Archive for the ‘Male Genetics’ Category

This report additionally covers the effect of COVID-19 on the worldwide market. The pandemic brought about by Coronavirus (COVID-19) has influenced each part of life all inclusive, including the business segment. This has brought along a several changes in economic situations.

This report focuses on the Global Male Breast Cancer Treatment Market trends, future forecasts, growth opportunities, key end-user industries, and market players. The objectives of the study are to present the key developments of the market across the globe.

Download Premium Sample of the Report:http://marketresearchbazaar.com/requestSample/58346

PfizerRocheGlaxoSmithKlineSanofiNovartisBayerBristol-Myers SquibbEli LillyAstraZenecaTeva PharmaceuticalSun PharmaceuticalBioNumerik PharmaceuticalsSeattle GeneticsAccord Healthcare

By Type:

MedicationChemotherapyOthers

By Application:

HospitalsClinicsOthers

Regional Analysis of the Male Breast Cancer Treatment Market:

Additionally, the report serves as a convenient guide to design and implement potential growth steering activities across select regional pockets in the Male Breast Cancer Treatment market. Frontline players and their effective growth strategies are also enlisted in the report to emulate growth.

North America (U.S., Canada, Mexico)

Europe (U.K., France, Germany, Spain, Italy, Central & Eastern Europe, CIS)

Asia Pacific (China, Japan, South Korea, ASEAN, India, Rest of Asia Pacific)

Latin America (Brazil, Rest of L.A.)

Middle East and Africa (Turkey, GCC, Rest of Middle East)

Customization of this Report: This Male Breast Cancer Treatment market report could be customized to the customers requirements. Please contact our sales professional ([emailprotected]), we will ensure you obtain the report which works for your needs.

Key Questions Answered in this Report:

What is the outlook for the Male Breast Cancer Treatmentindustry?This report has over a dozen market forecasts (2020 and the next 5 years) on the industry, including total sales, a number of companies, attractive investment opportunities, operating expenses, and others.

What industry analysis/data exists for the Male Breast Cancer Treatmentindustry?This report covers key segments and sub-segments, key drivers, restraints, opportunities, and challenges in the market and how they are expected to impact the Male Breast Cancer Treatmentindustry. Take a look at the table of contents below to see the scope of analysis and data on the industry.

How many companies are in the Male Breast Cancer Treatmentindustry?This report analyzes the historical and forecasted number of companies, locations in the industry, and breaks them down by company size over time. The report also provides company rank against its competitors with respect to revenue, profit comparison, operational efficiency, cost competitiveness, and market capitalization.

What is the market size of the Male Breast Cancer Treatmentindustry?This report covers the historical market size of the industry (2013-2020), and forecasts for 2020 and the next 5 years. Market size includes the total revenues of companies.

What are the financial metrics for the industry?This report covers many financial metrics for the industry including profitability, Market value- chain, and key trends impacting every node with reference to the companys growth, revenue, return on sales, etc.

What are the most important benchmarks for the Male Breast Cancer Treatmentindustry?Some of the most important benchmarks for the industry include sales growth, productivity (revenue), operating expense breakdown, span of control, organizational make-up. All of which youll find in this market report.

Request Customization of the Report:http://marketresearchbazaar.com/enquiry/58346

If you want to need latest primary and secondary data (2020-2026) with Cost Module, Business Strategy, Distribution Channel, etc. Click request free sample report, published report will be delivered to you in PDF format via email within 24 to 48 hours of receiving full payment.

Key Points from Table of Content:

1 Market Overview1.1 Product Definition and Market Characteristics1.2 Global Male Breast Cancer Treatment Market Size1.3 Market Segmentation1.4 Global Macroeconomic Analysis1.5 SWOT Analysis

2. Market Dynamics2.1 Market Drivers2.2 Market Constraints and Challenges2.3 Emerging Market Trends2.4 Impact of COVID-192.4.1 Short-term Impact2.4.2 Long-term Impact

3 Associated Industry Assessment3.1 Supply Chain Analysis3.2 Industry Active Participants3.2.1 Suppliers of Raw Materials3.2.2 Key Distributors/Retailers3.3 Alternative Analysis3.4 The Impact of Covid-19 From the Perspective of Industry Chain

4 Market Competitive Landscape4.1 Industry Leading Players4.2 Industry News4.2.1 Key Product Launch News4.2.2 MandA and Expansion Plans

5 Analysis of Leading Companies5.1 Company 15.1.1 Company 1 Company Profile5.1.2 Company 1 Business Overview5.1.3 Company 1 Male Breast Cancer Treatment Sales, Revenue, Average Selling Price and Gross Margin (2015-2020)5.1.4 Company 1 Male Breast Cancer Treatment Products Introduction

5.2 Company 25.2.1 Company 2 Company Profile5.2.2 Company 2 Business Overview5.2.3 Company 2 Male Breast Cancer Treatment Sales, Revenue, Average Selling Price and Gross Margin (2015-2020)5.2.4 Company 2 Male Breast Cancer Treatment Products Introduction

5.3 Company 35.3.1 Company 3 Company Profile5.3.2 Company 3 Business Overview5.3.3 Company 3 Male Breast Cancer Treatment Sales, Revenue, Average Selling Price and Gross Margin (2015-2020)5.3.4 Company 3 Male Breast Cancer Treatment Products Introduction

5.4 Company 45.4.1 Company 4 Company Profile5.4.2 Company 4 Business Overview5.4.3 Company 4 Male Breast Cancer Treatment Sales, Revenue, Average Selling Price and Gross Margin (2015-2020)5.4.4 Company 4 Male Breast Cancer Treatment Products Introduction

6 Market Analysis and Forecast, By Product Types6.1 Global Male Breast Cancer Treatment Sales, Revenue and Market Share by Types (2015-2020)6.2 Global Male Breast Cancer Treatment Market Forecast by Types (2020-2026)6.3 Global Male Breast Cancer Treatment Sales, Price and Growth Rate by Types (2015-2020)6.4 Global Male Breast Cancer Treatment Market Revenue and Sales Forecast, by Types (2020-2026)

7 Market Analysis and Forecast, By Applications7.1 Global Male Breast Cancer Treatment Sales, Revenue and Market Share by Applications (2015-2020)7.2 Global Male Breast Cancer Treatment Market Forecast by Applications (2020-2026)7.3 Global Revenue, Sales and Growth Rate by Applications (2015-2020)7.4 Global Male Breast Cancer Treatment Market Revenue and Sales Forecast, by Applications (2020-2026)

Request TOC: http://marketresearchbazaar.com/requestSample/58346

8 Market Analysis and Forecast, By Regions8.1 Global Male Breast Cancer Treatment Sales by Regions (2015-2020)8.2 Global Male Breast Cancer Treatment Market Revenue by Regions (2015-2020)8.3 Global Male Breast Cancer Treatment Market Forecast by Regions (2020-2026)Continued.

About (Market Research Bazaar):

Market Research Bazaar (MRB)- a part of VRRB Reports LLP is an overall Market Research and consulting organization. We give unparalleled nature of offering to our clients present all around the world crosswise over industry verticals. Market Research Bazaar has aptitude in giving profound jump showcase understanding alongside advertise knowledge to our clients spread across over different endeavours.

Media Contact:

Market Research Bazaar

UK: +442070973908

US: +13156360953

India: +919548234540

Email:[emailprotected]

Website:http://marketresearchbazaar.com/

Blog:http://marketresearchbazaar.com/blogs

Follows to Twitter :https://twitter.com/BazaarMrb

Follows to LinkedIn :https://www.linkedin.com/company/market-research-bazaar-vrrb/

Here is the original post:
Male Breast Cancer Treatment Market Size will Observe Substantial Growth by 2026 | Pfizer, Roche, GlaxoSmithKline, Sanofi, Novartis - The Daily...

By Zelda Venter 16h ago

Share this article:

Fans of the Rietvlei Nature Reserve are looking forward to the day they can be on the lookout for its two new cheetahs.

Njozi, a sub-adult female cheetah which arrived last month, now has a mate, a male sub-adult released in the popular Pretoria city reserve last week.

For now they cannot be seen by the visiting public as they are being kept in a cordoned-off boma to give them a chance to settle.

They will stay together in the reserve until it is time for the male to be relocated the hope is they will produce a litter, as was the case with previous cheetahs in the reserve.

The two took to each other like ducks to water, said Vincent van der Merwe of the Endangered Wildlife Trust (EWT), and they are settling and should be released into the wider reserve by the end of September.

Van der Merwe said it had been an anxious time when the male from Welgevonden was released as they did not know how Njozi would react. She had come from a family in the Western Cape and been skittish at first, but became more confident with time.

He said they were ready to separate the two if they got in a fight, but it was not necessary. Instead, Njozi called out to the male and when he approached, they licked one another.

They are very relaxed with each other and bonded nicely. Lets see how they adapt to their new surroundings when we release them, he said.

He described the new male as a beautiful animal with a mix of Karoo and Namibian genetics.

Knowledge of cheetahs has grown fast and the EWT has had success with its metapopulation project for the long-term viability of cheetahs in smaller fenced reserves, and with the long-term genetic and demographic integrity of the metapopulation across Africa.

Funds to support the project have come from CRC Industries, Q20 SA, Lions Club of Pretoria City and Strata Logistics.

In 2017, Kiara and Sabona produced a litter of three cubs, the first time cheetah cubs had been born in the reserve, and they were a hit with visitors until their relocation.

Link:
Public will soon be able to spot cheetahs in Rietvlei - IOL

Sept. 18, 2020 10:45 UTC

BOTHELL, Wash. & TOKYO--(BUSINESS WIRE)-- Seattle Genetics, Inc. (Nasdaq:SGEN) and Astellas Pharma Inc. (TSE: 4503, President and CEO: Kenji Yasukawa, Ph.D., Astellas) today announced that a phase 3 trial of PADCEV (enfortumab vedotin-ejfv) met its primary endpoint of overall survival compared to chemotherapy. The results were reviewed by an independent Data Monitoring Committee following a planned interim analysis. The global EV-301 clinical trial compared PADCEV to chemotherapy in adult patients with locally advanced or metastatic urothelial cancer who were previously treated with platinum-based chemotherapy and a PD-1/L1 inhibitor.

This press release features multimedia. View the full release here: https://www.businesswire.com/news/home/20200918005101/en/

PADCEV (enfortumab vedotin-ejfv) (Photo: Business Wire)

In the trial, PADCEV significantly improved overall survival (OS), with a 30 percent reduction in risk of death (Hazard Ratio [HR]=0.70; [95% Confidence Interval (CI): 0.56, 0.89]; p=0.001). PADCEV also significantly improved progression-free survival (PFS), a secondary endpoint, with a 39 percent reduction in risk of disease progression or death (HR=0.61 [95% CI: 0.50, 0.75]; p<0.00001).

For patients in the PADCEV arm of the trial, adverse events were consistent with those listed in the U.S. Prescribing Information, with rash, hyperglycemia, decreased neutrophil count, fatigue, anemia and decreased appetite as the most frequent Grade 3 or greater adverse event(s) occurring in more than 5 percent of patients. Data from EV-301 will be submitted for presentation at an upcoming scientific congress. Patients in the chemotherapy arm of the trial will be offered the opportunity to receive PADCEV.

The results will be submitted to the U.S. Food and Drug Administration (FDA) as the confirmatory trial following the drugs accelerated approval in 2019. EV-301 is also intended to support global registrations.

These survival results from the confirmatory trial for PADCEV are welcome news for patients whose cancer has progressed after platinum-based chemotherapy and immunotherapy, said Roger Dansey, M.D., Chief Medical Officer at Seattle Genetics. We continue to explore PADCEVs activity across the spectrum of urothelial cancer including its potential for use in earlier lines of therapy.

EV-301 is the first randomized trial to show overall survival results compared to chemotherapy in patients with locally advanced or metastatic urothelial cancer who previously have received platinum-based treatment and a PD-1 or PD-L1 inhibitor, and we are encouraged by the potential this may have in helping patients who have otherwise limited alternatives, said Andrew Krivoshik, M.D., Ph.D., Senior Vice President and Oncology Therapeutic Area Head, Astellas. We look forward to discussing these results with global health authorities.

Globally, approximately 580,000 people will be diagnosed with bladder cancer in 2020.1 Urothelial cancer accounts for 90 percent of all bladder cancers and can also be found in the renal pelvis (where urine collects inside the kidney), ureter (tube that connects the kidneys to the bladder) and urethra.2 Approximately 80 percent of people do not respond to PD-1 or PD-L1 inhibitors after a platinum-containing therapy has failed as an initial treatment for advanced disease.3

About the EV-301 Trial

The EV-301 trial (NCT03474107) is a global, multicenter, open-label, randomized phase 3 trial designed to evaluate PADCEV versus physician's choice of chemotherapy (docetaxel, paclitaxel or vinflunine) in approximately 600 patients with locally advanced or metastatic urothelial cancer who were previously treated with a PD-1 or PD-L1 inhibitor and platinum-based therapies. The primary endpoint is overall survival of participants treated with PADCEV compared to those treated with chemotherapy. Secondary endpoints include progression-free survival, duration of response, and overall response rate, as well as assessment of safety/tolerability and quality-of-life parameters.

For more information about the EV-301 clinical trial, please visit http://www.clinicaltrials.gov.

About PADCEV (enfortumab vedotin-ejfv)

PADCEV was approved by the U.S. Food and Drug Administration (FDA) in December 2019 and is indicated for the treatment of adult patients with locally advanced or metastatic urothelial cancer who have previously received a programmed death receptor-1 (PD-1) or programmed death-ligand 1 (PD-L1) inhibitor and a platinum-containing chemotherapy before (neoadjuvant) or after (adjuvant) surgery or in a locally advanced or metastatic setting. PADCEV was approved under the FDAs Accelerated Approval Program based on tumor response rate. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trials.4

PADCEV is a first-in-class antibody-drug conjugate (ADC) that is directed against Nectin-4, a protein located on the surface of cells and highly expressed in bladder cancer.4,5 Nonclinical data suggest the anticancer activity of PADCEV is due to its binding to Nectin-4 expressing cells followed by the internalization and release of the anti-tumor agent monomethyl auristatin E (MMAE) into the cell, which result in the cell not reproducing (cell cycle arrest) and in programmed cell death (apoptosis).4 PADCEV is co-developed by Astellas and Seattle Genetics.

PADCEV Important Safety Information

Warnings and Precautions

Adverse Reactions

Serious adverse reactions occurred in 46% of patients treated with PADCEV. The most common serious adverse reactions (3%) were urinary tract infection (6%), cellulitis (5%), febrile neutropenia (4%), diarrhea (4%), sepsis (3%), acute kidney injury (3%), dyspnea (3%), and rash (3%). Fatal adverse reactions occurred in 3.2% of patients, including acute respiratory failure, aspiration pneumonia, cardiac disorder, and sepsis (each 0.8%).

Adverse reactions leading to discontinuation occurred in 16% of patients; the most common adverse reaction leading to discontinuation was peripheral neuropathy (6%). Adverse reactions leading to dose interruption occurred in 64% of patients; the most common adverse reactions leading to dose interruption were peripheral neuropathy (18%), rash (9%) and fatigue (6%). Adverse reactions leading to dose reduction occurred in 34% of patients; the most common adverse reactions leading to dose reduction were peripheral neuropathy (12%), rash (6%) and fatigue (4%).

The most common adverse reactions (20%) were fatigue (56%), peripheral neuropathy (56%), decreased appetite (52%), rash (52%), alopecia (50%), nausea (45%), dysgeusia (42%), diarrhea (42%), dry eye (40%), pruritus (26%) and dry skin (26%). The most common Grade 3 adverse reactions (5%) were rash (13%), diarrhea (6%) and fatigue (6%).

Lab Abnormalities

In one clinical trial, Grade 3-4 laboratory abnormalities reported in 5% were: lymphocytes decreased (10%), hemoglobin decreased (10%), phosphate decreased (10%), lipase increased (9%), sodium decreased (8%), glucose increased (8%), urate increased (7%), neutrophils decreased (5%).

Drug Interactions

Specific Populations

For more information, please see the full Prescribing Information for PADCEV here.

About Seattle Genetics

Seattle Genetics, Inc. is a global biotechnology company that discovers, develops and commercializes transformative medicines targeting cancer to make a meaningful difference in peoples lives. The company is headquartered in the Seattle, Washington area, with locations in California, Switzerland and the European Union. For more information on our robust pipeline, visit http://www.seattlegenetics.com and follow @SeattleGenetics on Twitter.

About Astellas

Astellas Pharma Inc. is a pharmaceutical company conducting business in more than 70 countries around the world. We are promoting the Focus Area Approach that is designed to identify opportunities for the continuous creation of new drugs to address diseases with high unmet medical needs by focusing on Biology and Modality. Furthermore, we are also looking beyond our foundational Rx focus to create Rx+ healthcare solutions that combine our expertise and knowledge with cutting-edge technology in different fields of external partners. Through these efforts, Astellas stands on the forefront of healthcare change to turn innovative science into value for patients. For more information, please visit our website at https://www.astellas.com/en.

About the Seattle Genetics and Astellas Collaboration

Seattle Genetics and Astellas are co-developing PADCEV (enfortumab vedotin-ejfv) under a 50:50 worldwide development and commercialization collaboration that was entered into in 2007 and expanded in 2009.

Seattle Genetics Forward Looking Statements

Certain statements made in this press release are forward looking, such as those, among others, relating to the submission of data from the EV-301 trial for presentation at an upcoming scientific congress; intended regulatory actions, including plans to submit the results of the EV-301 trial to the FDA as the confirmatory trial following the drugs accelerated approval in the U.S. and plans to discuss the results with global health authorities and seek global registrations; conduct of a comprehensive clinical development program for PADCEV, which includes exploring PADCEVs activity in other types of urothelial cancer and its potential for use in earlier lines of therapy; the therapeutic potential of PADCEV, including its efficacy, safety and therapeutic uses, and anticipated development activities, including ongoing and future clinical trials. Actual results or developments may differ materially from those projected or implied in these forward-looking statements. Factors that may cause such a difference include that the data from the EV-301 trial may not be selected for presentation at scientific congresses; the possibility of delays in the submission of results to the FDA; that the results from the EV-301 trial may not be enough to convert PADCEVs accelerated approval in the U.S. to regular approval or to support any other global registrations; that, even if PADCEV receives regular approval in the U.S. or any other global registrations, the product labeling may not be as broad or desirable as anticipated; the possibility that ongoing and subsequent clinical trials may fail to establish sufficient activity; the risk of adverse events or safety signals; and the possibility that adverse regulatory actions may occur. More information about the risks and uncertainties faced by Seattle Genetics is contained under the caption Risk Factors included in the companys Quarterly Report on Form 10-Q for the quarter ended June 30, 2020 filed with the Securities and Exchange Commission. Seattle Genetics disclaims any intention or obligation to update or revise any forward-looking statements, whether as a result of new information, future events or otherwise, except as required by law.

Astellas Cautionary Notes

In this press release, statements made with respect to current plans, estimates, strategies and beliefs and other statements that are not historical facts are forward-looking statements about the future performance of Astellas. These statements are based on managements current assumptions and beliefs in light of the information currently available to it and involve known and unknown risks and uncertainties. A number of factors could cause actual results to differ materially from those discussed in the forward-looking statements. Such factors include, but are not limited to: (i) changes in general economic conditions and in laws and regulations, relating to pharmaceutical markets, (ii) currency exchange rate fluctuations, (iii) delays in new product launches, (iv) the inability of Astellas to market existing and new products effectively, (v) the inability of Astellas to continue to effectively research and develop products accepted by customers in highly competitive markets, and (vi) infringements of Astellas intellectual property rights by third parties.

Information about pharmaceutical products (including products currently in development), which is included in this press release is not intended to constitute an advertisement or medical advice.

1 International Agency for Research on Cancer. Cancer Tomorrow: Bladder. http://gco.iarc.fr/tomorrow. Accessed 07-31-2020.2 American Society of Clinical Oncology. Bladder cancer: introduction (10-2017).3 Shah, Manasee V., et al Targeted Literature Review of the Burden of Illness in UC (PCN108), Nov 2018.4 PADCEV [package insert] Northbrook, IL: Astellas, Inc.5 Challita-Eid P, Satpayev D, Yang P, et al. Enfortumab Vedotin Antibody-Drug Conjugate Targeting Nectin-4 Is a Highly Potent Therapeutic Agent in Multiple Preclinical Cancer Models. Cancer Res 2016;76(10):3003-13.

View source version on businesswire.com: https://www.businesswire.com/news/home/20200918005101/en/

Go here to see the original:
Seattle Genetics and Astellas Announce PADCEV (enfortumab vedotin-ejfv) Significantly Improved Overall Survival in Phase 3 Trial in Previously Treated...

(Sep, 2020) United Kingdom, The report titled Male Breast Cancer Treatment Market: Size, Trends and Forecasts (2020-2026), delivers an in-depth analysis of the Male Breast Cancer Treatment Industry by considering there type, application, market value, by production capacity, by companies, by region, etc.

The report assesses the key opportunities in the market and outlines the factors that are and will be driving the growth of the Male Breast Cancer Treatmentindustry. Growth of the overall Male Breast Cancer Treatmentmarket has also been forecasted for the period 2020-2026, taking into consideration the previous growth patterns, the growth drivers and the current and future trends.

Get Exclusive Sample copy on Male Breast Cancer Treatment Marketis available athttps://www.worldwidemarketreports.com/sample/366541

Male Breast Cancer TreatmentMarket report analyses the impact of Coronavirus (COVID-19) on theMale Breast Cancer Treatmentindustry.

Our analysts monitoring the situation across the globe explains that the market will generate remunerative prospects for producers post COVID-19 crisis. The report aims to provide an additional illustration of the latest scenario, economic slowdown, and COVID-19 impact on the overall industry.

The outbreak of COVID-19 has brought effects on many aspects, like flight cancellations; travel bans and quarantines; restaurants closed; all indoor events restricted; emergency declared in many countries; massive slowing of the supply chain; stock market unpredictability; falling business assurance, growing panic among the population, and uncertainty about future.

COVID-19 can affect the global economy in 3 main ways: by directly affecting production and demand, by creating supply chain and market disturbance, and by its financial impact on firms and financial markets.

If you are investor/shareholder in theMale Breast Cancer TreatmentMarket, the provided study will help you to understand the growth model ofMale Breast Cancer TreatmentIndustry after impact of COVID-19. Request for sample report (including ToC, Tables and Figures with detailed information) @https://www.worldwidemarketreports.com/covidimpact/366541

The research report segments the market from a relevancy perspective into the below segments and sub-segments with the quantitative analysis done from 2017 to 2026 considering 2019 as the base year for the research. Compounded Annual Growth Rate (CAGR) for each respective segment and sub-segment is calculated for the forecast period from 2019 to 2026 to provide a reference for growth potential.

