Page 11234..1020..»

Archive for the ‘Crispr’ Category

Natural CRISPR’s Safety Feature Could Become Genetic Dimmer Switch – Genetic Engineering & Biotechnology News

The CRISPR systems inside bacteria serve as adaptive immune systems, but they also threaten to unleash autoimmune reactions. Fortunately, for bacteria such as Streptococcus pyogenes, these systems have a built-in safety feature: a long-form transactivating CRISPR RNA (tracrRNA). Unlike the short-form tracrRNA, which together with CRISPR RNA (crRNA) complexes with the CRISPR-Cas9 enzyme and guides it to DNA sites where it executes cuts, the long-form tracrRNA guides the enzyme to the enzymes own genetic promoter.