Male Breast Cancer Treatmentmarket segmented on the basis of Product Type:Medication, Chemotherapy, Others

Male Breast Cancer Treatmentmarket segmented on the basis of Application: Hospitals, Clinics, Others

The major players profiled in this report include:Pfizer, Roche, GlaxoSmithKline, Sanofi, Novartis, Bayer, Bristol-Myers Squibb, Eli Lilly, AstraZeneca, Teva Pharmaceutical, Sun Pharmaceutical, BioNumerik Pharmaceuticals, Seattle Genetics, Accord Healthcare

Get Chance of 20% Extra Discount, If your Company is Listed in Above Key Players List;https://www.worldwidemarketreports.com/discount/366541

Regional Coverage of theMale Breast Cancer TreatmentMarket:

Reasons to PurchaseMale Breast Cancer TreatmentMarket Research Report

:DOWNLOAD COMPLETE PDF BROCHURE:

Contact Us:

Mr. ShahWorldwide Market ReportsSeattle, WA 98154,U.S.Email: [emailprotected]

See more here:
Global Male Breast Cancer Treatment Market to Rise at a CAGR of XX% Due to COVID-19 Outbreak Exclusive Report Covering: Pfizer, Roche,...

Rita Colwell is a pioneering microbiologist whose work on cholera helped illuminate the interplay between the environment and public health. She was also the first woman to serve as director of the National Science Foundation, and is currently a Distinguished University Professor at both the University of Maryland and Johns Hopkins Universitys Bloomberg School of Public Health.

In her half-century-plus in the sciences, Colwell has also seen very clearly the array of obstacles confronted by women as they try to navigate a traditionally male world. (When she applied for a graduate fellowship in bacteriology, she says was told, We dont waste fellowships on women.)

A Lab of Ones Own: One Womans Personal Journey Through Sexism in Science, by Rita Colwell and Sharon Bertsch McGrayne (Simon & Schuster, 288 pages).

Colwells new book, A Lab of Ones Own, co-authored with writer Sharon Bertsch McGrayne, documents much of what she has seen and heard over the years, from sexual harassment to the invisible structural obstacles placed in the way of women working in the sciences. (The books subtitle is One Womans Personal Journey Through Sexism in Science.)

Not long ago, women were discouraged from studying science at all; those who did pursue such studies were seen as oddities. Later, when the numbers of women earning science degrees began to rise, they found themselves receiving less funding than their male colleagues, and less likely to land a position as a professor or a lab director. (It wasnt that long ago, Colwell recalls, when a grant application could be turned down because a man on the granting committee simply didnt like women scientists.) But Colwell also found allies along the way, and her book is something of a celebration of what can be achieved when science strives for inclusivity.

The following interview has been edited for length and clarity.

UNDARK: Though sexism has a long history, you write that the 1950s and 60s saw unprecedented levels of sexism in the sciences. What was going on at that time?

Rita Colwell: The attitude was, a woman worked in the home period. A woman couldnt even get a credit card in her own name; she had to have her husband, or her father, vouch for her. In general, the understanding was, if you were [a woman] interested in science, that was peculiar. It wasnt unusual for women to go to college but most did not go from there into any kind of work, unless it was nursing or teaching. It was a very limiting time, for women. A lot of this was unspoken; it was just sort of assumed.

UD: Regarding graduate education, you say that women were simply seen as not worth investing in. What does that mean?

RC: The expectation was that you would get married and have children. If you werent there, with your children, you were seen as a bad mother. You went to college to find a husband; that was the expectation.

UD: You point out that not only could one face obstacles for being a woman Ph.D. student, you could face a backlash if you supervised too many women Ph.D. students. What was that about?

RC: The assumption was that anyone who was really brilliant, with great ideas, would work for a male professor. So if you took women students, it was assumed they werent the best and the brightest. Having women students would mark you as not serious; your students were just going to get married, and youre just wasting all this time.

UD: As you say, a lot of this was unspoken but eventually there was solid data to quantify this discrimination. How did that come about?

RC: It was in the 90s that Nancy Hopkins at MIT carried out her now-famous experiment: She measured the labs, and discovered that the men had almost twice as much space; they also got the bulk of the research money. More women were entering these careers [in the sciences], but men got most of the funding and most of the space.

Later, Jo Handelsman did the experiment where they sent identical letters to male researchers [from recent graduates applying to be a lab manager], the only difference was that some were signed John and others were signed Jennifer. The question was, would you hire this person, and what would you pay them? Far fewer said they would hire the woman; and the salary they were prepared to offer was much, much lower.

But Id like to emphasize one thing: Once I was able to break through, at each stage of my career, there was tremendous support. My father was very education-minded; it didnt matter if you were a girl or a boy; everyone went to school. My husband, a physicist, was a fantastic supporter; we were married for 62 very happy years. And my Ph.D. supervisor, John Liston, was absolutely the best. He was a newcomer to the University of Washington, starting a new program in marine microbiology so I ended up being the first graduate student with a Ph.D. in marine microbiology, possibly in the whole United States.

The assumption was that anyone who was really brilliant, with great ideas, would work for a male professor. So if you took women students, it was assumed they werent the best and the brightest.

UD: Youre known for your groundbreaking work on cholera, but it was also fascinating to read about your work investigating the 2001 anthrax attacks, in which a number of politicians and journalists were mailed packages containing the deadly substance in the weeks following the 9/11 attacks. How did you end up on the front lines of that investigation?

RC: I was appointed [as director of the National Science Foundation] by Bill Clinton, and I served two years under Clinton and four under George W. Bush. In October or November [of 2001], we heard about anthrax attacks. I remember saying, Weve got to sequence that bacterium, or well never know who did it.

I had been working on an advisory board for the CIA, so I was able to call on some colleagues, and we formed an inter-agency group. We decided not to make the group official, so that we could keep it a secret. And we worked for five years on this classified project. And using molecular genetics, we tracked down the source. Now, well never know whether the perpetrator was in fact Bruce Ivins, and if he worked alone, or with others. [Ivins died in 2008.] He was an anthrax microbiologist, and the source turned out to be in his lab.

UD: You were using a computer in the late 1950s, long before they became ubiquitous in the life sciences. Did you have a sense that computers would eventually impact every branch of science?

RC: At the University of Washington, I wrote a computer program the first in the country, for bacteriology using the old IBM 650, which has less power than the chip in your microwave oven. When I was working with that computer, I had to program it, and I didnt know diddly. But in my husbands lab, there was a postdoc named George Constabaris, who taught me. And there was another chap who was using the IBM to do pipe-fitting for the ships in Seattle harbor. He was programming how to cut and fit pipe most efficiently.

So it was clear to me that this was an amazing tool. I used the computer for taxonomic purposes, for identification which now everybody does. Its amusing I used to give talks about species of bacteria, and people would yawn. But now the hotshots in Silicon Valley know the differences between different kinds of bacteria. It was clear to me that we had to have massive computation [in the sciences]. I was able to get into the NSF budget, over my term, $2 billion, for computation, for universities to start building the internet railway, so to speak.

UD: So much has changed in science, and in the culture of science, over your career. Today, are you optimistic or at least, more optimistic?

RC: I would say its cautious optimism. I dont know whats going to happen in the next administration; it could be a disaster for women. I strongly encourage girls to go into science. I abhor the assumption that girls cant do math; its absurd. Or that if youre African American you cant do math or you cant do science its crazy. Theres still sexism, which ranges from the criminal to the clueless. Like when someone comments to a woman scientist as shes going up to the podium to give a talk, that she looks attractive. Thats the last thing you want to hear. You want to hear Thats a great idea, or Can we collaborate on the next stage of this experiment?

More:
The Undark Interview: A Conversation with Rita Colwell - Undark Magazine

When I was younger, the Hollywood blockbuster The Mummy enraptured and captured my attention like few other movies did. Its mesmerising mixture of Egyptian myth and cinematic mayhem sparked a lifelong fascination in me for mysterious, ancient civilisations.

However, one thing I noticed over the years was how Malaysia and Southeast Asia were largely absent from the discussion when it came to ancient civilisations. There were tales about the Sumerians, Babylonians, Egyptians, Indians, and Chinese but never Malaysians or rather those who inhabited Malaysia at the time.

For a long time, we were thought to be at the periphery of prehistory, so we were often relegated to a footnote, and sometimes not even that. Our history textbooks certainly didnt help they concentrated the bulk of their focus on the Malacca sultanate and the events that followed after (post-1400 AD), dedicating just a few cursory sections to powerful regional kingdoms that predated it such as Langkasuka, Majapahit, Srivijaya, and Kedah Tua. Their details on prehistory are even abysmally scantier.

When I dug deeper, I realised why. In addition to there being little archaeological, geological, and literary evidence to go by, the prevailing scientific consensus was that those who came to inhabit the Malay peninsula and Borneo were descendants of ancient argonauts from Taiwan who colonised Malaysia and other parts of Southeast Asia only as recently as 4,000 years ago.

Called the Out-of-Taiwan Theory, it was largely based on exiguous archaeological findings and linguistic population mapping. Since we were considered a relatively young offshoot culture who inherited agriculture and other neolithic technology from the seafaring ancient aboriginal Taiwanese (the Formosans), we were not of much interest to many prehistorians and archaeologists.

But a potentially paradigm-shifting theory posited by Oxford geneticist Stephen Oppenheimer threatens to upend this long-standing view. While his predecessors used archaeology, geology, and linguistics to investigate the subject, Oppenheimer and his colleagues have added a new, powerful tool to the mix genetics.

The key to the theory is the study of the often marginalised and sometimes even criminally disenfranchised Orang Asli.

Oppenheimer and his colleagues pored through the Orang Aslis female mtDNA (mitochondrial DNA) and the male Y chromosome the two components of the human genetic code that dont get shuffled like nuclear DNA does during reproduction, hence maintaining their purity and making them powerful portals into our past.

Thanks to this study and the discovery of many other geological, linguistic, and archaeological markers, a new theory that reverses and predates the Out-of-Taiwan Theory has emerged. Its called the Out-of-Sundaland Theory.

This groundbreaking theory puts Malaysia and Southeast Asia at the heart of prehistoric innovation and civilisation and makes the Orang Asli the probable progenitors of the ancient cultures that would go on to dominate the world.

According to the theory, there was a single migration of anatomically modern humans out of Africa around 80,000 years ago. These pioneering beachcombers traversed the Arabian and Indian coasts, eventually making it to the lands now known as Malaysia and Southeast Asia around 60,000 years ago.

Oppenheimer says: The ancestors of the three Orang Asli groups (the Senai, Semang, and Proto-Malays) in the Malay peninsula arrived in the vanguard. They (the Orang Asli) descended from the very first people who put foot in this region in Malaya.

But when the ancestors of the Orang Asli set foot here, Malaysia didnt look like it does now far from it. At the time, it wasnt a snaking peninsula with a large island on the east.

Instead, it was part of a gargantuan, trunk-like subcontinent double the size of India the result of sea levels being at least 120 metres lower than they are currently. This means that modern-day Malaysia, Thailand, Indonesia, Singapore, and all the now-submerged land between them were connected and formed one solid, massive peninsula.

This majestic, prehistoric landmass is aptly called Sundaland Sund being the Sanskrit term for an elephants trunk.

Thanks to its fortuitously strategic geography, where it hugs the equator and is flanked by the sea, it was Eden-like full of dense, life-sustaining vegetation, frequent rainfall, and populated by animals of all kinds. Many of our ancestors, presumably enamored of this newly-found Suvarnabhumi, stayed put.

But all that changed around 14,000 years ago when rapidly melting ice unleashed cataclysmic floods, and maybe even tsunamis, which inundated many parts of the world. Large swaths of the low-lying coasts of Sundaland were especially badly battered and permanently submerged due to it.

Subsequently, two more massive flooding events took place around 11,500 years ago and 8,000 years ago, further swallowing up the elephantine landmass and eventually turning it into what it is today Peninsular Malaysia, the island of Borneo, the Indonesian Archipelago, and Singapore.

These bouts of cosmic angst unsurprisingly caused a mass exodus from the region. Genetic marker links indicate that migrant bands from Sundaland travelled to and colonised many parts of the world, including Eastern Europe, the Middle East, India, China, Korea, and New Guinea.

And when they did, they carried with them the seeds of civilisation that might have gone on to fertilise the great ancient cultures of the world, including Mesopotamia, Egypt, and India.

Dr Sangkot Marzuki of the Eijkman Institute in Jakarta encapsulates it well when he says: Southeast Asia is the place of origin from which modern man spread out to the rest of the world, after Africa.

Oppenheimer zeroes in on the location of the dispersion even further, saying that the genetic evidence for the spread of people from Southeast Asia round the Pacific Rim points to two Aboriginal areas, Sabah in northeast Borneo and the jungles of the Malay Peninsula.

In light of this groundbreaking scientific revelation, its about time we celebrated the Orang Asli and their ancient way of life, instead of looking at them as irrelevant relics of the past and relegating them to the sidelines of society.

Its about time we embraced and learned from these genetic and cultural time-capsules. After all, the Orang Asli provide a window into our forgotten past and are the proud custodians of tens of thousands of years of wisdom something few other cultures can lay claim to today.

And its definitely about time we invested a lot more money and dedicated a lot more academic firepower into studying the rich prehistory of our homeland. If we did, who knows what we would uncover next.

The views expressed are those of the author and do not necessarily reflect those of FMT.

Link:
Is Malaysia the cradle of civilisation? | Free Malaysia Today - Free Malaysia Today

By: Lifestyle Desk | New Delhi | Updated: September 19, 2020 12:36:00 pmPCOS is so common in women intheir 20s that every 1 in 5 women go through it, while endometriosis is diagnosed in women, who are inbetween their 30s and 40s, said the expert. (Photo: Getty Images/Thinkstock)

Women often end up ignoring their health, and this can sometimes lead to serious issues like a reproductive disorder. It has been seen that health conditions like PCOS (Polycystic Ovarian Syndrome) and endometriosis are often gone undiagnosed as women feel that certain symptoms are variations of a normal menstrual cycle. PCOS is so common in women in their 20s that every 1 in 5 women go through it, while endometriosis is diagnosed in women, who are in between their 30s and 40s, said Dr Sandeep Chadha, consultant obstetrician and gynecologist, Motherhood Hospital, Noida.

Here are some differences and similarities between the two, and when its time to visit your doctor:

What is PCOS?

PCOS is a common hormonal disorder in women in which ovaries produce too many male hormones resulting in irregular or absent menstrual periods, weight gain, hair growth in unusual places like your face, neck, or abdomen, thinning hair on your scalp, acne on your face, chest, or back, and infertility issues.

But with the changing times, there has been difficulty in diagnosis of the condition. Experts suggest that they have been seeing many such women, who do not have all the classic symptoms but they still have been diagnosed with PCOS. While the cause of PCOS is still unclear, but genetics are thought to play a role and high levels of insulin and androgens exacerbate the problem. Excess insulin, which can lead to weight gain, is thought to boost androgen production in the ovaries. So, you are more prone to developing this disorder if you have a family history of PCOS, obesity or diabetes, she told indianexpress.com.

What is endometriosis?

Endometriosis is a condition in which the lining of the uterus, known as endometrium, grows outside the uterus or on other areas such as the ovaries, the outer surface of the uterus, the fallopian tubes, the vagina, the cervix, or even on the bladder or rectum. If a woman has the condition, she will have immensely painful periods with pelvic and lower back pain, pain during or after intercourse, pain while using the bathroom, excessive bleeding, digestive problems, and infertility are also common symptoms.

With a typical menstrual cycle, your endometrium thickens, breaks down, bleeds, and exits your body through the uterus each month. Like PCOS, endometriosis can be difficult to diagnose. Endometriosis is also challenging to diagnose because some women will have no symptoms, and other women who have all of the symptoms above may not necessarily have endometriosis. The exact reason behind endometriosis is also unknown. There are several theories, but none explain all aspects of the disorder, she explained.

Can you have both?

Unfortunately, you can have both, said the expert. She added that many mix-and-match possibilities can present themselves in women suffering from both, but the most common overlapping symptom is infertility.

ALSO READ | Count on these handy tips to prevent and manage polycystic ovarian syndrome

The regularity of your menstrual cycle and hormone testing can help differentiate between the two conditions. It is more common to see endometriosis present in women with regular cycles. However, if a patient with PCOS reports significant pelvic pain, this raises the possibility of another condition being present with PCOS, such as uterine fibroids or endometriosis, since PCOS does not cause pain during periods, she said.

However, any time if you experience especially painful or irregular cycles, notice abnormal hair growth, or struggle with infertility, then its time to visit your doctor.

What you can do

There are no known cures for PCOS or endometriosis, but both are treatable and the symptoms can be managed once correctly diagnosed. PCOS can be managed through hormonal birth control pills, which can help level hormones and therefore regulate periods. If youre trying to get pregnant and cant take birth control, then a doctor suggests some hormone therapy medications. For endometriosis, you can take an extended-cycle pill, which means you have a few periods or eliminating your period completely. A hormonal intrauterine device (IUD) is another option. It can be inserted to help reduce pain and bleeding. Surgery for endometriosis may improve your chances of pregnancy, depending on how extensive the condition has become, she said.

The Indian Express is now on Telegram. Click here to join our channel (@indianexpress) and stay updated with the latest headlines

For all the latest Lifestyle News, download Indian Express App.

IE Online Media Services Pvt Ltd

Read the original post:
PCOS and Endometriosis: How to spot the signs - The Indian Express

IRVINE, Calif.--(BUSINESS WIRE)--Please replace the release issued September 10, 2020 with the following corrected version due to multiple revisions.

The updated release reads:

APPLIED BIOLOGY IN COLLABORATION WITH CORPOMETRIA INSTITUTE TO LAUNCH ANTI-ANDROGEN CLINICAL STUDY FOR THE TREATMENT OF COVID-19 (ANDROCOV TRIAL)

Breakthrough Discovery by Applied Biology Scientists Paves Way for a Generic Anti-androgen as a Treatment For COVID-19

While studying the genetics of the androgen receptor in male pattern baldness, a team of scientists discovered a possible breakthrough treatment for COVID-19.

The team led by Andy Goren, MD and John McCoy, PhD from Applied Biology along with other collaborators have published their discovery in the medical journal Dermatologic Therapy. The manuscript, What Does Androgenetic Alopecia have to do with COVID-19? An Insight into a Potential New Therapy (doi: 10.1111/dth.13365), elucidates the possible role of androgens in controlling the infectivity of SARS-CoV-2 in human lung cells.

According to Dr. Goren our earlier discovery potentially links SARS-CoV-2 infectivity to androgens, the same hormones implicated in male pattern baldness and prostate cancer.

To test their hypothesis, the team has joined efforts with renowned endocrinologist Flavio A. Cadegiani, MD, MSc, PhD. Dr. Cadegiani is the medical director of the Corpometria Institute in Brazil. Currently, Brazil is the epicenter of the COVID-19 pandemic. According to Dr. Cadegiani: I am excited to participate in the international effort to study anti-androgens in COVID-19. More information about the study (ClinicalTrials.gov Identifier: NCT04446429) is available at clinicaltrials.gov (https://clinicaltrials.gov/ct2/show/NCT04446429?term=NCT04446429&draw=2&rank=1)

ABOUT APPLIED BIOLOGYFounded in 2002, Applied Biology, Inc. (www.appliedbiology.com), headquartered in Irvine, California, is a biotechnology company specializing in hair and skin science. Applied Biology develops breakthrough drugs and medical devices for the treatment of androgen mediated dermatological conditions. Applied Biology's R&D pipeline includes a topically applied prophylactic treatment for chemotherapy induced alopecia; a novel diagnostic device that can aid dermatologists in identifying non-responders to topical minoxidil; an adjuvant therapy for non-responders to topical minoxidil; and a novel therapy for female pattern hair loss.

Read more from the original source:
CORRECTING and REPLACING Applied Biology in Collaboration with Corpometria Institute to Launch Anti-Androgen Clinical Study for the Treatment of...

We are not born violent. Outside factors depict who we become. Like John Locke theorized, we are born with a blank slate. Some scientists propose that humans are innately violent. For example, David Carrier hypothesized that human hands evolved for us to be better fighters. However, there is evidence from other anthropologists, like Douglas Fry, proving that humans can make peace without resorting to violence.

Chimpanzees and bonobos are our closest relatives. Some scientists argue that humans, especially males, are inherently violent like chimpanzees. While male chimps fight for territory and females, bonobos tend to be more peaceful and share meat. Bonobos are female-dominated troops, so males may be less violent due to reduced competition for mating. It seems most violence from chimps stems from competition for limited resources. One study showed that bonobos are kind and generous to those outside of their groups. Behavior like this is not typically seen in chimps, who are aggressive to outsiders, while bonobos are usually not. Humans are more like bonobos than chimps: they want to collaborate and make peace with one another. In society today, most developed countries no longer need to fight for resources. Instead, we work together through trade and peace treaties.

The environment shapes our nature. For example, Brad Bushman and L. Huesmann studied how violence in mass media affects adults and children. They found that children will experience long-term effects of aggression because they mimic their environment. They explained that through classical conditioning, a child may then react with inappropriate fear or anger in a novel situation that is similar to one that the child has observed in the media. Adults may experience long-term effects of violence depending on their past exposure to aggression.

Viewing violence in mass media desensitizes us to it. We become less sympathetic to others and more antisocial. People are not innately violent: what we learn and observe can make us violent.

What we experience and learn makes us who we are. People become violent, angry, and fearful because of what they see in mass media and real situations. One literature review on how child abuse affects a childs behavior revealed that physically abused children have structural brain changes proving that outside factors shape our minds. Children who were abused tend to show the following signs: fighting with others, suicidal thoughts, poor grades, anxiety, depression, high probability to commit crimes such as underage drinking, drug use, etc. This means that our experiences help determine our behavior. Children who were abused may be more violent or rebellious because of their upbringing, not because they were born with a violent nature.

Some scientists also argue that genetics help determine our behavior. For example, genetics shape our personalities, and in some cases, affect our behaviors and attitudes. However, as we have different experiences over time, our personalities may change. Why? Because outside influences affect our behavior. Brent Roberts and Daniel Mroczek studied the changes in personalities from youth to adulthood. They explained that our personalities usually change as we grow older. For instance, someone who was an introverted teen may become more extroverted as they get older depending on their experiences.

In one experiment, scientists studied 3-month-old infants reactions to two different scenarios: one with a Climber trying to reach the top of a hill where a Helper pushed them up or a Hinderer pushed them down the hill, and the other control scenario with inanimate objects. Results showed that 10 out of 12 children valued the Helper while five out of 12 liked the Pusher-Upper inanimate object. The research proved that infants can interpret positive social cues and motivations, such as the Helper guiding the Climber up the hill.

The way we are raised and what we experience shapes us. We mimic our environment; if we see violence, we may become violent and reflect negative emotions.

See the original post here:
Opinion: Be it resolved human nature is not violent - The Appalachian Online

What are the symptoms for prostate cancer? Heres the thing you probably wont notice any.

Prostate cancer is not symptomatic until late, so screening is important, Dr. Michelle Yu, a urologic oncology fellow at University of Pittsburgh Medical Center, told TODAY.

Symptoms of prostate cancer may include:

Yu said that by the time men notice such symptoms the cancer has likely spread to other parts of the body and will be a lot harder to treat. (Of course, some of these symptoms could be caused by other conditions.)

Cancer of the prostate develops when cells in the prostate, a gland thats important for male reproduction, grow abnormally. This type of cancer often progresses slowly.

One in nine men get it its incredibly common, said Dr. Rana McKay, an assistant clinical professor at University of California San Diego and a spokesperson for the Prostate Cancer Foundation (PCF). Because of the type of disease this is theres some stigma. We need to be raising awareness.

A lot of high-profile men have helped increase awareness of prostate cancer by coming forward with their own stories about screening, diagnosis and treatment.

Some high-profile men who've had prostate cancer include:

Trending stories,celebrity news and all the best of TODAY.

The good news? Screening is easy and effective. The most important thing is screening, McKay said.

Prostate cancer is one of those diseases where early screening and early detection improves outcomes. The PCF reports that about 95% of prostate cancers are detected before the cancer has spread outside of the prostate.

And the survival rate from prostate cancers is 99% after five years. The good news is, the majority of people diagnosed with prostate cancer dont die of their disease, given the effectiveness of treatment, McKay said.

Your doctor can help evaluate your risk and recommend the best time to start screenings.

According to the PCF, screenings generally start at:

The number one thing men can do is to ask their doctor if they are eligible to be screened, McKay said.

To screen for prostate cancer, your doctor will perform a digital rectal exam (DRE). This test involves inserting a gloved finger into your rectum to feel for any irregularities in the prostate. The test might be uncomfortable, but its brief, and its an important step toward uncovering prostate cancer early.

Your doctor will also check your blood to measure prostate specific antigen (PSA) levels. PSA levels go up when theres a problem with the prostate that problem could be prostate cancer, an infection or another condition.

What are causes of prostate cancer? Its not clear exactly. Genetics and environmental factors both play a role, McKay said. One in 10 men have a genetic predisposition for prostate cancer.

Diet, exercise and quitting smoking can help decrease your risk for developing prostate cancer. Choose a diet lower in fat and processed carbohydrates, and maintain a healthy body weight to help reduce your risk of developing more aggressive prostate cancer.

Also, some studies show that having sex frequently can lower your risk.

If your DRE shows an abnormality or your PSA has elevated numbers, your doctor will probably recommend a biopsy of the prostate and may recommend an MRI or other imaging studies as well.

If youre diagnosed with prostate cancer, you have a range of treatment options to consider based on your age, overall health and how early your cancer was caught the stages of prostate cancer vary depending on how it has advanced.

The treatment landscape is rapidly evolving, McKay said. In the last decade theres been the introduction of many more drugs that work better and make people live longer and live better.

Treatment options include prostate cancer surgery, radiation therapy, chemotherapy and hormone treatment. Your doctor could also recommend active surveillance, which involves monitoring your cancer for signs that its progressing.

Ask your provider any questions, Yu said, and take charge of your own health discussion.

See more here:
Prostate cancer symptoms: The warning signs you need to know - TODAY

The process of scientists trying to understand how the coronavirus operates has been likened to detectives investigating a crime. To better understand the perpetrator, they first had to uncover its modus operandi in the human body, i.e. which cells it targets, and why.

These hotspots have recently been mapped in a study published in Cell Reports, where 28 SARS-CoV-2 and coronavirus-associated receptors and factors (SCARFS) were investigated as "accomplices" to the virus, serving as gateways for infection into various organ cells.

READ | Why check-ups for Covid-19 recoveries are important

Cause of death

Let's start with cause of death. Post-mortems confirm that victims had major lung damage inflicted by Covid-19-induced pneumonia. It also wreaks havoc on the heart, kidney, liver and gastrointestinal tract, and has been proven to havesome neurological impact on the brain.

"What causes the wide range of clinical phenotypes observed in people infected with SARS-CoV-2 is not yet understood," write the investigative scientists.

"It remains unclear which of these pathologies are caused by direct infection of the organs affected or indirect effects mediated by systemic inflammatory responses or comorbidities. A prerequisite to resolving these questions is to gain a better understanding of the tropism of the virus, i.e. which tissues and cell types are permissive to SARS-CoV-2 infection."

Partners in crime

This means that some cells have more coronavirus-friendly receptors than others, and are more willing to "invite the wolf in", especially when primed bycellular protease. In the case of this virus, scientists have already identified ACE2 receptors andTMPRSS2 protease as the most common "partners in crime".

But the researchers say there have to be more players at work due to the virus's high infection rate, which is what they undertook to investigate.

READ MORE | Could the MMR vaccine help prevent Covid-19? New trial may tell

Following your nose

For them, the real battle for infection takes place in the nose, more specifically, the nasal epithelium.

"The nasal epithelium expresses various combinations of factors that, in principle, could facilitate SARS-CoV-2 infection, but it also expresses robust basal levels of resistant factors, which may act as a strong protective barrier in this tissue."

Age may also have an impact on the nasal epithelium's ability to fight off the infection, where the protease undergoes a shift in regulation in young individuals.

Moving through the rest of the body, goblet and absorptive cells in the intestines and proximal tubule cells in the kidneys are more welcoming of the virus, with infection also found in the brain and lungs.

Men are the main target

Male parts like spermatogonial cells in the testes and prostate endocrine cells are also easily targeted by the coronavirus, which might explain men's vulnerability to the Covid-19. In contrast, in women, the ovaries and their cells are highly unlikely to be infected.

However, embryonic and placental development are at moderate risk of infection in pregnant women, but further research is needed.

"Because the basal expression level of these factors determines, at least in part, the tropism of the virus, this information is foundational to predict which tissues are more vulnerable to infection. These data are also important to guide and prioritise clinical interventions and pathological studies, including biopsies."

They highlight, however, that SCARF expression within and between individuals can be influenced by genetics and environmental factors and their "map" might not be representative of everyone.

Still, tracing the virus's potential footsteps throughout the body also reveals potential secret routes it might use to jump from host to host. With this guide, we might be able to finally catch up to the virus and stop it in its tracks.

READ | Coronavirus' weird trip inside cells might be its undoing, scientists say

Image credit:

Compiled by Gabi Zietsman

Read this article:
Mapping Covid-19's tracks as it attacks the body - Health24

Abstract

Objective To evaluate and quantify the future risk of cardiovascular events in young adults with high blood pressure.

Design Systematic review and meta-analysis.

Data sources Medline, Embase, and Web of Science were searched from inception to 6 March 2020. Relative risks were pooled using a random effects model and expressed with 95% confidence intervals. Absolute risk difference was calculated. Dose-response relations between blood pressure and individual outcomes were assessed by a restricted cubic spline model.

Eligibility criteria for selecting studies Studies were selected that investigated the adverse outcomes of adults aged 18-45 with raised blood pressure. The primary study outcome was a composite of total cardiovascular events. Coronary heart disease, stroke, and all cause mortality were examined as secondary outcomes.

Results Seventeen observational cohorts consisting of approximately 4.5 million young adults were included in the analysis. The average follow-up was 14.7 years. Young adults with normal blood pressure had increased risk of cardiovascular events compared with those with optimal blood pressure (relative risk 1.19, 95% confidence interval 1.08 to 1.31; risk difference 0.37, 95% confidence interval 0.16 to 0.61 per 1000 person years). A graded, progressive association was found between blood pressure categories and increased risk of cardiovascular events (high normal blood pressure: relative risk 1.35, 95% confidence interval 1.22 to 1.49; risk difference 0.69, 95% confidence interval 0.43 to 0.97 per 1000 person years; grade 1 hypertension: 1.92, 1.68 to 2.19; 1.81, 1.34 to 2.34; grade 2 hypertension: 3.15, 2.31 to 4.29; 4.24, 2.58 to 6.48). Similar results were observed for coronary heart disease and stroke. Generally, the population attributable fraction for cardiovascular events associated with raised blood pressure was 23.8% (95% confidence interval 17.9% to 28.8%). The number needed to treat for one year to prevent one cardiovascular event was estimated at 2672 (95% confidence interval 1639 to 6250) for participants with normal blood pressure, 1450 (1031 to 2326) for those with high normal blood pressure, 552 (427 to 746) for those with grade 1 hypertension, and 236 (154 to 388) for those with grade 2 hypertension.

Conclusions Young adults with raised blood pressure might have a slightly increased risk of cardiovascular events in later life. Because the evidence for blood pressure lowering is limited, active interventions should be cautious and warrant further investigation.

Cardiovascular events are responsible for more than 18 million deaths each year, which is around one third of all global deaths.12 High blood pressure is a well recognised remediable risk factor for cardiovascular events. Currently, two different blood pressure thresholds are used to diagnose hypertension: the traditional threshold of 140/90 mm Hg3 and the newly recommended threshold of 130/80 mm Hg given in the 2017 guideline by the American College of Cardiology and American Heart Association.4 Although different criteria are implemented for diagnosing hypertension, their therapeutic recommendation is similar and largely driven by the risk of cardiovascular disease.34 Most randomised outcome studies have involved participants who are at high risk or are over the age of 55.5 Therefore frequently used risk prediction models or guidelines are mainly based on studies among older people,346 whereas the association between blood pressure and cardiovascular event risks among young adults is under studied. Although hypertension is traditionally a more prevalent disease in older people, recent epidemiological studies have shown that the incidence is progressively rising among the young.7

Further research is needed to determine whether cumulative exposure to raised blood pressure during young adulthood contributes to higher risks of cardiovascular events in later life. Systematic reviews or randomised control trials investigating the associations of raised blood pressure with risks of cardiovascular events among young adults are lacking. Only a limited number of observational studies exist.89101112131415161718192021222324 However, substantial heterogeneity has been observed, varying in risk thresholds and the associations with different disease outcomes. An Indian cohort study showed that the risk of cardiovascular mortality increased in participants aged 34-44 years with systolic blood pressure from the category 140-159 mm Hg,21 while in several other cohorts, the blood pressure threshold associated with cardiovascular events was around 120/80 mm Hg.8923 Additionally, Son and colleagues reported that higher measured blood pressure in early adulthood was associated with increased risks of all cardiovascular outcomes,8 whereas in the Harvard Alumni Health Study, the exposure-outcome association was exclusive of strokes.15

With these inconsistent findings in mind, an up-to-date understanding of the association of blood pressure with different cardiovascular outcomes is needed, which would help to refine strategies for primary prevention and to inform the design of future clinical trials. We conducted a systematic review and meta-analysis of published studies to quantify the association between blood pressure categories and the future risk of cardiovascular events in young adults. Additionally we assessed if increases in systolic and diastolic blood pressure differentially impacted distinctive clinical outcomes.

This study was conducted under a predefined protocol (supplementary appendix 1), following the recommendations of the Cochrane handbook25 and reporting in accordance with the PRISMA (preferred reporting items for systematic reviews and meta-analysis) statement.26 The protocol was amended once on 6 March 2020; the search end date and search strategies were updated. Extra statistical analyses were also performed. Additionally, the grading quality of this meta-analysis was reported and evaluated by using the GRADE (grading of recommendations assessment, Development and evaluation) approach.27 According to the protocol deviation process guide, these changes were considered minor protocol deviations.28

We considered studies to be eligible if they were longitudinal cohort studies that enrolled adults aged 18-45 years, and reported the association between increased blood pressure and the study outcomes. The primary study outcome was a composite of total cardiovascular eventscoronary heart disease, stroke, heart failure, other types of cardiovascular diseases, and any cardiovascular deaths. We examined coronary heart disease, stroke, and all cause mortality as secondary outcomes.

We excluded studies if they were review articles, case reports, cross sectional studies, or randomised controlled trials comparing efficacy of antihypertensive medications; or if the study population was complicated with some other overt diseases, including cardiovascular diseases, kidney disease, diabetes, pulmonary hypertension, cancers, hyperthyroidism, connective tissue disease, rheumatoid arthritis, mental diseases or obstructive sleep apnoea. We also excluded studies involving pregnant participants, critically ill patients, or those admitted to hospital, studies recording fewer than three groups of blood pressure strata, or providing insufficient data to allow for risk estimates to be calculated.

We searched Medline, Embase, and Web of Science for articles from inception to 6 March 2020. Supplementary appendix 2 gives the detailed search strategy that used several search terms: (hypertension OR blood pressure) AND (cardiovascular disease OR coronary artery disease OR coronary heart disease OR myocardial infarction OR ischaemic heart disease OR acute coronary syndrome OR stroke OR cerebrovascular accident OR cerebrovascular disease OR cardiovascular events OR cardiovascular deaths OR heart failure OR diabetes OR renal failure OR chronic kidney disease) AND (cohort OR follow up) AND (age OR young). No restrictions were applied based on sex, location, languages, or duration of follow-up. We searched the reference lists of the included studies and relevant review articles, and contacted authors of potentially eligible articles to request additional data. Hand searching from the Google Scholar, China National Knowledge Infrastructure, or Wanfang datasets was conducted for additional grey literature, including government reports, insurance reports, conference proceedings, and digital dissertations. We also searched ClincalTrials.gov and the World Health Organization International Clinical Trials Registry Platform for ongoing or unpublished eligible studies. If duplicate studies were found from the same cohort that offered similar outcome measures, we included the studies reporting the most relevant data. However, if duplicate studies offered information for different outcomes, they were included in the pooled analysis for specific outcome analysis.

Two reviewers (DL and YC) screened all titles that met the inclusion criteria and then the remaining abstracts were screened. The full manuscripts were screened by the same reviewers to make the final decision for all included studies. Any disagreements were resolved by consensus.

Two reviewers (DL and YC) performed independent double data extraction. Core baseline and outcome data were extracted, including first author, year of publication, region/country, study type, year of enrolment, number and age of the included participants, follow-up duration, male sex proportion, body mass index, mean blood pressure level of each blood pressure stratum, the methods used for blood pressure measurement, and the study outcomes. Blood pressure was stratified into five subgroups: optimal blood pressure (systolic blood pressure <120 mm Hg and diastolic blood pressure <80 mm Hg), normal blood pressure (120-129 and 80-84 mm Hg), high normal blood pressure (130-139 and 85-89 mm Hg), grade 1 hypertension (140-159 and 90-99 mm Hg), and grade 2 hypertension (160 and 100 mm Hg) based on the 2018 European guideline.3 Optimal blood pressure was the reference category for relative risks. The information was obtained from published data or calculated by using the raw data.

We used the Newcastle-Ottawa scale to assess the characteristics and quality of included studies. Briefly, the scale is based on a star system and includes three broad perspectives: selection of the study groups, comparability of the groups, and ascertainment of the outcome of interest.29 Total score is calculated by summing the score for each answer. Studies are considered of good quality if the total score is at least 7/9. Two reviewers (DL and YC) independently conducted quality assessments of the included studies. Disagreements were resolved by discussion and further review. Publication bias was assessed by visual inspection of funnel plots and by Eggers statistical tests.30 We considered a P value less than 0.05 to be evidence of small study effects.

We used the STATA version 15.0 (Stata Corp, College Station, TX) software package to conduct random effects meta-analysis by using the inverse variance method for pooling log relative risks. Random effects was used because the studies were conducted over a wide range of settings in different populations. This approach required that heterogeneity be considered when making the pooled effect estimate. If possible, we chose to pool the risk estimates from primary studies, and when these data were not available, raw data were used to calculate unadjusted risk estimates. Pooled relative risks were expressed with 95% confidence intervals. The absolute risk difference was calculated by using the formula [(RR1)*I0], where RR indicates pooled relative risks and I0 is the incidence of cardiovascular events per 1000 person years among young adults with optimal blood pressure.31

We present benefit after one year of treatment in terms of number needed to treat for one year. This calculation assumed that the effect of treatment could help to lower the increased blood pressure to an optimal level and the event rate could be reduced to the same level as that in the population with optimal blood pressure. Number needed to treat was calculated directly as the reciprocal of the absolute risk difference between participants with increased blood pressure and optimal blood pressure.32 Additionally, we used the formula pdi*[(RR1)/RR] to calculate the population attributable fractions for each categorical blood pressure level in comparison to the reference category of optimal blood pressure, where pdi represents the proportion of total events in the population arising from the ith exposure category.33

In the dose-response analysis, we used restricted cubic splines to assess the pooled dose-response relation between blood pressure and individual outcomes. Nonlinear models were fitted and the results presented with 95% confidence intervals.34 We used mean values of the systolic blood pressure or diastolic blood pressure reported by the original studies, or calculated the average level by estimating the midpoint in each category. To enable the total person years of observation to be calculated, we included data from reports that specified total person time of follow-up, or sample size and median follow-up per person.

We used the 2 test to assess heterogeneity across studies, expressed as Cochrans Q and I2 statistics, together with 95% confidence intervals. Values of 0-25% represented minimal heterogeneity, 26-75% represented moderate heterogeneity, and values greater than 75% represented substantial heterogeneity.35

We performed meta-regression and stratified analyses to assess the potential sources of heterogeneity. Studies were stratified into different subgroups based on age (younger than or older than 30 years); body mass index (25 or <25); sample size (100000 or <100000); median follow-up duration (>20 or 20 years); year of enrolment (before or after 1980); population regions (Asia, Europe, or North America); and Newcastle-Ottawa scale scores (>7 or 7). For studies reporting subgroups stratified by sex, we combined results from the male subgroups and studies that were all male, which were then compared with the pooling results of the female subgroups. We separated studies based on male proportion (90% or <90%) to further explore the potential effect of sex distribution on the associations of high blood pressure and cardiovascular risks.

We conducted further sensitivity analyses by leaving out studies with high risk of bias21; removing studies with only male participants10131517222324 or military members10; excluding studies of retrospective design81924 or using non-equivalent outcome definitions924; or limiting studies to those involving only untreated participants,81213192023 using a mercury sphygmomanometer for blood pressure measurements,121314212223 or reporting some levels of adjustment.891011121315181920212223 All statistical tests were two sided and a P value less than 0.05 was considered statistically significant.

No patients or the public were involved in setting the research question or the outcome measures, nor were they involved in developing plans for recruitment, design, or implementation of the study. No patients or the public were asked to advise on interpretation or writing up of results. We had no way of directly contacting participants from the original studies.

From 57519 published records, 828 remained eligible for inclusion based on screening of the titles and abstracts. After reading the full manuscripts, a total of 17 studies were included in the analysis89101112131415161718192021222324 (fig 1). The studies examined 4533292 young adults (ranging from 3490 to 2488101 in each study), with an average follow-up of 14.7 years (ranging from 4.3 to 56.3 years in each study). Table 1 gives details of the study characteristics. Three of the studies were retrospective cohort studies and 14 were prospective. All studies reported the outcome of cardiovascular events (coronary heart disease or stroke) and only eight reported the outcome of all cause mortality.

Flowchart of selection of studies included in meta-analysis

Core characteristics of included studies

We found no evidence of publication bias across different blood pressure categories based on visual inspection of funnel plots and the results from Eggers tests (all P>0.05; supplementary appendix 3, fig S1). Table 2 reports Newcastle-Ottawa scale scores and quality assessment of the included studies; only one study scored lower than 7, indicating fair quality.21 All the other studies were recorded as good quality and low risk of bias based on total scores higher than 7. Most studies were rated as including representative participants for the general population. All but one study reported adequately on outcome ascertainment.19 According to the GRADE summary of evidence, the quality of evidence was rated as moderate to high for the outcomes of cardiovascular events, coronary heart disease and stroke, but low for all cause mortality except for the category of grade 2 hypertension (supplementary appendix 3, table S1).

Newcastle-Ottawa scale scores and quality assessment of included studies

During follow-up, 85674 cardiovascular events occurred. The event rate of cardiovascular events in young adults with optimal blood pressure was estimated to be 1.97 per 1000 person years (95% confidence interval 1.48 to 2.46). Figure 2 shows a graded, progressive association between blood pressure categories and the primary outcome. Young adults with normal blood pressure (relative risk 1.19, 95% confidence interval 1.08 to 1.31; risk difference 0.37, 95% confidence interval 0.16 to 0.61 per 1000 person years), high normal blood pressure (1.35, 1.22 to 1.49; 0.69, 0.43 to 0.97), grade 1 hypertension (1.92, 1.68 to 2.19; 1.81, 1.34 to 2.34), and grade 2 hypertension (3.15, 2.31 to 4.29; 4.24, 2.58 to 6.48 per 1000 person years) had increased risk of cardiovascular events compared with those with optimal blood pressure.

Forest plot of relative risks of cardiovascular events across blood pressure categories compared with optimal blood pressure. RR=relative risk

The heterogeneity of relative risks was substantial and statistically significant across studies (Q=42.5, I2=74.1%, P<0.001 for normal blood pressure; Q=104.2, I2=85.6%, P<0.001 for high normal blood pressure; Q=175.8, I2=91.5%, P<0.001 for grade 1 hypertension; Q=216.6, I2=95.8%, P<0.001 for grade 2 hypertension; fig 2). Therefore, we conducted sensitivity analyses across various scenarios to assess whether and to what extent the heterogeneity could be reduced. As a result, the heterogeneity reduced from substantial to moderate (supplementary appendix 3, table S2) when the analyses were confined to studies including only untreated participants81213192023 or when a mercury sphygmomanometer was used for blood pressure measurements.121314212223

To further explore the source of heterogeneity, we performed stratified analyses in the predefined subgroups. The findings of increased cardiovascular risk associated with high blood pressure were consistently observed in most of the stratified analyses (table 3). Differences in study sample size, study quality, follow-up duration, population regions, or body mass index were not major sources of heterogeneity. Additionally, summary estimates of the risk increasing association were identical for both sexes. The stratification based on male proportion (90% v <90%) did not reveal a major difference in the exposure-outcome associations, which suggested that the disparity in sex proportion did not have an important effect on our findings. Also, the pattern of association did not change materially after removing studies that had all male participants10131517222324 or only military members.10 Although the year of enrolment for individual studies could be a source of heterogeneity, we did not observe important secular trends when pooling studies conducted before or after the 1980s (table 3). However, the associations of blood pressure above high normal blood pressure level and risks of cardiovascular events were more evident in young adults aged over 30 years, suggesting that age could be one of the sources of study heterogeneity.

Stratification analysis of pooled relative risks for cardiovascular events

The event rates for coronary heart disease, stroke, and all cause mortality in young adults with optimal blood pressure level were estimated to be 1.07 (95% confidence interval 0.77 to 1.38), 0.94 (0.67 to 1.21), and 3.12 (1.40 to 4.84) per 1000 person years, respectively. The relative risk for coronary heart disease was 1.09 (95% confidence interval 0.99 to 1.21; risk difference 0.10, 95% confidence interval 0.01 to 0.22 per 1000 person years) for normal blood pressure, 1.25 (1.18 to 1.34; 0.27, 0.19 to 0.36) for high normal blood pressure, 1.65 (1.48 to 1.84; 0.70, 0.51 to 0.90 ) for grade 1 hypertension, and 2.27 (1.86 to 2.78; 1.36, 0.92 to 1.90) for grade 2 hypertension compared with optimal blood pressure (fig 3).

Forest plot of relative risks of coronary heart disease across blood pressure categories compared with optimal blood pressure. RR=relative risk

Similarly, young adults with normal blood pressure (relative risk 1.14, 95% confidence interval 1.03 to 1.27; risk difference 0.13, 95% confidence interval 0.03 to 0.25 per 1000 person years), high normal blood pressure (1.27, 1.15 to 1.39; 0.25, 0.14 to 0.37), grade 1 hypertension (1.89, 1.56 to 2.28; 0.84, 0.53 to 1.20), and grade 2 hypertension (2.87, 2.07 to 3.96; 1.76, 1.01 to 2.78) had increased risk of stroke compared with those with optimal blood pressure (fig 4). For all cause mortality, the risk increased above a blood pressure of 140/90 mm Hg, with a 42% higher risk for grade 1 hypertension (relative risk 1.42, 95% confidence interval 1.18 to 1.71; risk difference 1.31, 95% confidence interval 0.56 to 2.22 per 1000 person years) and a double risk for grade 2 hypertension (2.01, 1.38 to 2.93; 3.15, 1.19 to 6.02; fig 5).

Forest plot of relative risks of stroke across blood pressure categories compared with optimal blood pressure. RR=relative risk

Forest plot of relative risks of all cause mortality across blood pressure categories compared with optimal blood pressure. RR=relative risk

The heterogeneity of relative risks was moderate to substantial for the outcomes of stroke and all cause mortality across high normal blood pressure (Q=25.4, I2=52.8%, P=0.01 for stroke; Q=21.3, I2=67.1%, P=0.003 for all cause mortality; fig 4 and fig 5), grade 1 hypertension (Q=86.3, I2=86.1%, P<0.001 for stroke; Q=93.8, I2=92.5%, P<0.001 for all cause mortality; fig 4 and fig 5), and grade 2 hypertension strata (Q=25.7, I2=76.6%, P<0.001 for stroke; Q=36.5, I2=89.0%, P<0.001 for all cause mortality; fig 4 and fig 5). However, for the normal blood pressure stratum (Q=10.6, I2=24.4%, P=0.23 for stroke; Q=10.6, I2=0.0%, P=0.46 for all cause mortality; fig 4 and fig 5) and coronary heart disease outcome associated with normal blood pressure (Q=13.6, I2=33.7%, P=0.14; fig 3), high normal blood pressure (Q=16.5, I2=21.1%, P=0.23; fig 3), and grade 2 hypertension (Q=9.7, I2=27.8%, P=0.21; fig 3), we did not observe any significant heterogeneity.

Assuming that the effect of treatment could help to lower increased blood pressure to the optimal level and the risk attributable to raised blood pressure was removed by treatment, the number needed to treat for one year to prevent one cardiovascular event was estimated to be 2672 (95% confidence interval 1639 to 6250) for those with normal blood pressure, 1450 (1031 to 2326) for those with high normal blood pressure, 552 (427 to 746) for those with grade 1 hypertension, and 236 (154 to 388) for those with grade 2 hypertension. Figure 6 shows the estimated number needed to treat to prevent one event of coronary heart disease, stroke, and all cause mortality. Generally, the population attributable fraction for the cardiovascular events associated with raised blood pressure was 23.8% (95% confidence interval 17.9% to 28.8%). The attributional effects increased across blood pressure increments: 2.1% (1.0% to 3.1%) for normal blood pressure, 8.6% (6.0% to 10.9%) for high normal blood pressure, and 13.0% (11.0% to 14.8%) for a hypertensive blood pressure level (fig 6). Similar results were observed for coronary heart disease and stroke (fig 6).

Population attributable fraction and number needed to treat for one year for different study outcomes across blood pressure categories. NNT=number needed to treat

The risk increasing associations of blood pressure categories with cardiovascular events, coronary heart disease, and stroke were similar when using mean systolic and diastolic blood pressure values. Figure 7 shows that systolic blood pressure higher than 120-129 mm Hg was associated with an increased risk of cardiovascular events, coronary heart disease, and stroke in a dose responsive manner (fig 7, top panel). Similarly, the association of diastolic blood pressure with risk of cardiovascular events, coronary heart disease, and stroke monotonically increased from a level of 80 mm Hg (fig 7, bottom panel). For all cause mortality, the risk associated with systolic blood pressure increased from a level above 150-160 mm Hg, and an association with diastolic blood pressure was observed above 80-90 mm Hg. Independently, every 10 mm Hg increment of systolic blood pressure was associated with a 5% increased risk of cardiovascular events (relative risk 1.05, 95% confidence interval 1.03 to 1.06), a 3% increased risk of coronary heart disease (1.03, 1.02 to 1.04), a 4% increased risk of stroke (1.04, 1.02 to 1.05), and a 2% increased risk of all cause mortality (1.02, 1.01 to 1.03). For diastolic blood pressure, each 5 mm Hg increment resulted in a 4% increased risk of cardiovascular events (1.04, 1.03 to 1.05), a 2% increased risk of coronary heart disease (1.02, 1.02 to 1.03), a 3% increased risk of stroke (1.03, 1.02 to 1.04), and a 2% increased risk of all cause mortality (1.02, 1.01 to 1.03).

Nonlinear dose-response analysis of systolic blood pressure (top panel) and diastolic blood pressure (bottom panel) and risk of cardiovascular events, coronary heart disease, stroke, and all cause mortality. Shaded areas indicate 95% confidence intervals for corresponding coloured lines

Limited evidence exists of an association between higher blood pressure and the risk of clinically manifest cardiovascular events in young adults. A systematic review of the literature provided insight into this process. Our study was based on 17 studies with approximately 4.5 million young adults and yielded three main findings. Firstly, we observed continuous and graded associations between categorical blood pressure increments and increasing risks of cardiovascular events, coronary heart disease, stroke, and all cause mortality. The risk increasing association with cardiovascular events was consistent in participants across different regions, but it was more evident in those older than 30 years. Secondly, the population attributable fractions for cardiovascular events from increased blood pressure were high, contributing to nearly a quarter of cardiovascular events in young adults. Thirdly, a similar pattern of the associations with different study outcomes was observed in the dose-response relation of systolic and diastolic blood pressure.

The strengths of the present study are the large sample size and the long follow-up duration, with a total of approximately 4.5 million participants at risk and an average follow-up of 14.7 years. The associations of high blood pressure with various study outcomes were examined across different blood pressure categories in our study. Unlike most of the previous studies assessing only normotension and hypertension,3637 the use of comprehensive blood pressure strata enabled healthcare workers to determine a detailed association of blood pressure with cardiovascular events. Additionally, restricted cubic spline models were used to assess the dose-response relation between blood pressure and future risk of individual outcomes, providing an estimate of the independent associations of systolic and diastolic blood pressure with different study outcomes. Moreover, consistent results of the pooled estimates from the stratified and sensitivity analyses across various scenarios supported the robustness of the study findings.

However, limitations also exist. Firstly, this review was not preregistered. However, it was conducted under a predefined protocol and followed the guidance of the Cochrane handbook.25 The items recommended by the PRISMA statement were also provided, which reduced the manipulation and improved the transparency.26 Secondly, considerable heterogeneity was observed in the design of the included studies. The protocols for blood pressure measurement were not equivalent in different cohorts. Population characteristics, including age range, treated or untreated status, presence or absence of hyperglycaemia, hyperuricaemia, and dyslipidaemia might also have contributed to the heterogeneity of the included studies. As a result, although the risk increasing association remained robust across various scenarios, high levels of statistical heterogeneity generally persisted and could not be reduced in stratified and sensitivity analyses. Finally, pooling results from studies that were all male with other mixed studies could have biased the results. However, stratification analyses by sex distribution (male proportion) were conducted and showed that the summary estimates of the risk increasing association were identical for both sexes and in studies with different proportions of male participants. However, analysis of the female population was based on only four studies and the calculated estimates for women were highly uncertain.

Associations between high blood pressure and cardiovascular risk have long been recognised and found to be age specific, but most of the outcome studies were carried out in middle aged or older populations.383940 Previous cohort studies and overviews have shown that high blood pressure is robustly associated with increased risk of total cardiovascular events and all cause mortality in middle aged or older populations.123384142 The Suita Study reported that the cardiovascular risk was 2.04 (95% confidence interval 1.19 to 3.48) for normal blood pressure, 2.46 (1.46 to 4.14) for high normal blood pressure, 2.62 (1.59 to 4.32) for grade 1 hypertension, and 3.95 (2.37 to 6.58) for grade 2 hypertension compared with optimal blood pressure in a population over 50 years old. Additionally, each 10 mm Hg decrement in systolic blood pressure was predicted to result in a reduction in cardiovascular events of around 25-40%.43 Our findings further support the idea that the relative risks for cardiovascular events associated with various blood pressure categories vary among different age groups.39 We show that the relative risks for cardiovascular events in each blood pressure category were all lower among young adults. For every 10 mm Hg increment of systolic blood pressure and every 5 mm Hg increment of diastolic blood pressure, a 4-5% increase in risk was found.

Relative risk estimates for disease incidence are of limited clinical utility given the uncertainty about the incidence rate of the reference group, referring to the optimal blood pressure sample in our study.44 The absolute risk for cardiovascular events in young adults with optimal blood pressure is low compared with the older population. The Multi-Ethnic Study of Atherosclerosis, a population based study that enrolled adults aged 45-84 years who were free of clinical cardiovascular diseases, showed that the event rates for all cardiovascular events in participants with a blood pressure of 120-139 mm Hg were 5.6-24.3 per 1000 person years. For those with a blood pressure of 140-159 mm Hg, the event rates were 7.4-36.9 per 1000 person years and rose to a level of 16.7-37.1 per 1000 person years when blood pressure was higher than 160 mm Hg.45 Despite the relatively low absolute risk, the difference in absolute risk (at least four additional cardiovascular events per 10000 person years in those with increased blood pressure) should not be overlooked owing to an increasing prevalence of hypertension in young adults.74647

The population attributable fraction for cardiovascular events from raised blood pressure in young adults was higher than the corresponding blood pressure levels in older people.2048 This finding suggests that the impact of high blood pressure on cardiovascular events is more detrimental among young people, especially above the level of 140/90 mm Hg. The reason for this effect is probably driven by age. The contributing impacts of other risk factors, including previous cardiovascular disease, impaired lung function, or longer duration of diabetes could make a greater difference at an older age and so the contributing role of hypertension diminishes4849; however, for young adults, with fewer comorbidities or risk factors, the role of increased blood pressure dominates.

Systolic and diastolic blood pressure each independently influenced cardiovascular outcomes in young adults. The pathophysiological basis of high blood pressure in young adults and older people seems to be different.550 White coat hypertension, a hyperadrenergic state, a higher prevalence of secondary hypertension, and hypertension caused by peripheral blood pressure amplification are more commonly seen in young adults. Conversely, loss of arterial compliance and increased arterial stiffness are often found in older people, concurrent with increasing systolic blood pressure and decreasing diastolic blood pressure.55051 Understanding such pathophysiological links among different age groups could help us to better understand what we found in this study. The Monica, Risk, Genetics, Archiving and Monograph project, a large population based cohort, found a gradual age related shift from diastolic blood pressure to both diastolic blood pressure and systolic blood pressure, and eventually to systolic blood pressure as a risk factor for cardiovascular events.52 This finding is consistent with our results, with systolic and diastolic blood pressure independently and comparatively associated with the risk of cardiovascular events. However, outcome specific association was observed in terms of systolic blood pressure and diastolic blood pressure. For systolic blood pressure, the risk of stroke and coronary heart disease was identical in pattern and increased from the level of 120 mm Hg, while for all cause mortality the risk apparently rose from the level of 150-160 mm Hg. For diastolic blood pressure, the burden for stroke was more evident than coronary heart disease and all cause mortality. Given that the prevalence of isolated diastolic hypertension is more pronounced in young adults, special attention should be paid to this population.53

Uncertainty remains about antihypertensive treatments in young adults with increased blood pressure. Because our findings were based on observational studies, not interventional, no direct data were yielded relating to antihypertensive treatment. According to the hypertension guidelines, antihypertensive treatment is beneficial for those with a 10 year atherosclerotic cardiovascular disease risk of more than 10%.34 However, the frequently used risk prediction models have not been validated in young adults and evidence to support the recommendation of starting antihypertensive drugs is insufficient.5455 Therefore, active interventions should be cautious. Based on our findings, to prevent one cardiovascular event, the number needed to treat for one year was estimated to be 2672, 1450, 552, and 236 for normal blood pressure, high normal blood pressure, grade 1 hypertension, and grade 2 hypertension, respectively. These data suggest a lower likelihood of treatment benefit, especially for those with normal and high normal blood pressure. Our results could inform healthcare professionals about the effort needed to achieve a particular outcome and provide insights into the design of future clinical trials.31

Without a defined association between high blood pressure and cardiovascular risks, developing and implementing standardised treatment advice and guidelines that include young adults is challenging. Although ongoing studies for young adults are currently being investigated, most are still at the initial stages and the long term impact on cardiovascular end points remains to be determined.565758 Therefore, the insights provided in our study could help to refine strategies for primary prevention and might have important implications for future research.

Read more from the original source:
Association between high blood pressure and long term cardiovascular events in young adults: systematic review and meta-analysis - The BMJ

If you were to ask an ancient Greek how it is determined that a baby is born a boy or a girl, they would have had some interesting and very compelling theories to offer you. One camp held that it was determined by which of the males testes the child originated from, while another believed that what really matters is what side of the womb the fetus develops in, until Aristotle put everybody on notice by declaring once and for all, and definitively, that it is temperature that makes the difference, because men are governed by the element fire, and women by the cooler element water.

For two millennia, our ideas about sex determination were little more advanced than those of the ancient Greeks, with pre-natal environment considered the most important factor for determining whether a child, sexless at conception, emerged a boy or a girl. Temperature continued to be sited as an important factor, but also the nutrition consumed by the mother was deemed to be crucial, and such was the common wisdom until 1905, when a Bryn Mawr cytologist by the name of Nettie Stevens (1861-1912) published Studies in Spermatogenesis with Especial Reference to the Accessory Chromosome,' a daring paper that smashed all previous theories and established on a definite basis the chromosomal, hereditary nature of gender.

For the importance of her work, we know astonishingly little about her life. She was born three months after the start of the US Civil War in Vermont to Julia and Ephraim Stevens, one of four children of whom only two survived to adulthood. Julia Stevens died in 1863 and Nettie was raised primarily by her stepmother, whom her father married in 1865. The year of Stevenss birth put her firmly between two generations of expectations and opportunities. Born two decades earlier, and her career would have firmly been that of a gifted and vastly overqualified governess or school teacher. Born two decades later, and her talents would have opened a series of doors that would have resulted in their steady and early development.

Nettie Stevens would author 38 papers in under a decade, one of which describing the results of her investigations into sex determination ranks among the most important genetic works of the 20th Century

As it stood, Stevens underwent several starts and stops to her career as she attempted to navigate her way through the grey area of the late nineteenth century educational system. She attended public school in Westford, Massachusetts and her academic performance there allowed her to continue on as one of the rare women students attending Westford Academy, where she graduated in 1880. Stevens had clear gifts, but she was also driven by the need to be financially independent, and in 1880 that meant finding a job as a teacher, as paying research positions for women interested in biology were not, as of yet, an option. She took up a position as a Latin, English, mathematics, and biology teacher in Lebanon, New Hampshire and furthered her scientific education as best she could at Westfield Normal School, where she graduated at the top of her class in 1883.

The next thirteen years, then, were devoted to the sort of necessary, money-earning work that would allow her to maintain what she prized most of all, her independence. She worked as a librarian and a teacher in three different cities while waiting for an opportunity to take the next step in her education. That opportunity arose in 1896 when she heard about a new university on the West Coast, founded in 1891 and open to women applicants Leland Stanford Junior University.

In a move that seems doubly bold in view of her history of cautious and pragmatic career decisions, she decided to move out to California in 1896 and join Stanford as a special-case student preparatory to earning her full freshman status in 1897, and an advanced status a few months after that. She worked at Stanford with Frank Mace MacFarland, a nudibranch authority who steered Stevens towards histology, the study of organic tissues by microscope. She earned her bachelors degree in 1899 and her Masters in 1900 with her thesis Studies on Ciliate Infusoria.

1900 was a crucial year not only for Nettie Stevens, when she earned her Masters and settled in to the work at Bryn Mawr College that was to define the rest of her life, but for biology generally. This was the year that the genetic work of Gregor Mendel was rediscovered and verified in a paper by German botanist Carl Correns, kickstarting a new wave of investigations that would come to define modern biology. By 1903 Walter Sutton and Theodor Boveri had established that chromosomes were the carriers of genetic material, thereby providing the locus of study for any researchers interested in questions of heredity.

Stevens had a chance to study with Boveri himself at the University of Wrzberg at precisely the time that he was carrying out his important investigations of chromosomal regularity in sea urchins, furthering concentrating her interest from cytology generally to chromosomal research. She received her PhD in 1903 for her dissertation Further Studies on the Ciliate Infusoria, Licnophor and Boveria, which focused on morphology and particularly the regenerative processes of those organisms. Her interest, however, was turning towards a new investigation of the possible hereditary basis of sex determination, work which she would need funding to carry out. She applied for a Carnegie stipend to supplement her meager salary as a reader in experimental morphology at Bryn Mawr, and received it in 1904.

Stevens would author thirty-eight papers over the next eight years of life left to her, but it was to be the paper published in 1905 describing the results of her investigations into sex determination that would earn her a pedestal in the scientific pantheon. The majority opinion of the scientific community in the early 1900s was that environmental factors determined the evolution of a fetuss sex in the womb. In 1901 Clarence McClung, working with the grasshoppers that were readily available around the University of Kansas, had hypothesized that gender was determined by the presence or absence of a second X chromosome in the cell, an observation which is true enough in grasshoppers, where females have two X chromosomes while males only have one, but was, unfortunately for McClung, not true of the larger animal kingdom.

Stevens worked with the meal worm Tenebrio molitor and noted that while eggs always possessed ten full sized chromosomes, that sperm gametes contained either ten full chromosomes or nine full chromosomes and one smaller chromosome (what we now call the Y chromosome). When an egg was fertilized by a sperm with the larger tenth chromosomes, it developed into a female, and when it was fertilized by a sperm with the smaller tenth chromosome, it developed into a male. This was the death knell of the environmental hypothesis for sex determination, and also of McClungs theory that sex was caused generally by the presence of an extra accessory chromosome. In later studies, she expanded her research to ensure that her results were true for other species besides Tenebrio molitor (in particular aphids, beetles, and flies), while her results were confirmed independently by influential biologist EB Wilson, and in his paper on the topic he acknowledged Stevenss priority in a footnote.

Though she was first in the discovery of the hereditary basis of sex determination, she was not invited to a conference in 1906 where Wilson and her superior at Bryn Mawr (though her junior in age), Thomas Hunt Morgan, were slated to speak about their research in that topic. Morgan then compounded this omission in his official obituary of Stevens, which conveniently mis-stated the year of her work with Tenebrio molitor as 1906 instead of 1904 to make the case that Wilson and she essentially co-discovered the XY principle.

Morgans willingness to muddy the chronology on Stevenss work to give more credit to a male colleague was mirrored in his unwillingness to credit Stevens as an early researcher in the organism that he later won the Nobel Prize for genetically describing, Drosophila melanogaster. This was a species of fly first bred by C.W. Woodworth and used in genetics research at Harvard by William E. Castle as a model organism for genetics studies, and it was one of the species that Stevens included in her researches, several years before Morgan began making it the centerpiece of his genetics experiments in 1909. In his obituary of Stevens, written in 1912, mention is made of the fact that she worked with flies generally, but the fact that she worked with that particular species is not present. This is not to say that Morgan stole the idea of working with Drosophila from Stevens the account given in his Nobel biography states that the idea was suggested to him by entomologist Frank Eugene Lutz but it is all the same a curious missed opportunity to recognize a predecessor in the research of his preferred organism upon the occasion of her death.

Nettie Stevens was granted less than a decade of professional work in the field she had finally found her place in at the age of forty. It was only at the end of her life that Bryn Mawr offered to create a research professorship position for her so that she would not have to expend energy scrapping up funding to supplement her official position as Associate in Experimental Morphology, and she died of breast cancer before the new title and salary could be conferred upon her. There are so many What Ifs that accumulate about her person and career What if she had started sooner? What if she had been given a position equal to her abilities earlier? What if those best placed to assure her legacy had worked more assiduously towards that end? It is easy to get lost in those What Ifs, and to fail to see what is right before us 38 papers in under a decade, one of which ranks among the most important genetic works of the Twentieth Century, produced by an individual only three years into her second, mid-life, career. We know far too little of her character and voice, but the work remains, and in it we find the building blocks of our destinies, writ small but distinct, in the cells of our cousin and sometimes friend, the humble meal worm.

FURTHER READING: Marilyn Ogilvie devotes a good amount of space to Stevens in her classic Women in Science (1986) but there is no stand alone biography of her life and work. The best source is, ironically, a French article from 2008 by Simone Gilgenkrantz which places Stevens within the context of her fellow chromosomal researches. Thomas Hunt Morgans obituary of Stevens can still be found online, which is a good source for details about her work that most authors gloss over, though of course it needs to be approached skeptically.

Lead image: Nettie Stevens (circa 1909); by Bryn Mawr College Special Collections source, Public Domain

Link:
Where Sex Begins: The Chromosomal Investigations Of Nettie Stevens - Women You Should Know

As Covid-19 cases keep rising in the country, a pattern is emerging: a disproportionately high number of men are being infected.

At the beginning of April, truck drivers and their associates (turn boys, off-loaders, and delivery men) were a risk factor in the spread of the disease. Now, however, with the number of community transmissions rising, the same pattern is persisting.

On August 31, statistics on the Uganda Covid-19 Response Info Hub showed that the country has 3037 cumulative coronavirus cases. Of those who were still hospitalised, 85.2 per cent (950) were men, while 14.8 per cent (165) were female.

Last month, Mr George Bagala, an accountant working in Kampala, tested positive for the coronavirus. Like many who have recently tested positive, Bagala was surprised at the results.

I rarely go downtown, and I always wear a mask in public. But I remember, at the beginning of the month I visited a friend. When I entered his office, I removed my mask. My friend had flu and he was drinking lemon tea. It was a hot afternoon and the air conditioner was on, he says.

Downtown Kampala, with its open air markets, shopping arcades, and business hubs, is a hotspot for the virus because of overcrowding and lax adherence to the wearing masks and social distancing.Two days later, an ambulance ferried Bagalas friend to Mulago National Referral Hospital after he tested positive for Covid-19.

By then, I was not well. I had a feeling of blood rushing to my head all the time. I was fatigued all the time, had muscle aches and pain in my eyes. But I put this down to stress, until my wife advised me to take a test, he says.After a mass test at his workplace, Bagala and 10 of his male workmates tested positive for the virus. Role of gender in mortality and morbidity according to a paper, Gender Differences in patients with Covid-19: Focus on Severity and Mortality, published in April 2020 on Frontiers in Public Health, of the 2,442 people who died on the Chinese mainland from the coronavirus, two-thirds were men.

The World Health Organisation Covid-19 weekly surveillance report indicates that 63 per cent of the Covid-19 related deaths in Europe have been among men. The study also adds that according to clinical classification of severity, men tended to develop more serious cases than women.Dr Monica Musenero, the senior presidential advisor on epidemics, says these statistics are being replicated all over the world.

It is a global fact that Covid-19 is infecting and killing more men than women. We dont know why, but in Uganda we are looking at different reasons. It could be that men have more core morbidities (other chronic diseases), or it could be age or genetics. By mid September, we will have a desegregation of the data from the community transmission cases, she says.

Men more exposedStatistics from the Response Info Hub show that the most affected age group were those between 30 and 39, closely followed by those in the 20 and 29 age group.For instance, by August 31, 350 men aged between 30 and 39 had been infected with the virus, yet only 35 women in the same age group had been affected.

In the 20 to 29 age group, 268 were men while 71 were female. By the same date, 17 men had died from Covid-19 compared to nine women.Dr Alex Ndyabakira, an epidemiologist with Uganda Public Health Fellowship Programme, says more men are infected by virtue of being breadwinners.

The 20 to 39 age group is a mobile population. Men are the majority in the open struggle for survival because they work away from home. You will find that most people in Kikuubo (business hub) and taxi parks are young men. The women in this age group are in their child-bearing years and they tend to be stay-at-home mothers or work in less risky places, he says.Dr Ndyabakira adds that the risk of exposure through travel cannot be under looked.

Public transport is a risk factor. How many taxi drivers and conductors are women? Even the length of exposure matters. A passenger is less likely to be infected than the conductor who spends the entire day in the taxi. Besides, we are in a political season, and most people gathering in rallies and political meetings are men, he added.

It is also true that the majority of rapid response health workers and burial teams are men. Both occupations are high risk factors for contracting the virus.

However, Ivan Bamweyana, a member of the Kampala Capital City Authoritys Covid-19 taskforce, says in the medical profession more women have been impacted.

Many female nurses are on the frontlines, treating people who have tested positive. We cannot conclusively say men are more exposed because we do not yet have the statistics on which people are being tested. If you are testing more men because they are the ones in the trading centre, it is obvious more men will turn up positive, he says.

A man without a mask buys bananas from a street vendor without a mask near Jinja Road traffic lights on August. PHOTO | KELVIN ATUHAIRE

Poor medical seeking behaviourGenerally, as a nation, voluntary health seeking behaviour is still a challenge. For many men, going to hospital is a sign of weakness.

When a woman has a persistent headache, she will go to a clinic for treatment. On the other hand, a man will take a panadol and dismiss the disease. But even if he goes to hospital, when he is referred to another hospital, he is less likely to comply with the referral, Dr Musenero says.It could also be that because of poor health seeking behaviour, most men are not aware of underlying medical conditions they might have that could predispose them to the virus.

Women, on the other hand, during their childbearing years always get maternity reviews that bring these conditions to light.Bamweyana says women have a more responsible attitude towards the coronavirus.

Women having a better health seeking behaviour compared to men. As a result, they tend to take Covid-19 related messaging very seriously. Men, though, will tend to think that Covid-19 is nothing to them. I have heard people say that they have survived being shot at or have lived through hellish situations and survived, so how can Covid-19 affect them. They think it is a simple flu, he says.

Risky lifestylesPoverty and neglect for a healthy lifestyle have seen many Ugandans unable to eat a balanced diet. One of the keys to fighting the virus is to boost immunity levels by eating fruits and vegetables.

In an effort to maintain a minimum weight or to lose weight, a number of women in the most affected age group (20-39) will try to maintain healthy lifestyles, which includes eating lots of fruits and vegetables.Covid-19 affects the respiratory system and lifestyle behaviour such as smoking that impact lung health are more predominant in men.

In Uganda, smoking is largely a male habit. The Global Adult Tobacco Survey: Country Report 2013 showed that 7.9 per cent of adults in Uganda aged 15 and above (1.3 million) use tobacco products. The rates are higher among males than women, with 11.6 per cent of men and 4.6 per cent of women using tobacco products.

According to a WHO publication, although there are currently no peer-reviewed studies that directly estimate the risk of hospitalisation with Covid-19 among smokers, 27 observational studies found that smokers constituted 1.4 per cent to 18.5 per cent of hospitalised adults.

The studies done in Europe have not been conclusive. However, smoking is a sever risk factor for any respiratory disease, but even with that, if you have a male smoker and a female smoker, the man is likely to die from Covid-19 than the woman, Dr Musenero says.

Another reason could be that women are more likely than men to adhere to wearing masks. Because of high testosterone levels, men are alpha risk takers and tend to believe they cannot be infected with the virus.

The psychological effectAlthough a conclusive study is yet to be done, the effects of the lockdown and the subsequent downward economic effect seem to be affecting more men than women. Since July, seven men between the ages of 29 and 40 have been known to have committed suicide.

Dr Musenero says this is because women cope better than men when it comes to stress.Men tend to want to work through their problems and show that they are in charge. A woman, on the other hand, will call up a friend, narrate her problems, cry about it and will feel better. Ordinarily, a man would go to a bar to socialise with friends but now, those places are closed, she says.

The way forwardSince the data is still being analysed, there is no guarantee that broadcast messages targeted at men will change the trend.A proper data analysis must be done before a message targeting men can go out. Otherwise, you might cause relaxation of the standard operating procedures among women, Bamweyana says.

Another disturbing detail that is being analysed, according to Dr Musenero, is that most of those who have died never reaced the stage of needing a ventilator, as has been the case in Europe and the USA. Here, the progression from flu and cough to respiratory distress has been alarmingly quick less than five days.

It is a global fact that Covid-19 is infecting and killing more men than women. We dont know why, but in Uganda we are looking at different reasons. It could be that men have more core morbidities (other chronic diseases), or it could be age or genetics. By mid September, we will have a desegregation of the data from the community transmission cases, Dr Monica Musenero, the senior presidential advisor on epidemics.

Many female nurses are on the frontlines, treating people who have tested positive. We cannot conclusively say men are more exposed because we do not yet have the statistics on which people are being tested. If you are testing more men because they are the ones in the trading centre, it is obvious more men will turn up positive, Mr Ivan Bamweyana, member of KCCA Covid-19 Taskforce,

gnantume@ug.nationmedia.com

See more here:
Covid-19 taking a greater toll on men than women - reports - Daily Monitor

Galanin is known to be associated with mental health. People born with genetically low levels of galanin face an uncommonly high risk of depression and anxiety disorders.

Multiple studies show that exercise increases production of the substance. In the rat experiments, some of which were conducted at Dr. Weinshenkers lab, researchers found that exercise led to a surge in galanin production in the animals brains, particularly in a portion of the brain that is known to be involved in physiological stress reactions. Perhaps most interesting, they also found that the more galanin there, the greater the rats subsequent stress resilience.

For the new research, they gathered healthy adult male and female mice and gave some of them access to running wheels in their cages. Others remained inactive. Mice generally seem to enjoy running, and those with wheels skittered through multiple miles each day. After three weeks, the scientists checked for genetic markers of galanin in the mouse brains and found them to be much higher in the runners, with greater mileage correlating with more galanin.

Then the scientists stressed out all of the animals by lightly shocking their paws while the mice were restrained and could not dash away. This method does not physically harm the mice but does spook them, which the scientists confirmed by checking for stress hormones in the mice. They had soared.

The next day, the scientists placed runners and inactive animals in new situations designed to worry them again, including cages with both light, open sections and dark, enclosed areas. Mice are prey animals and their natural reaction is to run for the darkness and then, as they feel safe, explore the open spaces. The runners responded now like normal, healthy mice, cautiously moving toward the light. But the sedentary animals tended to cower in the shadows, still too overwhelmed by stress to explore. They lacked resilience.

Finally, the researchers confirmed that galanin played a pivotal role in the animals stress resilience by breeding mice with unusually high levels of the substance. Those rodents reacted like the runners to the stress of foot shocks, with full-body floods of stress hormones. But the next day, like the runners, they warily braved the well-lit portions of the light-and-dark cage, not recklessly but with suitable prudence.

The upshot of these experiments is that abundant galanin seems to be crucial for resilience, at least in rodents, says Rachel P. Tillage, a Ph.D. candidate in Dr. Weinshenkers lab who led the new study. And exercise increases galanin, amplifying the animals ability to remain stalwart in the face of whatever obstacles life and science places before them.

See more here:
Exercise May Make It Easier to Bounce Back From Stress - The New York Times

Today, the Sexing Technologies methodology is widely used in many animal species, with a wide variety of applications, from livestock production systems to population increases among endangered species. Conception rates are slightly lower than non-sorted semen, as the high-speed sorting process causes stress on the cells. However, this process is a giant step toward the pie-in-the-sky future technology I reported on as an FFA member many years ago.

In recent years, another company, one that is familiar to most cattle producers, American Breeders Service, or ABS Global, has developed an additional process to produce gender- specific offspring. This process, called SexcelTM Sexed Genetics, was first launched in Australia in early 2018. Similar to the Sexing Technologies process, the SexcelTM process differentiates the X- or Y-chromosome-bearing cells due to the slight difference in DNA in each type of cell.

The ABS process uses a nontoxic fluorescent DNA probe that adheres to the DNA of the chromosomes, and the cells can then be differentiated by the level of florescence to segregate the X or Y cells. Based on the type of chromosome, cells may be sorted into separate containers based on sex, or the cells of the undesired sex may be laser-ablated and remain in the solution.

Leaving the ablated cells in the same solution with the viable selected cells does not have any negative impact on fertility of the sex-skewed product. Field performance indicates that X-skewed sexed-semen inseminations produce 86 percent to 93 percent female calves with up to 90 percent relative conception rate to conventional semen. ABS reiterates that results vary according to management, environment and animal.

Excerpt from:
JACK'S INSIGHTS: Animal agriculture technology: pie-in-the-sky inventions - Scottsbluff Star Herald

Releasing mosquitoes into the corridors of apartment complexes might seem like an unusual strategy for a city fighting its worst recorded outbreak of dengue, a painful disease spread between humans by mosquitoes. But the thousands of little insects discharged last week werent your average mosquitoes.

They were bred in a laboratory to carry a substance not commonly found in this type of mosquito: bacteria called Wolbachia. When the bacteria-laden male mosquitoes are released into the open and mate with naturally-born females, the resultant eggs wont hatch.

The outcome is reduced number of dengue cases in the areas where the lab-bred insects were released, according to Singapores government.

Scientists and governments are expanding high-tech solutions like these as the threat from the dengue virus grows. Some are using genetically engineered mosquitoes; others are zapping them with X-ray beams to sterilize them.

The World Health Organization says roughly half the worlds population is at risk of catching dengue, a viral infection that causes an intense flulike illness that is sometimes lethal. Growing urbanization and bulging cities have given mosquitoes vast human populations to feast on. Reported cases of the disease increased from about 500,000 in 2000 to 4.2 million in 2019, with tropical countries such as Brazil, Indonesia and the Philippines especially hard-hit.

Global warming could spread the disease further as both dengue-carrying mosquitoes and the virus itself thrive in warmer climates.

Dengue is transmitted by the female Aedes aegypti mosquito, which also spreads other diseases like Zika, which can cause severe birth defects when pregnant women are infected, and chikungunya, which causes fever and joint pain. Public-health campaigns have traditionally focused on simple solutions, such as encouraging people to empty stagnant water from household objects such as vases, pails and watering cans, where mosquitoes lay eggs. Insecticides are also used in dengue-prone areas.

But mosquitoes have developed immunity against common insecticides and dengue cases are rising globally. That is why scientists turned to altering or modifying the mosquitoes themselves.

In Singaporewhich has long suffered from dengue outbreaksspecialized mosquito-breeding began with mosquito eggs shipped from Michigan. A team led by Zhiyong Xi, a professor at Michigan State Universitys Department of Microbiology and Molecular Genetics used long, thin glass needles to inject Wolbachia into mosquito eggs, resembling tiny grains of dirt, that had been laid 90 minutes before. Upon hatching, the larvae also contained the bacteria.

That first generation passed the Wolbachia bacteria on to its descendants, birthing a new line of bacteria-infused mosquitoes whose eggs were shipped to Singapore to found the city-states colony.

Before the offspring could be released, the females needed to be separated from the males, which dont bite or transmit the dengue virus. Sex-sorting is critical because Singapores program hinges on mating males that contain the bacteria with females that dont. If both sexes carried the bacteria, the mosquitoes would successfully procreate, thwarting the programs goal of reducing the local mosquito population.

A machine developed by Verily, an Alphabet Inc. company focused on life sciences, uses automated mechanical sieves to separate female mosquito pupaewhich are generally largerfrom male ones. This step removes about 95% of females, the company says.

A computer vision system is used to identify any females the sieve may have missed. The system looks for the females distinct proboscis or mouth, antenna and other anatomical clues, flagging it for removal. Verily says substantially fewer than one in a million mosquitoes it releases is female, keeping Wolbachia from being inherited in the wild mosquito population.

Not all Wolbachia mosquitoes released in Singapore are sieved through Alphabets machine. Others are subjected to low-dose X-ray irradiation using a specific methodology Singapore developed in collaboration with the International Atomic Energy Agency. The irradiation sterilizes female mosquitoes, so that any that are inadvertently released will be unable to reproduce and spread Wolbachia to future generations.

Singapores government says that in parts of the city where its males have been released there were 65% to 80% fewer dengue cases compared with areas where the mosquitoes werent released. Mosquitoes are now being discharged in 5% of the citys public housing blocks. The releases are slated to expand to 15% of them by 2022.

Other programs want the Wolbachia to be inherited widely in wild populations. That is because those programs have found that the bacteria has another feature: It strongly reduces the Aedes aegypti mosquitoes ability to transmit dengue to humans.

The World Mosquito Program, a nonprofit active in a dozen countries in Asia, the Pacific and Latin America, released lab-bred bacteria-containing mosquitoesboth male and femalein the city of Yogyakarta in Indonesia. It counted on the fact that female mosquitoes will produce offspring that also have the bacteria, meaning the dengue-blocking feature is passed down.

Its trial showed a 77% reduction in dengue cases in areas where the mosquitoes were released compared with areas where they werent, the nonprofit said in August.

This method is much simpler than Singapores technique, which involves complex sex-sorting. But some scientists say releasing females with Wolbachia is potentially irreversible. If the Wolbachia turns out to have unintended consequences, it would be very difficult to extract the bacteria from the mosquito population, they say.

One laboratory study found that carrying Wolbachia enhanced the infection rate of West Nile virus in the Culex tarsalis species of mosquito, which is endemic to North America. Its a big black box," said Jason Rasgon, professor of disease epidemiology at Pennsylvania State University, arguing more research should be done on Wolbachias effects on the transmission of other diseases before further large-scale releases.

Cameron Simmons, a director at the World Mosquito Program, said many governments have conducted risk-assessments of its approach. On balance Wolbachia represented a negligible risk compared to doing nothing," he said.

One company is going in a different direction altogether: genetic engineering. Oxitec, a U.S.-owned biotechnology company with research bases in the U.K. and Brazil inserts a new gene in eggs that makes female mosquitoes die shortly after hatching while they are still in the larval stage of development.

Last year, Oxitec conducted a trial of its latest gene-modified version, which it calls OX5034, in Indaiatuba, Brazil, near So Paulo. For the trial, the company produced OX5034 eggs at a factory in Brazil and distributed them at release points around the municipality. When the eggs hatched, the females died before they could become adults capable of flying and biting.

The males, which reached adulthood, mated with local wild females, passing along the female-killing genes, reducing Aedes aegypti mosquito numbers by about 95%, Oxitec said.

The company received U.S. federal approvals in May for pilot releases in Florida, which the company expects to begin next year.

Oxitec says the genes they have added are self-limiting, which means that after a few generationsabout three to four monthsthe female-targeting gene is bred out of the species. Municipalities that wish to continue with the approach would carry on releasing OX5034 eggs to keep the mosquito population in check, it said, and those that dont would still have an off-ramp.

Jeffrey Powell, a biology professor at Yale University, sees drawbacks to the gene-modification approach. He said the need for periodic rereleases would get expensive, and over time wild mosquitoes may adapt to avoid mating with Oxitecs genetically doomed males. There is no evidence it is doing anything bad," he said of the genes Oxitec has introduced into mosquitoes. Its a complete unknown." He said he felt more comfortable with the use of Wolbachia, which is found naturally in many mosquito species.

Oxitec says it has released about one billion mosquitoes in the past decade and has no evidence female mosquitoes selectively mate with non-Oxitec males.

Theres no ecological footprint; theres no persistence," said Kevin Gorman, who heads field operations for Oxitec. Its not going to permanently change the environment at all."

Write to Jon Emont at jonathan.emont@wsj.com

Subscribe to newsletters

* Enter a valid email

* Thank you for subscribing to our newsletter.

Here is the original post:
How to fight the deadly dengue virus? Make your own mosquitoes - Livemint

From a scientific standpoint, the jury is still out on why exactly sperm count and quality are declining. Nevertheless, there is one highly likely culprit: modern life.

What is it about modern life that is wreaking havoc on male fertility?

Try something with me: Search your minds eye for a vivid movie of what your day looked like yesterday? Conjure up every detail you can: what you did, what you thought, what you worried about, what you consumed, how often you sat and what you were doing while sitting, and the details of the environment surrounding you.

Now do the same for an ordinary day in your grandfathers life when he was your age. This will require some imagination on your part, but consider the differences in what your grandfather did, what he thought and worried about, what he consumed, how often he sat and what he was doing while sitting, and the details of the environment surrounding your grandfather.

The difference between routines is where you can start to get a sense of what factors of modern life are taking such a toll on male fertility. (And female fertility, too.) Here are a few to consider:

Read the original post:
How To Improve Male Fertility & Sperm Quality, From An Expert - mindbodygreen.com

Abstract

Meiotic reductional division depends on the synaptonemal complex (SC), a supramolecular protein assembly that mediates homologous chromosomes synapsis and promotes crossover formation. The mammalian SC has eight structural components, including SYCE1, the only central element protein with known causative mutations in human infertility. We combine mouse genetics, cellular, and biochemical studies to reveal that SYCE1 undergoes multivalent interactions with SC component SIX6OS1. The N terminus of SIX6OS1 binds and disrupts SYCE1s core dimeric structure to form a 1:1 complex, while their downstream sequences provide a distinct second interface. These interfaces are separately disrupted by SYCE1 mutations associated with nonobstructive azoospermia and premature ovarian failure (POF), respectively. Mice harboring SYCE1s POF mutation and a targeted deletion within SIX6OS1s N terminus are infertile with failure of chromosome synapsis. We conclude that both SYCE1-SIX6OS1 binding interfaces are essential for SC assembly, thus explaining how SYCE1s reported clinical mutations give rise to human infertility.

Meiotic cell division is defined by a unique and highly dynamic program of events that result in homologous chromosome synapsis, crossover (CO) formation, and subsequent homolog segregation into haploid germ cells (13). Homologous chromosome pairs are established through interhomolog recombination searches from up to 400 induced double-strand breaks (DSBs) per cell (4). Once established, local recombination-mediated alignments are converted into the single continuous synapsis of aligned homologous chromosomes through the zipper-like assembly of the synaptonemal complex (SC) (5). The SCs supramolecular protein structure mediates continuous 100-nm tethering between homologous chromosome axes and provides the necessary three-dimensional framework for crossover formation (2). Following SC disassembly, crossovers provide the sole physical links between homologs at metaphase I, so are essential for ensuring correct homolog segregation in addition to providing genetic diversity (2).

The SC has an iconic and highly conserved tripartite structure that has been observed across meiotically reproducing eukaryotes (6). This consists of lateral elements (LEs) that coat the two homologous chromosome axes and a midline central element (CE), with a series of transverse filaments that bind together these longitudinal electron-dense structures (Fig. 1A) (7). The protein components of the mammalian SC have been identified as transverse filaments protein SYCP1 (Synaptonemal complex protein 1) (8), CE proteins SYCE1, SYCE2, and SYCE3 (Synaptonemal complex central element proteins 1 to 3), SIX6OS1, and TEX12 (Testis-expressed protein 12) (912), and LE proteins SYCP2 and SYCP3 (13, 14). All transverse filament and CE components are essential for SC assembly, and their individual disruption leads to infertility owing to meiotic arrest with failure of DSB repair (10, 11, 1518). In contrast, disruption of LE components produces a sexual dimorphism of male infertility and female subfertility (19, 20), with SYCP3 deficiency in females promoting germ cell aneuploidy and embryonic death (21).

(A) Schematic of the SC demonstrating its tripartite structure of two chromosome-bound LEs and a midline CE. Synapsis is achieved through N-terminal head-to-head assembly of SYCP1 molecules, which are bound via their C termini to meiotic chromosomes. SYCP1 head-to-head assembly is structurally supported within the CE by SYCE3 (red), an SYCE1-SIX6OS1 complex (yellow), and SYCE2-TEX12 fibrous assemblies (green). (B) Human SYCE1 (top) and SIX6OS1 (bottom) sequence schematics indicating the location and consequence of infertility-associated mutations of SYCE1 and 1021 internal deletion of SIX6OS1, alongside the principal constructs used in this study. (C) SDSpolyacrylamide gel electrophoresis (SDS-PAGE) analysis of the purified recombinant proteins used in this study. The dominant degradation product of SYCE1POF is indicated by an asterisk; its identity was confirmed by the observed cleavage of degraded MBP- and His-SYCE1POF fusion proteins upon treatment with TEV protease (fig. S1, A and B), consistent with it representing C-terminal degradation down to SYCE1s structural core. Mw, weight-average molecular weight. (D) SEC-MALS analysis. SYCE1core (yellow), SYCE1POF (green), and full-length SYCE1 (violet) are dimeric species of 36, 48 (39 kDa for the degradation product), and 86 kDa, respectively (theoretical dimers: 37, 55, and 80 kDa). dRI, differential refractive index. Data for SYCE1core and full-length SYCE1 are reproduced from (28).

In recent years, a variety of cellular imaging, biochemical and structural biology approaches have begun to uncover the molecular structures, interactions, and mechanisms responsible for mammalian SC assembly. SYCP1 self-assembles into a supramolecular lattice that provides the underlying 100-nm synapsis between chromosome axes (22, 23), while SYCP3 assembles into regularly repeating filaments that support chromosomal looping (24, 25). The five CE proteins provide essential structural supports for the SYCP1 lattice that enable its continuous and cooperative extension along the entire chromosome length. In this capacity, CE proteins have been categorized as synaptic initiation factors (SYCE3, SYCE1, and SIX6OS1) and elongation factors (SYCE2 and TEX12), of which their disruption leads to complete loss of tripartite SC structure and failure of extension of short SC-like stretches, respectively (10, 11, 1618). Of synaptic initiation factors, SYCE3 forms dimers that undergo potentially limitless self-assembly (26, 27), SYCE1 forms antiparallel dimeric assemblies (28), and SIX6OS1 is an SYCE1-interacting protein of unknown structure (11). These likely act as short-range structural supports between SYCP1 molecules, possibly in transverse, longitudinal, and vertical orientations to stabilize a local three-dimensional SYCP1 lattice (22). In contrast, SYCE2 and TEX12 exist as a seemingly constitutive complex that undergoes self-assembly into fibers of many micrometers in length (29), which likely provide the long-range structural supports that stabilize continuous growth of the SYCP1 lattice along the entire chromosome axis (22).

Owing to the essential roles of meiotic recombination, synapsis, and chromosome dynamics in mammalian meiosis (15, 3034), their defects are associated with human infertility, recurrent miscarriage, and aneuploidies (35, 36). As genetic causes of infertility, they typically fall within the category of idiopathic cases, having no readily diagnosable and clinically resolvable cause. Within the 10 to 15% of couples who suffer from infertility, approximately 25% are idiopathic and of likely genetic origin, comprising 50 to 80% of cases of nonobstructive azoospermia (NOA) and premature ovarian failure (POF) (36, 37). While individual infertility mutations are inherently unlikely to become widespread in a population, they can be found within families, especially when consanguineous (38), and provide crucial insights into their common targets and the molecular mechanisms that they disrupt.

Within the SC, familial infertility mutations have been identified for SYCP3 and SYCE1 (36). All identified SYCP3 mutations are autosomal dominant and alter or delete its structural cores C terminus that mediates filamentous assembly, so likely sequester wild-type (WT) molecules into inactive complexes (24, 36). In contrast, the three identified SYCE1 mutations are autosomal recessive and were found in two familial cases of NOA and one of POF (36). The two NOA cases are splice-site mutations, c.197-2A>G and c.375-2A>G, which are predicted to result in a truncated product of amino acids 1 to 65 and an internal deletion of amino acids 126 to 155, respectively (39, 40). These remove or delete part of human SYCE1s structural core that is encoded by amino acids 25 to 179, so can be explained by disruption of its dimeric structure (Fig. 1B) (28, 36). The POF mutation c.613C>T generates a premature stop codon (p.Gln241*) to give a truncated product of amino acids 1 to 240, relative to the canonical 351amino acid isoform (Fig. 1B) (41). However, as this truncation lies outside SYCE1s structural core, the molecular mechanism that is disrupted, and thereby responsible for infertility, remains unknown.

Here, we combine mouse genetics and cellular and biochemical studies to reveal a multivalent interaction mode between SYCE1 and SIX6OS1 that is disrupted by infertility-associated mutations of SYCE1. We find that the SIX6OS1 N terminus binds and disrupts the core dimeric structure of SYCE1 (amino acids 25 to 179) to form a 1:1 complex as the first interface, and its downstream sequence binds to SYCE1 amino acids 177 to 305 as the second interface. SYCE1s infertility-associated mutations c.375-2A>G (NOA) and c.613C>T (POF) specifically disrupt the first and second interfaces, respectively. Mice harboring the SYCE1 POF mutation and a targeted deletion within SIX6OS1 (which disrupts the first interface) are infertile, with failure of SC assembly. We conclude that both SYCE1-SIX6OS1 binding interfaces are essential for SC assembly and meiotic division, thus explaining how human infertility results from the differential targeting of binding interfaces by SYCE1s reported clinical mutations.

The SYCE1 POF mutation c.613C>T encodes a premature stop codon (p.Gln241*) that is predicted to generate a truncated protein product of amino acids 1 to 240, relative to SYCE1s canonical 351amino acid isoform (Fig. 1B) (41). We previously demonstrated that an N-terminal structural core encoded by amino acids 25 to 179 (SYCE1core) forms an -helical antiparallel coiled-coil structure that mediates head-of-head dimerization of SYCE1 (28). As this core region is retained (Fig. 1B), we predicted that SYCE1s antiparallel dimeric structure would be maintained within the 1- to 240-amino acid truncated product of the POF mutation (SYCE1pof). To test this, we purified recombinant SYCE1pof, generating purified material that contained approximately equal quantities of the full protein and a degradation product of apparent size consistent with degradation to the C-terminal boundary of its structural core (Fig. 1C and fig. S1, A and B). Circular dichroism (CD) spectroscopy confirmed that SYCE1pof contains a proportion of -helical structure consistent with retention of the 25179 core structure (fig. S1C), and SYCE1pof and SYCE1core demonstrated identical melting temperatures (Tm) of 39C (fig. S1D). Furthermore, analysis by size exclusion chromatography multiangle light scattering (SEC-MALS) confirmed that the full and degraded proteins are homodimers of 48 and 39 kDa, respectively (Fig. 1D). We conclude that SYCE1pof retains the dimeric structure imposed by its core 25179 region, so its SC and meiotic defects must result from additional structural or functional roles of its deleted C terminus.

Having established its retention of core dimeric structure, we next sought to determine the structural and functional consequence of the SYCE1 POF mutation on the SC and meiotic division in vivo. We thus generated mice harboring mutations of Syce1 alleles to introduce stop codons at amino acid position 243, equivalent to the human p.Gln241* mutation (figs. S2 and S3). While heterozygotes (designated Syce1POF/WT) were fertile, both male and female homozygotes (designated Syce1POF/POF) were infertile, replicating the autosomal recessive pattern of the POF mutation in humans (41). In male mutant mice, we observed reduced testis size (63% smaller, n = 3 mice at 2 months of age; fig. S4A) and a zygotene-like arrest similar to that observed in the SYCE1 knockout (16). There was defective SC assembly, with reduced staining for SYCP1 (Fig. 2A) and SYCE3 (Fig. 2B) and no staining for SYCE1 (Fig. 2C), SIX6OS1 (Fig. 2D), and SYCE2-TEX12 (fig. S4, B and C). Analysis of SYCE1 expression in the testis of Syce1POF/POF mice confirmed the presence of Syce1 transcript and a protein product of the correct molecular weight, albeit at reduced levels in comparison with WT (fig. S4, D and E, and table S1A). The Syce1POF open reading frame achieved WT levels of protein expression in a heterologous 293T cellular system (fig. S4F). We next studied the kinetics of DSB repair. Meiotic DSBs are generated by the nuclease SPO11 and are then resected to form single-stranded DNA ends that invade into the homologous chromosome by the recombinases RAD51 (DNA repair protein RAD51 homolog 1) and DMC1 (Meiotic recombination protein DMC1/LIM15 homolog) (42). DSBs are labeled by the presence of phosphorylated H2AX (-H2AX) (43). The distribution of -H2AX in mutant spermatocytes was similar to that found in WT cells at early prophase I but show increased staining at zygotene-like arrest (Fig. 2E). The distributions of RAD51 and DMC1 were detected on aligned LEs (Fig. 2, F and G) but in absence of mismatch repair protein MLH1 (DNA mismatch repair protein Mlh1) (marker of crossing-overs) (Fig. 2H). Together, these data indicate generation of DSBs but with failure of their repair and CO formation in Syce1POF/POF. In female mutant mice, we observed no follicles in adult ovaries (fig. S5A), and embryonic oocytes demonstrated zygotene arrest with mostly unaligned chromosome axes, recapitulating the human POF syndrome. Analysis of the SC revealed similar defects, with reduction in SYCP1 and SYCE3 (Fig. 3, A and B) staining (though to a lesser extent than males), and absence of SYCE1, SIX6OS1 (Fig. 3, C and D), and SYCE2-TEX12 (fig. S5, B and C). The distribution of -H2AX, RAD51, and DMC1 labeling in zygotene-like mutant oocytes was also increased and lacked MLH1 foci (Fig. 3, E to H). Thus, the SYCE1 POF mutation leads to male and female infertility with phenotypes of failed DSB repair, synapsis, and lastly SC assembly, similar to those previously observed upon disruption of structural components of the SC CE (10, 11, 1618).

(A) Double immunolabeling of WT pachytene and Syce1POF/POF zygotene-like spermatocytes with SYCP3 (red) and SYCP1 (green). In Syce1POF/POF spermatocytes, AEs fail to synapse and show a weak staining of SYCP1 along the axial elements (AEs). a.u., arbitrary units. (B to D) Double immunolabeling of spermatocyte spreads with SYCP3 (red) and the CE proteins (green). Syce1POF/POF zygotene-like spermatocytes showed a highly reduced signal of SYCE3 (B) and the absence of (C) SYCE1 and (D) SIX6OS1 from the AEs. (E) Double immunolabeling of -H2AX (green) and SYCP3 (red) in spermatocyte spreads from WT and Syce1POF/POF mice. -H2AX staining was persistent in Syce1POF/POF zygotene-like spermatocytes, but was restricted to the sex body in WT pachytene cells. (F and G) Double immunofluorescence of (F) RAD51 or (G) DMC1 (green) and SYCP3 (red). Syce1POF/POF zygotene-like spermatocytes showed increased numbers of foci of RAD51 and DMC1 along the AEs in comparison with WT, indicating unrepaired DSBs. (H) Double immunolabeling of MLH1 (green) and SYCP3 (red) showing the absence of COs (MLH1) in arrested Syce1POF/POF spermatocytes. Fluorescence intensity levels (A, B, and E) and number of foci (F and G) from WT and zygotene-like arrested spermatocytes are quantified in the right-hand plots. Welchs t test analysis: ***P < 0.0001. Scale bars, 10 m.

(A) Double immunolabeling of oocyte spreads from WT and Syce1POF/POF mice with SYCP3 (red) and SYCP1 (green). Syce1POF/POF oocytes became arrested in a zygotene-like stage where AEs remain unsynapsed and unaligned, with reduced levels of SYCP1. (B to D) Double immunolabeling of oocyte spreads with SYCP3 (red) and the CE proteins (green). Syce1POF/POF zygotene-like oocytes showed reduced SYCE3 signal (B) and a complete absence of (C) SYCE1 and (D) SIX6OS1 from the AEs. IP, immunoprecipitation. (E) Double immunostaining of spread preparations of WT pachytene and Syce1POF/POF zygotene-like oocytes with -H2AX (green) and SYCP3 (red). In Syce1POF/POF oocytes, the levels of -H2AX increased and were more restricted to AEs in comparison with WT pachytene cells. (F to G) Double immunolabeling of (F) RAD51 or (G) DMC1 (green) and SYCP3 (red), showing higher numbers of foci in AEs from mutant oocytes. (H) Labeling of MLH1 (green) and SYCP3 (red). MLH1 foci are absent from the AEs of Syce1POF/POF oocytes. Fluorescence intensity levels (A, B, and E) and number of foci (F and G) from WT and Syce1POF/POF zygotene-like oocytes are quantified in the right-hand plots. Welchs t test analysis: ***P < 0.0001. Scale bars, 10 m.

As the Syce1POF/POF mouse strain indicated a clear structural defect in the SC, we wondered whether the POF mutation may disrupt the known interaction between SYCE1 and fellow SC CE components SIX6OS1 and SYCE3 (11). The expression of SYCE1 and SIX6OS1 in COS7 cells produced cytoplasmic signals that became colocalized in foci upon coexpression (95% cells; Fig. 4A and fig. S6), in keeping with our previous findings (11). SYCE1pof formed similar or slightly reduced numbers of foci that equally colocalized with SIX6OS1, indicating a retention of SIX6OS1 binding (89% cells; Fig. 4A). We further demonstrated a similar coimmunoprecipitation of SIX6OS1 by WT SYCE1 and SYCE1pof upon coexpression in human embryonic kidney (HEK) 293 cells (Fig. 4B). Thus, the SYCE1-SIX6OS1 interaction is retained in the SYCE1 POF mutation. Could other disrupted functions contribute to the effect of the POF mutation? The only other known SYCE1 interactor is SYCE3, which undergoes low-affinity binding, as determined by its dissociation during purification (fig. S7, A and B). In contrast with the WT protein, the expression of SYCE1pof (cytoplasmic foci) in COS7 cells failed to recruit SYCE3 (preferentially nuclear) to their cytoplasmic foci (colocalization between SYCE3 and SYCE1 was observed for 95% of cells expressing WT SYCE1 and 21% of cells expressing SYCE1pof; Fig. 4C and fig. S6). Similarly, SYCE1pof failed to coimmunoprecipitate SYCE3 upon coexpression in HEK293 cells (Fig. 4D). Thus, while the SYCE1-SIX6OS1 complex is retained, the low-affinity SYCE1-SYCE3 complex is largely abolished in the SYCE1 POF mutation.

(A) Mouse SIX6OS1 colocalized with mouse SYCE1 and SYCE1POF in a cytoplasmatic punctate pattern upon coexpression in COS7 cells; the percentage of cells exhibiting colocalization is shown in the right-hand plot (n = 100 cells). DAPI, 4,6-diamidino-2-phenylindole. (B) HEK293T cells were cotransfected with the indicated expression vectors. Protein complexes were immunoprecipitated with anti-Flag or antienhanced green fluorescent protein (EGFP) antibodies, or mouse immunoglobulin G (IgG) as a negative control, and were analyzed by immunoblotting with the indicated antibody. GFP-mSIX6OS1 coimmunoprecipitated with Flag-mSYCE1 and Flag-mSYCE1POF, suggesting that the POF mutation of SYCE1 alone is insufficient to block the interaction. (C) COS7 cells were transfected with mouse Syce3 in combination with mouse Syce1 or Syce1pof as indicated. SYCE1 colocalized with SYCE3 in its own cytoplasmatic punctate pattern, and colocalization was substantially diminished for SYCE1POF (n = 100 cells). (D) Immunoprecipitation of protein complexes from HEK293T-cotransfected cells with an anti-Myc or anti-EGFP antibody or mouse IgG. SYCE1 coimmunoprecipitated with SYCE3, and the interaction was disrupted for SYCE1 POF, suggesting that the C-terminal region of SYCE1 is required for its interaction with SYCE3. The untransfected lanes in (B) and (D) show the absence of all the proteins in total protein extracts from untransfected 293T cells. Scale bars, 20 m.

What is the molecular basis of SIX6OS1 binding by SYCE1? As this is retained in SYCE1pof, we reasoned that SIX6OS1 binding must be mediated by SYCE1s structural core. We screened SYCE1core against a library of SIX6OS1 constructs through bacterial coexpression and identified a robust interaction with amino acids 1 to 67 of SIX6OS1, herein referred to as SIX6OS1N (Figs. 1B and 5A). We were able to purify the SYCE1core-SIX6OS1N complex by reciprocal affinity chromatography, ion exchange, and size exclusion chromatography (Fig. 5B) and found it to be stable under all experimental conditions tested. We were further able to purify similar complexes for SYCE1pof (with the same degradation product as upon isolated expression) and full-length SYCE1 (Fig. 1C and fig. S1B), confirming that SIX6OS1 binding is retained by all constructs containing the 25179 core. CD analysis revealed similar -helical content for SYCE1-SIX6OS1N complexes as for their isolated SYCE1 proteins (fig. S1C). CD thermal denaturation revealed slightly increased cooperativity of unfolding and melting temperatures for SYCE1-SIX6OS1N complexes relative to their isolated SYCE1 proteins (increasing from 39 to 43C, 39 to 41C, and 38 to 40C for SYCE1core, SYCE1pof, and full length, respectively; Fig. 5C and fig. S1D). SEC-MALS analysis revealed that all three SYCE1-SIX6OS1N complexes are 1:1, with molecular weights of 27, 37, and 46 kDa, respectively (Fig. 5D and fig. S7C). Thus, the SYCE1core undergoes conformation change from an antiparallel homodimer to a 1:1 complex upon binding to SIX6OS1N (Fig. 5E).

(A) Amylose pulldown following coexpression of MBP-SIX6OS1 175, 167, 175 1021, and free MBP with His-SYCE1core. (B) SDS-PAGE of the copurification of the SYCE1core-SIX6OS1n complex. Ni-NTA, Ninitrilotriacetic acid. (C) CD thermal denaturation recording the CD helical signature at 222 nm between 5 and 95C, as % unfolded; estimated melting temperatures (Tm) are indicated. (D) SEC-MALS analysis. SYCE1core-SIX6OS1n (blue), SYCE1POF-SIX6OS1n (red) and full-length SYCE1-SIX6OS1n (black) are 1:1 complexes of 27, 37 (29 kDa for the degradation product complex), and 46 kDa, respectively (theoretical 1:1 to 27, 36, and 48 kDa), while MBP-SIX6OS1n (gray) is a 57-kDa monomer (theoretical, 53 kDa). SDS-PAGE of the SYCE1POF-SIX6OS1n sample is shown in Fig. 1C. (E) Schematic of the conformational change of the SYCE1core antiparallel dimer (yellow) into a 1:1 SYCE1core-SIX6OS1n complex (yellow-blue). (F and G) SEC-SAXS analysis. (F) SEC-SAXS P(r) interatomic distance distributions of SYCE1core-SIX6OS1n (blue), SYCE1POF-SIX6OS1n (red), and SYCE1core (yellow), revealing maximum dimensions (Dmax) of 138, 180, and 186 , respectively. Their cross-sectional radii (Rc) are indicated (fig. S7D). (G) SAXS ab initio models of SYCE1core-SIX6OS1n (blue) and SYCE1core (yellow); averaged models were generated from 20 independent DAMMIF runs. Data for SYCE1core and full-length SYCE1 are reproduced from (28).

We analyzed the conformation of the SYCE1core-SIX6OS1N complex by size exclusion chromatography small-angle x-ray scattering (SEC-SAXS; fig. S7, D and E). The SAXS real-space pair-distance P(r) distribution (the distribution of interatomic distances within a protein structure) demonstrates positive skew, indicating that SYCE1core-SIX6OS1N retains the rod-like structure of SYCE1core, but with a reduction in its molecular length from 186 to 138 (Fig. 5F). Furthermore, its cross-sectional radius is slightly increased from 9 to 11 (fig. S7F), suggesting an increase from a two- to four-helical coiled coil. These geometric changes are consistent with the SYCE1core-SIX6OS1N 1:1 complex forming a shorter but wider coiled coil than the isolated SYCE1core dimer, as indicated by their SAXS ab initio models (Fig. 5G). Furthermore, the SAXS P(r) distribution of SYCE1pof indicates a similar elongated structure but with an increased tail to a maximum dimension of 180 (Fig. 5F), consistent with it containing the same SYCE1core-SIX6OS1N structure with an extended and potentially unstructured C terminus to amino acid 240. We conclude that SYCE1core mediates a direct interaction with SIX6OS1N that imposes a conformational change to a 1:1 complex that adopts a shorter and wider coiled-coil conformation than the isolated SYCE1core antiparallel homodimer.

Does the SYCE1core-SIX6OS1N complex represent the sole means by which SYCE1 interacts with SIX6OS1? We were unable to obtain soluble biochemical complexes containing SIX6OS1 sequences beyond its N terminus and so used yeast two-hybrid (Y2H) to test SYCE1 binding by full-length SIX6OS1. Having confirmed direct binding of SYCE1core to full-length SIX6OS1, we used C-terminal truncation to dissect its minimal binding site to amino acids 1 to 75, in keeping with our biochemical findings, and identified an additional interaction between SYCE1 177305 and full-length SIX6OS1 (Fig. 6A).

(A) Y2H analysis of interactions between SYCE1 and SIX6OS1 in which positive reactions are indicated by the growth of blue colonies. These data are representative of three repeats. (B) Schematic of the SYCE1-SIX6OS1 interaction based on the Y2H data in (A), with the two binding sites highlighted in red and green. The SYCE1 POF mutation blocks the second binding interface between SYCE1 177305 and SIX6OS1 downstream sequence within region 1262, whereas the SIX6OS1 1021 deletion blocks the first binding interface between SYCE1core (25179) and SIX6OS1n (167). (C) COS7 cells were transfected with mouse Six6os1 1021 alone or in combination with mouse Syce1. SIX6OS1 1021 showed nuclear localization with some cytoplasmatic signal and colocalized in cytoplasmic foci with SYCE1; the percentage of cells exhibiting colocalization is shown. Scale bars, 20 m. (D) Coimmunoprecipitation of SIX6OS1 1021 and Flag-SYCE1 from cotransfected HEK293T cells using anti-Myc or anti-EGFP antibodies, or mouse IgG as a negative control. SIX6OS1 1021 coimmunoprecipitated SYCE1, indicating that the second SYCE1 binding interface is retained. The untransfected lanes confirm the absence of SIX6OS1 1021 and SYCE1 in total protein extracts of untransfected 293T cells.

To establish whether SYCE1core and 177305 bind to the same or distinct sites within SIX6OS1, we established an internal deletion of SIX6OS1 amino acids 10 to 21 (1021) that blocks formation of the SYCE1core-SIX6OS1N biochemical complex (Fig. 5A). SIX6OS1 122 did not interact with any SYCE1 construct (Fig. 6A), indicating that amino acids 10 to 21 are necessary but not sufficient for SYCE1core binding. While 1021 completely abrogated the Y2H interaction of full-length SIX6OS1 with SYCE1core (25179), it retained a robust interaction with SYCE1 177305, suggesting distinct SIX6OS1-binding sites (Fig. 6A). Furthermore, 1021 blocked the ability of SIX6OS1 1262 to interact with SYCE1core and SYCE1pof (amino acids 25 to 240) while retaining its binding to full-length and 25315 SYCE1 (Fig. 6A). Thus, SYCE1 undergoes multivalent interactions with SIX6OS1, with the first binding interface mediated by SYCE1core and SIX6OS1N (167), and the second interface mediated by SYCE1 177305 and downstream sequence within SIX6OS1 1262. Furthermore, the first and second binding interfaces are specifically disrupted by SIX6OS1 deletion 1021 and the SYCE1 POF mutation, respectively, and in both cases, an SYCE1-SIX6OS1 complex is retained through the unaffected alternative site (Fig. 6B).

Our biochemical and Y2H analyses concluded that SIX6OS1 1021 would disrupt the first SYCE1-SIX6OS1 binding interface while retaining complex formation through the second interface. In support of this, we found that SIX6OS1 1021 retained its ability to form intense colocalized foci with SYCE1 upon coexpression in COS7 cells (98% of the cells; Fig. 6C), similar to our previous observations for the SYCE1 POF mutation (Fig. 4A). Similarly, SIX6OS1 1021 retained its ability to coimmunoprecipitate SYCE1 upon coexpression in HEK293 cells (Fig. 6D). Thus, localization and coimmunoprecipitation data from heterologous systems support our Y2H findings that the second SYCE1-SIX6OS1 binding interface is retained in SIX6OS1 1021, mirroring the retention of only the second binding interface that is predicted for the 126155 deletion of the SYCE1 c.375-2A>G NOA mutation (40).

Having established that the severe phenotype of the SYCE1 POF mutation likely results from the disruption of the second SYCE1-SIX6OS1 binding interface and its interaction with SYCE3, we wondered whether a similar phenotype would result from the sole disruption of the first SYCE1-SIX6OS1 binding interface. To test this, we generated mice harboring mutations of Six6os1 alleles encoding internal in-frame deletions of amino acids 10 to 21 (equivalent numbering to the human protein) (fig. S8, A and B). While heterozygotes (designated Six6os11021/WT) were fertile, both male and female homozygotes (designated Six6os11021/1021) were infertile, similar to the SYCE1 POF mutation. In males, we observed reduced testis size (Fig. 7A) and a zygotene-like arrest similar to that observed in the Six6os1 and Syce1 knockouts (11, 16). The mutant spermatocytes were defective in synapsis and SC assembly, with reduced staining for SC proteins SYCP1 (Fig. 7B) and SYCE3 (Fig. 7C) and no staining for SYCE2-TEX12 (Fig. 7, F and G). In contrast with their complete absence in the SYCE1 POF mutation, we observed some residual staining for SYCE1 (Fig. 7D) and SIX6OS1 (Fig. 7E) even though the levels of transcription of Six6os11021 appeared to be increased in the mutant testis (fig. S9 and table S1B). We detected -H2AX (fig. S10A) and DMC1/RAD51 foci (fig. S10, B and C) on aligned axial elements but no MLH1 foci (fig. S10D), indicating the proper induction of DSBs with their failed repair and absence of COs. Thus, SIX6OS1 1021 leads to infertility with a phenotype of failed DSB repair and SC assembly, similar to the SYCE1 POF mutation and those reported for disruption of structural components of the CE (10, 11, 1618).

(A) Genetic deletion of amino acids 10 to 21 of SIX6OS1 led to a reduction of the testis size compared to the WT (mice of 3 months of age). (B) Double immunolabeling of WT pachytene and Six6os1/ zygotene-like spermatocytes with SYCP3 (red) and SYCP1 (green). AEs failed to synapse in Six6os1/ spermatocytes despite partial alignment, with reduced loading of SYCP1 along the AEs. (C to G) Double immunolabeling of spermatocyte spreads with SYCP3 (red) and all CE components (green). Six6os1/ zygotene-like spermatocytes showed reduced signals of (C) SYCE3, (D) SYCE1, and (E) SIX6OS1, and the absence of (F) SYCE2 and (G) TEX12 from the AEs. Scale bars, 10 m. Plots represent the quantification of fluorescence intensity levels in Six6os1/ zygotene-like and WT pachytene spermatocytes (B to E). Welchs t test analysis: ***P < 0.0001. (H) Schematic of how the SYCE1 antiparallel dimer (yellow) undergoes conformational change upon interaction with SIX6OS1 (blue) to form a possible 1:1 complex through consecutive binding interfaces mediated by SYCE1core-SIX6OS1n (site 1) and SYCE1 177305 and downstream sequence within SIX6OS1 1262 (site 2). The consequence of SYCE1 mutations associated with POF (c.613C>T) and NOA (c.375-2A>G) and SIX6OS1 1021 on the integrity, predicted stoichiometry, and conformation of resultant SYCE1-SIX6OS1 complexes is illustrated. Photo credit (A): Laura Gmez-H, Instituto de Biologa Celular y Molecular del Cncer.

Thus, we conclude that both first and second SYCE1-SIX6OS1 binding interfaces are essential for SC assembly and meiotic progression. Furthermore, these findings explain how the sole disruption of individual SYCE1-SIX6OS1 binding interfaces by SYCE1 NOA (c.375-2A>G) and POF (c.613C>T) mutations result in the reported familial cases of human infertility.

The structural and functional integrity of the SC is contingent on the structure and assembly of is constituent protein components. Here, we report that SC assembly depends on multivalent interactions between CE components SYCE1 and SIX6OS1 that are disrupted by infertility-associated mutations of SYCE1. The first binding interface is formed by the structural core of SYCE1 (SYCE1core; amino acids 25 to 179), which undergoes conformational change from an antiparallel homodimer to a 1:1 complex upon interaction with SIX6OS1s N terminus (SIX6OS1N; amino acids 1 to 67). The second binding interface is formed by downstream sequence within SIX6OS1 1262 interacting directly with SYCE1 177305. Through the generation of mice harboring an internal deletion of SIX6OS1s N terminus (1021) and the SYCE1 POF mutation (murine p.Gln243*), which specifically block the first and second binding interfaces, respectively, we find that integrity of both SYCE1-SIX6OS1 binding interfaces is essential for SC assembly and meiotic progression in vivo.

What is the structure of the SYCE1-SIX6OS1 complex? SEC-SAXS analysis revealed that the SYCE1core-SIX6OS1N 1:1 complex formed by the first binding interface has a length and cross-sectional radius of 138 and 11 , in comparison with 186 and 9 for the SYCE1core dimer. We previously reported a model for SYCE1core in which amino acids 52 to 179 form an antiparallel dimeric coiled coil containing a midline kink, with helices of amino acids 25 to 50 packing against this structural core (fig. S11A) (28). A maximum dimension of 138 for SYCE1core-SIX6OS1N suggests a coiled-coil length of approximately 92 amino acids, given a helical rise of 1.5 per amino acid (44). This could be explained by the 52179 region forming a helix-turn-helix structure through exaggeration of the kink to a full turn, which may combine with the helix formed by amino acids 25 to 50 and an helix from SIX6OS1N to form a four-helical coiled coil, consistent with its 11- cross-sectional radius (fig. S11B). The second binding interface between SYCE1 177305 and downstream sequence within SIX6OS1 1262 suggests that SYCE1core-SIX6OS1N likely adopts a parallel configuration to form a single SYCE1-SIX6OS1 1:1 complex of consecutive first and second binding interfaces (Fig. 7H).

Our analysis of the SYCE1-SIX6OS1 complex reveals how the three reported clinical mutations of SYCE1 differentially affect its interaction with SIX6OS1. The SYCE1 NOA mutation c.197-2A>G is predicted to result in a truncated product of amino acids 1 to 65 (39), which would disrupt both binding sites and so likely abrogates SYCE1-SIX6OS1 complex formation and thus works as a null mutation. The SYCE1 NOA mutation c.375-2A>G is predicted to result in internal deletion of amino acids 126 to 155 (40), which would disrupt the first binding interface while retaining the second binding interface, and so is likely to result in a conformationally altered 1:1 complex (Fig. 7H). In contrast, while 1021 SIX6OS1 similarly disrupts the first binding interface and retains the second binding interface, the SYCE1core remains unaffected and so is predicted to enable formation of a head-to-head 2:2 complex (Fig. 7H). The SYCE1 POF mutation c.613C>T generates a premature stop codon (p.Gln241*) that gives a truncated product of amino acids 1 to 240 (41), which we have demonstrated disrupts the second binding interface while retaining the first binding interface (Fig. 7H). Thus, the latter two infertility-associated mutations of SYCE1 specifically disrupt one SYCE1-SIX6OS1 interface while retaining the other, which combine with our mouse genetic studies to confirm that both interfaces are essential for the structural assembly of the SC and its function in meiosis.

What are the structural roles of SYCE1 and SYCE1-SIX6OS1 within the SC? Our analyses of Syce1POF/POF and Six6os11021/ 1021 mouse strains revealed similar phenotypes with retention of some SYCP1 and SYCE3 recruitment to chromosome axes, with absence or substantial reduction of SYCE1 and SIX6OS1, and lack of recruitment of SYCE2-TEX12. This pattern suggests a hierarchical model of SC assembly in which SYCE1 and SYCE1-SIX6OS1 lie downstream of SYCP1 and SYCE3, and upstream of SYCE2-TEX12 (Fig. 1A), which is consistent with existing knockout data (10, 11, 1518). The disruption of SYCE3 binding by the POF mutation suggests that its SYCE1-SIX6OS1 complex would be defective for SC recruitment, whereas the SYCE1-SYCE3 interaction, and hence SC recruitment, should be retained for the SYCE1-SIX6OS1 complex of the SIX6OS1 1021 internal deletion. This explains the greater severity of the CE loading defect in Syce1POF/POF than Six6os11021/ 1021, in which SYCE1 and SIX6OS1 staining was substantially reduced in the latter (83.77% of SYCE1 reduction, 0.12 0.02 in the Six6os11021/ 1021 versus 0.73 0.21 in the WT; 68.27% of SIX6OS1 reduction, 0.24 0.02 in the Six6os11021/ 1021 versus 0.76 0.15 in the WT) but completely absent in the former. Thus, we conclude that the first and second SYCE1-SIX6OS1 interfaces are essential for initiation of SC CE formation and likely function by stabilizing a local three-dimensional SC structure that mediates recruitment and self-assembly of SYCE2-TEX12 into fibers that mediate SC elongation along the chromosome axis. Furthermore, the SYCE1 POF mutation is likely worsened by its additional disruption of SYCE3 binding that removes the residual SYCE1-SIX6OS1 SC recruitment observed for the SIX6OS1 1021 internal deletion.

The existence of SYCE1core as an isolated antiparallel homodimer and in a 1:1 complex with SIX6OS1N raises the question of which is the biologically relevant conformation. It is important to highlight that the CD melting temperatures of SYCE1-SIX6OS1N complexes and isolated SYCE1 dimers are very similar, ranging between 38 and 41C. In contrast, highly stable SC components SYCE2-TEX12 and SYCP3 have melting temperatures of approximately 65C (24, 29). Thus, the relatively low melting temperatures of SYCE1-SIX6OS1N complexes and SYCE1 suggest that they may undergo conformational change in vivo, with each conformation functioning at different stages of meiosis and/or at different locations within the SC. Furthermore, our analysis of SYCE1 infertility-associated mutations and a targeted internal deletion of SIX6OS1 revealed at least four possible conformations of SYCE1 and SYCE1-SIX6OS1 complexes (Fig. 7H). Owing to the direct competition between SIX6OS1N binding and SYCE1core dimerization, these conformations could be achieved in the absence of mutations, through alterations of protein levels, local concentrations, allosteric changes, and posttranslational modifications. Hence, alterative conformations of SYCE1 and SYCE1-SIX6OS1 are intriguing candidates for local structural heterogeneity and the propagation of signals along the length of the SC, which could function in roles such as crossover enforcement and interference. Thus, as we progress toward a full molecular understanding of the mammalian SC, the multivalent SYCE1-SIX6OS1 interactions described herein provide tantalizing possibilities for a dynamic role of SC structure in its enigmatic functions in the mechanics of meiosis.

Human SYCE1 sequences were cloned into pHAT4 and pMAT11 vectors (45) for bacterial expression as His- and His-MBP (Maltose-Binding Protein) fusions with TEV (Tobacco Etch Virus) cleavage sites for fusion protein removal. Human SIX6OS1 was cloned into pRSF-Duet1 vectors with a TEV-cleavable N-terminal MBP fusion for coexpression with SYCE1. Proteins were expressed in BL21(DE3) Escherichia coli cells (Novagen), in 2xYT (Yeast Extract Tryptone) media. Expression was induced with addition of 0.5 mM isopropyl--d-thiogalactopyranoside with the cells incubated at 25C for 16 hours. Cells were lysed via sonication in 20 mM tris (pH 8.0) and 500 mM KCl, followed by centrifugation. Supernatant was applied to an amylose (New England Biolabs) affinity chromatography column, followed by HiTrap Q HP (GE Healthcare) anion exchange chromatography. His- and His-MBP/MBP tags were removed by incubation with TEV protease at 4C for 16 hours. The cleaved proteins were further purified by HiTrap Q HP (GE Healthcare) anion exchange chromatography followed by size exclusion chromatography (HiLoad 16/600 Superdex 200, GE Healthcare). The purified proteins/complexes were concentrated using Microsep Advance 3 kDa (PALL) centrifugal filter units and stored at 80C. Protein samples were analyzed for purity using Coomassie-stained SDSpolyacrylamide gel electrophoresis. Protein molecular weights and extinction coefficients were calculated using ExPASY ProtParam (http://web.expasy.org/protparam/) with protein concentrations determined using a Cary 60 ultraviolet (UV) spectrophotometer (Agilent).

Far-UV CD spectra were collected using a Jasco J-810 spectropolarimeter (Institute for Cell and Molecular Biosciences, Newcastle University). Wavelength scans were recorded at 4C from 260 to 185 nm at 0.2-nm intervals using a 0.2-mm path length quartz cuvette (Hellma). Protein samples were measured at 0.2 to 0.4 mg/ml in 10 mM Na2HPO4 (pH 7.5) and 150 mM NaF. Nine measurements were taken for each sample, averaged, buffer-corrected and converted to mean residue ellipticity (MRE) ([]) (1000 degcm2dmol1 per residue). Spectral deconvolutions were carried out using the Dichroweb CDSSTR algorithm (http://dichroweb.cryst.bbk.ac.uk). CD thermal melts were recorded at 222 nm between 5 and 95C, at intervals of 0.5C with a 1C/min ramping rate. Protein samples were measured at 0.1 mg/ml in 20 mM tris (pH 8.0), 150 mM KCl, and 2 mM dithiothreitol (DTT), using a 1-mm path length quartz cuvette (Hellma). The data were plotted as % unfolded after conversion to MRE ([]222,x-[]222,5)/([]222,95-[]222,5). The melting temperature was determined as the temperature at which the proteins are 50% unfolded.

SEC-MALS analysis of protein samples was carried out at concentrations of 5 to 20 mg/ml in 20 mM tris (pH 8.0), 150 mM KCl, and 2 mM DTT. Samples were loaded onto a Superdex 200 Increase 10/300 GL (GE Healthcare) column at 0.5 ml/min using an KTA Pure (GE Healthcare) system. The eluate was fed into a DAWN HELEOS II MALS detector (Wyatt Technology), followed by an Optilab T-rEX differential refractometer (Wyatt Technology). SEC-MALS data were collected and analyzed using ASTRA 6 software (Wyatt Technology), using Zimm plot extrapolation with a 0.185 ml/g dn/dc value to determine absolute protein molecular weights.

SEC-SAXS experiments were carried out on beamline B21 at the Diamond Light Source synchrotron facility (Oxfordshire, UK). Protein samples at concentrations 6 to 20 mg/ml were loaded onto a Superdex 200 Increase 10/300 GL size exclusion chromatography column (GE Healthcare) in 20 mM tris (pH 8.0) and 150 mM KCl at 0.5 ml/min using an Agilent 1200 high-performance liquid chromatography system. The eluate was fed through the experimental cell, with SAXS data recorded at 12.4 keV, in 3.0-s frames with a detector distance of 4.014 m. Sctter 3.0 (www.bioisis.net) was used to subtract and average the frames and carry out the Guinier analysis for the Rg and cross-sectional Rg (Rc). P(r) distributions were fitted using PRIMUS. Ab initio modeling was performed using DAMMIF (46) imposing P1 symmetry. Twenty independent runs were averaged. The PyMOL Molecular Graphics System, Version 2.0 Schrdinger, LLC was used to generate images of the SAXS ab initio models.

Constructs of human SYCE1 and SIX6OS1 were cloned into pGBKT7 and pGADT7 vectors (Clontech). Y2H experiments were carried out using the Matchmaker Gold system (Clontech) according to the manufacturers guidelines. Y187 yeast strain was transformed with pGBKT7 vectors, while the Y2H gold strain was transformed with pGADT7 vectors. Yeast transformations were carried out using standard lithium acetate methods. Mating of the two strains was carried out in 0.5 ml 2 YPDA (Yeast Peptone Dextrose Adenine) at 30C, 40 rpm, by mixing respective colonies. After 24 hours, the cultures were centrifuged and pellets were resuspended in 0.5xYPDA. These were then plated onto SD/Trp/Leu to select for mated colonies and onto SD/Trp/Leu/Ade/His with X--gal to detect mated colonies through ADE1, HIS3, and MEL1 reporter gene activation. Plates were then incubated for 5 days at 30C.

For developing the Syce1POF/POF model, Syce1single-guide RNA (sgRNA) 5-TGACTTCTTTCCACACTATC-3 targeting the intron 10 was predicted at https://eu.idtdna.com/site/order/designtool/index/CRISPR_SEQUENCE. This crRNA (CRISPR RNA), the tracrRNA (trans-activating CRISPR RNA), and the ssODN (single-stranded donor oligonucleotides) (5-GGGACTCTTCCTCCGAAGCCATGAGGCAGCTGCAGCAATGTAAGATGCAGGGTGGGGCAGGAGGAGGAAATGTCTAGCACTGACTTCTTTCCACACCCCCAGGTAGATCTTCAAGGATGAGAACAAGAAAGCTGAGG

AGTTCCTAGAGGCTGCAGCTCAGCAGCACGAGCAGCTGCAGCAGAGGTGCCACCAGCTACAG-3) were produced by chemical synthesis at IDT. The ssODN contains the mutated base (C>T, p.Gln241*) and the peptidyl-glycine -amidating monooxygenase (PAM) was mutated by substituting it by the human intron sequence (ACTATCAG > CCCCCAG). The crRNA and tracrRNA were annealed to obtain the mature sgRNA. A mixture containing the sgRNAs, recombinant Cas9 protein (IDT), and the ssODN [Cas9 (30 ng/l), annealed sgRNA (20 ng/l each), and ssODN (10 ng/l)] were microinjected into B6/CBA F2 zygotes (hybrids between strains C57BL/6 J and CBA/J) (47) at the Transgenic Facility of the University of Salamanca. Edited founders were identified by polymerase chain reaction (PCR) amplification (Taq polymerase, NZYTech) with primers flanking the exon 11 (primer F 5-CTGTAGAGAAACTGATGAAAGT-3 and R 5-CAAGAAAATATGAAGAGACATAC-3) producing an amplicon of 398 base pairs (bp) for both edited and WT alleles, and either direct sequenced or subcloned into pBlueScript (Stratagene) followed by Sanger sequencing, selecting the point mutation in the targeted region of Syce1 (fig. S2). For generating the Six6os11021/ 1021 (named as Six6os1/), Six6os1-crRNA G68 5-ATCTGTTTGTCAGTTTGGAC-3 and Six6os1-crRNA G75 5-TACTTATGTCTTGCTCATAC-3 targeting exons 2 and 3 and the ssODN (5-GTTCTTACTTTATGTATGCTCTTTTATATATGGCTTCTGAAAGTTTTATTATTTATTTTACACAGTGTCCAAGATGAATGATAATCTGTTTGTCAGTTTGCAAGACATAAGTATTAAAGAAGATACGATTCAAAGAATTAATAGTAAGTAGTTTTGCATGAAATAAATATTTTAGTCTTTTGGTTTTATCTTATATAGCA-3) were predicted, produced, and microinjected, as previously described. Edited founders with the predicted deletion were identified through PCR using primers flanking this region (primer F 5-CACTTACATTTTCCTTTTAAGAATGC-3 and R 5-CCCCTCTCATACATACAAGTTGC-3). The 1021 allele was 285 bp long versus 413 bp of the WT allele (fig. S8, A and B). The founders were crossed with WT C57BL/6 J to eliminate possible unwanted off-targets. Heterozygous mice were resequenced and crossed to give rise to edited homozygous. Genotyping was performed by analysis of the PCR products of genomic DNA with primers F and R.

Histology. For histological analysis of ovaries, after the necropsy of the mice, their ovaries were removed and fixed in formol 10%. They were processed into serial paraffin sections and stained with hematoxylin and eosin. The samples were analyzed using a microscope OLYMPUS BX51, and images were taken with a digital camera OLYMPUS DP70.

Immunocytology. Testes were detunicated and processed for spreading using a conventional dry-down technique. Oocytes from fetal ovaries (E17.5 embryos) were digested with collagenase, incubated in hypotonic buffer, disaggregated, and fixed in paraformaldehyde. Both meiocyte preparations were incubated with the following primary antibodies for immunofluorescence (IF): rabbit SIX6OS1 R1 and R2 [1:100, Proteogenix (11)], rabbit SYCE1 17406-1-AP (1:50, Proteintech), guinea pig SYCE1 (1:100, provided by C. Hg), mouse SYCP3 immunoglobulin G (IgG) sc-74569 (1:1000, Santa Cruz Biotechnology), rabbit serum SYCP3 K921 (1:500), rabbit SYCP1 IgG ab15090 (1:200), guinea pig SYCE3(1:20, provided by R. Benavente), guinea pig SYCE2 (1:100, provided by C. Hg), rabbit TEX12 IgG (1:100, provided by R. Benavente), rabbit anti--H2AX (ser139) IgG #07-164 (1:200) (Millipore), mouse MLH1 51-1327GR (1:5, BD Biosciences), rabbit RAD51 PC130 (1:50, Calbiochem), and rabbit DMC1 R1 and R2 (1:500, Proteogenix). The secondary antibodies used were goat Alexa 555 -mouse A-32727, goat Alexa 488 -mouse A-11001, donkey Alexa 555 -rabbit A-31572 (1:200, Thermo Fisher Scientific), goat Alexa 488Fab -rabbit 111-547-003, and donkey fluorescein isothiocyanate guinea pig 706-095-148 (1:100, Jackson Immunoresearch). Slides were visualized at room temperature using a microscope (Axioplan 2; Carl Zeiss Inc.) with 63 objectives with an aperture of 1.4 (Carl Zeiss Inc.). Images were taken with a digital camera (ORCA-ER; Hamamatsu) and processed with OPENLAB 4.0.3 and Photoshop (Adobe). Quantification of fluorescence signals was performed using ImageJ software.

HEK293T and COS7 cell lines were and obtained from the American Type Culture Collection (ATCC). Cell lines were tested for mycoplasma contamination (Mycoplasma PCR ELISA, Sigma-Aldrich). They were transfected with Jetpei (PolyPlus) according to the manufacturers protocol.

Immunoprecipitation and Western blotting. HEK293T cells were transiently transfected, and whole-cell extracts were prepared and cleared with protein G Sepharose beads (GE Healthcare) for 1 hour. The antibody was added for 2 hours, and immunocomplexes were isolated by adsorption to protein G Sepharose beads overnight. After washing, the proteins were eluted from the beads with 2 SDS gel-loading buffer 100 mM tris-HCl (pH 7), 4% SDS, 0.2% bromophenol blue, 200 mM -mercaptoethanol, and 20% glycerol and loaded onto reducing polyacrylamide SDS gels. The proteins were detected by Western blotting with the indicated antibodies. Immunoprecipitations were performed using mouse -Flag IgG (5 g; F1804, Sigma-Aldrich), mouse green fluorescent protein (-GFP) IgG (4 g; CSB-MA000051M0m, Cusabio), mouse -Myc obtained from hybridoma cell myc-1-9E10.2 ATCC (4 g), and ChromPure mouse IgG (5 g/1 mg protein; 015-000-003). Primary antibodies used for Western blotting were rabbit -Flag IgG (1:2000; F7425 Sigma-Aldrich), goat -GFP IgG (sc-5385, Santa Cruz Biotechnology) (1:3000), and rabbit -Myc Tag IgG (1:3000; #06-549, Millipore). Secondary horseradish peroxidaseconjugated -mouse (715-035-150, Jackson ImmunoResearch), -rabbit (711-035-152, Jackson ImmunoResearch), or -goat (705-035-147, Jackson ImmunoResearch) antibodies were used at 1:5000 dilution. Antibodies were detected by using Immobilon Western Chemiluminescent HRP Substrate from Millipore. Both Syce1POF and Six6os1 1021 complementary DNAs (cDNAs) used for IF and coimmunoprecipitation experiments were reverse transcription PCRamplified (the primers used for it were Syce1 S 5-GAGCAGTATGGCCACCAGACC-3 and Syce AS 5-GAGGAGGGTATTAGGTCCTGC-3; Six6os1 S 5-AGTGTCCAAGATGAATGATAATCTG-3 and Six6os1 AS 5-GTTCAAAAATAATAACTCAAAAAAAC-3) from total RNA extracted from Syce1POF/POF and Six6os11021/ 1021 mice, respectively. PCR-amplified fragments were cloned in pcDNA3-based mammalian expression vectors with different tags (enhanced GFP or Flag) and verified by Sanger sequencing.

Total RNA was isolated from testis of WT and mutant mice. To analyze the expression of Syce1 and Six6os1 mRNAs, equal amounts of cDNA were synthesized using SuperScript II Reverse Transcriptase (Invitrogen, Life Technologies) and Oligo (dT). Quantitative PCR (qPCR) was performed using FastStart Universal SYBR Green Master Mix (ROX) (Roche) and specific forward and reverse primers: qSYCE1_F 5-GGACATGGTGAAAAAGTTGCAG-3 and qSYCE1_R 5-CAGTTCCTTCTGCAGGTTGTC-3 for Syce1, and qSIX6OS1_F 5-GCTGAATGTGGAGATAAAGAG-3 and qSIX6OS1_R 5-AGGAGTTTCAGGAGTTTGAGG-3 for Six6os1. All qPCR reactions were performed at 95C for 10 min and then 40 cycles of 95C for 15 s and 62C for 1 min on the iQ5 Thermal Cycler (Bio-Rad). -Actin was amplified as a housekeeping gene with the primers q-actin_F 5-GGCACCACACCTTCTACAATG-3and q-actin_R 5-GTGGTGGTGAAGCTGTAGCC-3.

Statistics. To compare counts between genotypes, we used the Welchs t test (unequal variances t test), which was appropriate as the count data were not highly skewed (i.e., were reasonably approximated by a normal distribution) and, in most cases, showed unequal variance. We applied a two-sided test in all the cases. Asterisks denote statistical significance: *P < 0.01, **P < 0.001, and ***P < 0.0001.

Acknowledgments: We thank Diamond Light Source and the staff of beamline B21 (proposals sm15836, sm21777, and sm23510). We thank H. Waller for assistance with CD data collection. Funding: O.R.D. is a Sir Henry Dale Fellow jointly funded by the Wellcome Trust and Royal Society (grant number 104158/Z/14/Z). This work was supported by MINECO (BFU2017-89408-R) and by Junta de Castilla y Leon (CSI239P18). F.S.-S., L.G.-H., and N.F.-M. are supported by European Social Fund/JCyLe grants (EDU/556/2019, EDU/1083/2013, and EDU/310/2015). CIC-IBMCC is supported by the Programa de Apoyo a Planes Estratgicos de Investigacin de Estructuras de Investigacin de Excelencia cofunded by the CastillaLen autonomous government and the European Regional Development Fund (CLC201701). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Ethics statement: Mice were housed in a temperature-controlled facility (specific pathogen free) using individually ventilated cages, standard diet, and a 12-hour light/dark cycle, according to European Union laws at the Servicio de Experimentacion Animal, SEA. Mouse protocols were approved by the Ethics Committee for Animal Experimentation of the University of Salamanca (USAL). We made every effort to minimize suffering and to improve animal welfare. Blinded experiments were not possible since the phenotype was obvious between WT and mutant mice for all of the experimental procedures used. No randomization methods were applied since the animals were not divided in groups or treatments. The minimum size used for each analysis was two animals per genotype. Author contributions: F.S.-S., L.G.-H., O.M.D., N.F.-M., C.G.-P., M.S.-M., and O.R.D. performed experiments. O.R.D. and A.M.P. designed experiments, analyzed data, and wrote the manuscript. A.M.P., E.L., and O.R.D. supervised and designed the work. Competing financial interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Link:
Meiotic chromosome synapsis depends on multivalent SYCE1-SIX6OS1 interactions that are disrupted in cases of human infertility - Science Advances

This story is Parts 3 and 4 of a four-part series on the hemp industry in Colorado. Read and listen to Parts 1 and 2 here.

Colorados top three commodity crops are wheat, beans and corn. But theres a new kid on the block: hemp and its confusing sex life and relationship to marijuana is complicating matters.

Prohibition relegated cannabis to basements and garages where it would be grown in secret for decades. But as regulations loosened, hemp has moved to outdoor fields and industrial-size greenhouses.

Mike Workman owns New Earth Hemp Company out of Laporte, Colorado, and even he is humbled by this shift in scale.

Ser Williams / KUNC

Whatever you think you know, you dont know when youre trying to plant an acre of it, he said.

Outdoor growing is a lot cheaper than indoor growing, but it comes with its own set of challenges.

Then you have, you know, bugs, weather, hail, snow, said Ted Duerr, a hemp farmer, breeder, and co-owner of BDG Genetics in the small town of Frederick in southern Weld County. Pollen is one of the biggest things.

Plants produce pollen. So, how could that be an issue?

The unique reproductive life of hemp

This is where science and sex come into play. As a plant matures, it produces a flower. Males produce pollen, which pollinate female flowers, which in turn develop fruits also known as seeds.

Most plants contain male and female parts on the same plant, sometimes even in the same flower. But hemp is unique one plant will have only male flowers while another will have only female. And females can transform.

Female hemp plants are hermaphrodites, meaning they can turn into males. Depending on what youre growing hemp for -- fiber, seed oil or the chemical cannabinoids the unexpected sex-switch can be a problem.

Ser Williams / KUNC

If youre in it for the fiber, pollen doesnt affect your crop, so it doesnt matter what sex your plants are.

Ser Williams / KUNC

Ser Williams / KUNC

If youre growing hemp for seeds to press into oil, you want a female plant to be fertilized by a males pollen. As Ted Duerr explained, those strains need the males in there to pollinate and create the grain in the flower.

But to grow hemp for the flower or cannabinoids you need a virgin female flower that never comes into contact with pollen.

According to Workman, you can revert females into a masculine form, but you cant really revert males into a feminine form. This is a problem, because once a female plant turns into a male, it can fertilize other females in the field, and make the flowers develop seeds.

For CBD production, high CBD genetics, all these people that are going for smokable flowers, CBD oil, everything like that, you do not want males in your field, because you do not want seeds in your flower, said Duerr.

Since pollen travels on the wind, Duerr says a neighboring hemp crop with male plants could impact the outcome of your field. This happened last year.

A guy that we know did 600 acres of grain and fiber and there was multiple people around him that were trying to do smaller acreage for CBD oil and smokable flower, but needless to say, all their crops were ruined for what they wanted to do cause they all became seeded, he said.

Even with current genetic techniques, the biology underlying the sex switch is not well understood. It could be dependent on the environment.

Other important traits like THC concentration are dependent on the environment, too. But while a male plant wont make your crop illegal, too much THC will.

Ser Williams / KUNC

The deal with cannabinoids

Listen to part 4 of the audio here

THC is a psychoactive chemical compound in marijuana. Its what gets you high when its smoked or consumed. THC is just one cannabinoid, but the plant produces over 100 different cannabinoids like CBD and CBG that hemp growers are after for medicinal uses. CBG is produced first, and then specific enzymes convert CBG into either CBD or THC.

Ser Williams / KUNC

While cannabis was being grown indoors and in secret -- during prohibition the plant was grown for one purpose.

If it had not been for prohibition, cannabis and hemp would not be what they are today, and they would just probably be, itd be like, wed all be smoking hemp, wed all be smoking rope, said Workman.

Marijuana breeders continue to coax CBG into THC, thereby increasing THC content. According to the Drug Enforcement Agency, average THC concentration increased from 4% in the mid-90s to 12% today. THC can be found as high as 25% at some dispensaries.

But now, breeders need the plant to take the other fork in the road: the path that turns CBG into CBD.

For hemp growers, like Workman and Duerr, THC levels are strictly regulated and cannot exceed 0.3%.

It takes one day extra in the field for you to go from safe to hot. Thats problematic. Its basically a scenario that can turn innocent farmers into criminals, said Brett Eaton, owner of Green Cherry Organics, a hemp breeding company in Fort Collins.

Before a farmer harvests, the Colorado Department of Agriculture samples flowers from a hemp field to test for cannabinoid levels.

Thats the worst part of this job, said Brian Koontz, the hemp program manager with the Colorado Department of Agriculture. A lot of its very fun, but come September, October we start getting hot results back from the lab. When I say hot results that means its gone above the allowable three-tenths of one percent, he said. We demand by law that it be disposed of in a manner thats irretrievable and does not enter the stream of commerce and does not leave the registered land area.

Last year, 99 hemp fields in Colorado were above the limit. They were either burned or plowed into the soil on site.

Breeding the magic plant

Eaton and other hemp breeders are trying to find the perfect variety a female plant that would never transform into a male and never produce too much THC (while producing plenty of other cannabinoids).

Ser Williams / KUNC

Ser Williams / KUNC

Slowly over about three years of time, we had amassed about 286 phenos in house, and thats where we go on what we call the pheno-hunt, said Eaton.

The phenotype of a plant is how genes express themselves to display observable characteristics. While you cant see the chemicals in a plant, you can measure them, so high CBD is a desirable phenotype.

But its not just about the cannabinoid profile. You have to be able to grow the plant too.

We have an R&D department where we focus on growth trails first and foremost, Eaton said. Well do everything from rooting trials, soil density trials, soil nutrition trials, water trials

Once you cross the parent plants, you assess the offspring for the best combination of all of these traits. Like the differences between siblings, genetics from the same set of parents will produce an array of phenotypes.

For instance, Im going through a CBG genetic right now, and I started 1,400 seeds of that CBG strain. So, Im in the pheno-hunt of 1,400 plants, which is a crazy task to try to narrow that down to which is the one or two or three mothers that you want to keep, said Eaton.

But this isnt just getting the right genetic mix, its also about how a grower cares for his plants -- which affects how the genes are expressed. The trick with genes is that they will turn on or turn off depending on the environment.

Thats what these farmers really need to know, warned Ted Duerr. Certain genetics you cant just let it go to full maturity. Most of the genetics out there will go hot.

With hemp, if you leave the crop in the field too long or dont water it on time, the plant can build up too much THC, known as going hot in the industry.

There was some fields that we knew, and they did not water them, and they ended up getting hotter than other fields that Ive seen, he said.

Brett Eaton doesnt know of a hemp variety that makes over 5% CBD that wont go hot in the field. He only grows plants for cannabinoids in a greenhouse, where he can closely monitor the environmental conditions.

Ted Duerr

Some states have asked for a THC variance up to 1% only 11 Colorado hemp fields would have been destroyed last year had this been the case. The Colorado Department of Agriculture is interested, but they said growers will need to wait for the next farm bill to pass in 2023 before any changes to THC limits come into effect.

Farmers arent used to growing hermaphroditic crops that pose a legal threat. So, Duerr has a simple piece of advice for those thinking about growing hemp: Dont go too big." He says maybe start with an acre and see how it turns out.

Read more:
Unpredictable Biology And Stringent Regulations Turn Up The Heat For Hemp Farmers - KUNC

The core of this project is the heart. As humans, we can understand that heart rate tells us a lot about our emotions and how we feel in each life situation. Since we dont speak the language of animals, we need projects like this to better understand how they perceive their environments, so we can use that information to help them thrive.

Only 3% of the natural habitat available for maned wolves in Brazil is inside protected areas. That means animals are also living in areas where encounters with humans, vehicles and farming machinery are common and stress levels are higher. When sugar cane fields are harvested, for example, wolves can lose all their vegetation cover and food resources in less than 24 hours.

Having objective measurements of stress levels, and an understanding of where and how wolves move, could help us and land owners think about managing the land in ways that are more beneficial to wildlife. Our main goal is to become experts in the use of this technology, so we can apply it to the conservation of maned wolves and other endangered species in the wild. Studying the animals at SCBI has provided us with the skills we need, as well as the opportunity to overcome any obstacles in a controlled and safe environment.

This project is an excellent example of how much we can accomplish when we work as a team. We are physiologists, ecologists, biologists, veterinarians, animal care staff, students, donors, partners and more, all coming together to make this work possible. After a successful start, were expanding our scientific research at SCBI to other species, including eight scimitar-horned oryx. We proved that heart monitors can be safely used in maned wolves, and generated valuable information to compare with wild wolves. In 2021, we plan to start a field study with maned wolves in Brazil.

The Rhythm of Life Project was made possible with generous support from Medtronic.

View post:
A Heart to Heart with Maned Wolves | Smithsonian's National Zoo - Smithsonian's National Zoo and Conservation Biology Institute

The good news is that legions of women scientists have been fighting back against this sexism for years, in many cases with extraordinary success. Being trained to gather data to measure and document problems helped us prove that the issues we faced existed, and the problem-solving skills wed honed in our labs helped us figure out how to address them. For Nancy Hopkins and other women at MIT in the late 1990s, that meant taking out a tape measure and showing that, while senior male professors had labs averaging 3,000 square feet, senior female professors had, on average, just 2,000 square feet in which to workroughly as much as junior male faculty members.

Im happy to say that advances have been made to enhance the participation of women in science, mathematics, technology, engineering, and medicine since I began my career. By the mid-1980s, women in microbiology were banding together to make sure that nominations for leadership positions in professional organizations included womennot just once, but year after year, so that wed have time to make reforms last. During my tenure as director of the National Science Foundation, I worked with the president and Congress to increase the countrys overall budget for research in science, mathematics, and engineering. My team and I also made it a national priority to lift the status of women in academic science and to reform the misogynistic culture of universities. We launched ADVANCE, a program that, from 2001 to 2018, funded contracts to solve problems experienced by women in the sciences on more than 100 campuses.

Despite all of these efforts, major disparities persist. A study last year found that the typical National Institutes of Health research grant to a male principal investigator is $41,000 larger than to a female one. The gap between NIH grants for women and men is even larger at top universities: $68,800 at Yale and $76,500 at Brown.

In 2011, the biologist Jo Handelsman and her team at Yale decided to perform an experiment to see just how bad bias against women in science was. She persuaded 127 scientists in biology, chemistry, and physics departments at six leading research universities across the country to evaluate a job application. Ostensibly, the application came from a recent graduate seeking a position as a laboratory manager, and all of the applications were identical, or almost: half the applications were signed John, and half were signed Jennifer. The disturbing results revealed both men and women scientists judged the male applicant to be more competent than the female applicant with identical qualifications. More faculty members said theyd hire John than Jennifer, and those who were willing to hire her would pay her almost $4,000 less a year. All across the boardno matter their age, sex, scientific field, or tenure statusfaculty members preferred John.

More:
Women Scientists Have the Evidence About Sexism - The Atlantic

Monarch butterflies in one of the reserves of Michoacn (Mexico).Getty Images

Spring is the time when the sex lives of many animals awaken and strategies begin. Male monarchs spray females with aphrodisiac powder and drag them to the ground, writes David Barrie in his work. The most incredible trips (Review, 2020). This powder is the set of chemical pheromones that butterflies use to differentiate themselves. It is a necessary technique to be noticed in the middle of a very dense forest hundreds of meters away, explains Zackary Graham, researcher at the School of Life Sciences of the Arizona State University (United States) and specialist in insects and crayfish.

In the animal world, everyone does everything possible so that it is their sperm that reaches the females egg

Elisa P. Bads, from the University of Groningen (Holland)

Other species are based on sexual dimorphism, that is, on physical differences based on sex, to attract their partners without having to resort to powders aphrodisiacs. Males take advantage of their appearance to attract the attention of females, such as turkeys with their great feathers, newts with their colors and crests, or elk with their antlers. On several occasions, the largest and strongest specimen is the one that seduces the female because it ensures a better offspring.

The Graham Research Team has published a study in the journal Biology Letters about a little-known species that also uses its physical advantages to get a mate: narwhals (Monodon monoceros). Most of the previous hypotheses indicate that the tusk that comes out of their forehead is used to hunt, fight and drive away predators. Although this idea is not ruled out, Graham wanted to go further when he saw that the females did not have one.

Thanks to a collection of data on the behavior of 245 adult narwhals over 35 years, the researchers confirm that these animals use their tusks to demonstrate to other males that they are better and stronger and attract females. If they have a long tusk, it means that their body is proportionally large. And there is the key: Females are more attracted to those that are larger because it indicates more and better quality sperm, explains Graham.

Something similar happens with squid and cuttlefish. The male consorts of some species of squid (Family Loliginidae) are larger than females and use their large size, physical strength, and aggressive skin color to scare off potential competitors while standing guard. Sometimes, they can have half of the body that is directed towards the female with the coloration romantic and the other half with the coloring aggressive, Explains Fernando ngel Fernndez-lvarez, expert in cephalopods and researcher at the Ryan Institute and in the School of Natural Sciences of the National University of Ireland (Galway). However, victory is never assured. An even bigger male can always come along and eject the other, supplant him and begin to copulate with the female.

Some females, depending on the species, have several places where the male can deposit his sperm: near the exit of the oviduct and near the mouth, through the seminal receptacle of the oral membrane. This curious morphology allows them to have eggs from different males. The squids called sneakers (the males more rogues) are the ones who take advantage of this curious feature. These specimens are the same size as the female and give off a similar color to her, so the dominant male, who stands guard, does not perceive them as a threat. However, these small animals approach the female and inoculate their sperm in the oral reproduction zone thanks to a head to head copulation, says Fernndez-lvarez. All this, without the consort noticing.

Squids and cuttlefish are not the only ones to accumulate sexual partners. In the world of birds, polygamy exists more than is believed. Since the 1990s, thanks to genetics, scientists have shown that some socially monogamous birds have copulations outside the nest to ensure good offspring. The objective is to find the best female or the best male to reproduce with quality. This is what Elisa Prez Bads, a researcher at the University of Groningen (Holland) and lead author of a study published in the journal Evolution on the behavior of the tit, a small species with a very striking blue and yellow plumage.

These birds have a very high reproductive rate, of about eight or nine chicks per year, and can take care of up to 16 children in a single nest. The sexual life of this species outside this time is very calm, even non-existent. It is such a strong investment to take care of your children that the rest of the year they are calmer, looking for food and resting to recover all that they have lost. They change their plumage to be beautiful the following spring, says Bads. Both the male and the female, if they are not satisfied with the quality of the eggs or if they see another with a more showy plumage, they can change partners. But in general, it is the female who is going to flutter in search of a male, the most handsome one, the one with the best territory and there she will build her nest, adds the expert.

Frogs and toads use sound to attract females. They go towards the specimen with the most powerful or frequent songs, signs of the good quality of the males genes. A curious thing highlighted by Ignacio De la Riva, an expert researcher on amphibians from the National Museum of Natural Sciences of the Higher Council for Scientific Research, is that, in certain species, there are male satellites that take advantage of the musical qualities of others. Instead of wasting energy singing, these specimens stay quiet near another male that emits sound. When the female approaches, he intercepts her and attempts to mate with her.

The bog lizard, the reptile with the largest land distribution in the world, plays rock, paper or scissors, according to a study published in the journal Biological Science. Patrick Fitze, one of the authors of the work and researcher at the MNCN-CSIC, explains that the species is divided into three colors determined by the alleles (orange, yellow and white) and each one has its territory. For the female, the most interesting thing is to mate with the less frequent color so that her children do not have to compete with the rest of the lizards of the same aspect. If the majority are oranges, it will go for yellow, when yellow multiplies, it will go for white, and then again for orange. And the game begins again, again and again. In this species there are also males sneakers They enter the territory of the other to mate with the females. We have called it rock, paper or scissors because each specimen can choose which strategy to use even if its genetics determine it, explains the researcher.

The strategies of animals to reproduce are numerous and varied. The list is long. Forced copulations can also occur, although uncommon, as does the cat, which uses the spines of its penis to drag and remove the sperm of the previous male, says Elisa P. Bads. In the animal world, everyone does everything possible so that it is their sperm that reaches the females egg, she concludes.

You can follow Matter in Facebook, Twitter, Instagram or subscribe here to our newsletter

More here:
The polygamy of birds, the adultery of squids and other sexual strategies of animals - Pledge Times

September 1 marks the start of the PCOS (Polycystic ovary syndrome) awareness month and this year, it also marks the start of the World PCOS Day of Unity event, organised by the PCOS Challenge: The National Polycystic Ovary Syndrome Association. PCOS Awareness Month is a federally designated event and its aim is to raise awareness and help improve the lives of those affected by PCOS through overcoming symptoms and changing the lifestyle that leads to PCOS.

Polycystic ovary syndrome (PCOS) is a serious genetic, hormone, metabolic and reproductive disorder that affects women and girls, according to the PCOS Challenge Association. It is a set of symptoms that present themselves in women due to elevated levels of androgens (male hormones) in females.

PCOS occurs due to an amalgamation of genetic and environmental factors, and unfortunately, in the past 7-8 years, the number of people affected by this has increased exponentially, making it a fairly common gynaecological problem in the modern world. 3-4 out of 10 women, leaving room for genetics, suffer from PCOS.

In healthy women, one egg is released from the ovary, somewhere around the 15th day of the period, and with women affected by PCOS, this does not happen. The egg gets trapped inside the ovary and fluid accumulates around it and forms a bubble-like structure called a cyst. Over the course of time, many such cysts are formed which result in PCOS

This health condition presents itself through a combination of various symptoms that include an irregular menstruation cycle, acne, weight gain, unwanted hair growth on parts of the body which previously did not grow hair, excessive hair loss from the scalp, a blackish appearance on the neck and perhaps, the most significant being the difficulty in conceiving or bearing children.

One the biggest contributing factors to PCOS is obesity and the lifestyle that is prevalent in the modern world. Here the consumption of junk food is a common occurrence, exercise is minimal and stress levels are high. Even lack of regular sleep contributes to the development of PCOS in women. Family tendencies also play a major role, and if you have a mother or sister or relative who is suffering from PCOS, it increases the likelihood of you getting affected as well.

The easiest way to reverse the cycle on PCOS is to get at least an hours worth of exercise in a day and a diet that is rich in proteins and cuts down on sugars and carbohydrates. A minimum of eight-hours of sleep every night is also essential in maintaining a healthy body, especially in the long run.

Follow more stories on Facebook and Twitter

See the rest here:
World PCOS Awareness Month: All you need to know about PCOS and its prevention - Hindustan Times

Hosted by investor judges, the Start-Up Showcases will take place within four themed tracks: Precision Livestock Farming, Aquaculture, Animal Health, and the Microbiome & Feed.

Investor Jenny Rooke, Managing Director, at Genoa Ventures says: As innovative start-ups increasingly reimagine biology as an engineering-augmented process, exciting new approaches to addressing fundamental needs in animal health and agriculture will result.

Cattle Eye (Ireland) has created the worlds first autonomous livestock monitoring platform that is improving the lives of farmers and livestock, and revolutionising the protein supply chain. Its deep learning AI platform is designed to interpret the visual imagery of livestock from web cameras and extract valuable insights about those cows.

Cynomys (Italy) is the first company to patent an IoT solution for monitoring environmental parameters in animal housings. Our self-contained devices can control more than 30 parameters and farmers can monitor anything, from toxic gases to water quality factors, on our secure cloud platform at any time wherever they are, highlights International Manager, Ambra Milani.

Soos Technology (Israel) develops hatching technology to solve the biggest challenge the egg-production industry has today, male-chick culling. Its solution is an incubation system (AI-driven software controlling a customized incubation cell) that controls the sex development process in chicken embryos and results in more functional females that lay eggs.

Impact-9(Ireland) develops aquaculture structure solutions for high energy environments using flexible materials and smart design approaches to address big wave challenges. It aims to open access to new sites and deliver clean, secure, sustainable aquaculture with reduced maintenance and competitive costs.

Umitron (Singapore & Japan) is building user-friendly data platforms for aquaculture by using IoT, satellite remote sensing, and AI. Its technology helps farmers improve farm efficiency, manage environmental risks, and increase business revenues.

Micron Agritech (Ireland) has developed Tastail, a portable testing kit that allows farmers or vets to detect parasitic infections in cattle instantly and on-site. Parasites are a huge health problem in cattle and many farmers are currently using medication as a preventative measure instead of testing for parasites. This is leading to resistance and so the EU has passed legislation to ban the prophylactic use of anthelmintic medication, says Director & Co-Founder, Sean Smith.

Pharm Robotics (USA) With the animal health sector heading towards complete automation as labour challenges continue, Pharm Robotics system offers a complete solution with instant analytics to the shot-delivery process, which will be a must-have for dairy farmers to achieve operational sustainability. Alika Chuck, Co-Founder & CFO says: With Sureshot, dairy farmers will now have more time to tend to other important areas within their operation and make better-informed decisions.

Zelp(UK) develops smart wearable technology for cattle that neutralises livestock methane exhalations and is responsible for 40% of the total agricultural greenhouse gas emissions. The wearable also gathers unique emissions-related data to improve animal welfare, optimise herd management, and quantify emissions.

General Probiotics (USA) develops innovative cellbots and antimicrobial probiotics that eliminate harmful pathogens in livestock that enable the production of safe food and reduce our current dependency on antibiotics. In our most recent field trial, we observed a 67% decrease in the mortality rate caused by necrotic enteritis in chickens infected with Clostridia perfringens, when birds were administered our cellbots, says CEO Yiannis Kaznessis.

Beta Bugs (UK) creates high performance insect genetics for the insects as the protein sector is using proven biotech and breeding strategies. Its current focus is on the Black Soldier Fly and its use as an animal feed, with a mission of doubling this industry's productivity, enabling it to compete on price point with commoditized feed ingredients.

The start-ups will be quizzed on the viability of their technologies and business models by seasoned animal agtech investors:

The start-up community will join the virtual Animal AgTech Innovation Summit on September 14, as it brings together 400 animal agtech leaders for an action-packed day of 1-1 video networking, live panels and small group roundtable discussions.

The full programme, speaker faculty and delegate registration are available at http://www.animalagtecheurope.com.

Excerpt from:
Ten innovators take the digital stage to transform the livestock industry - The Pig Site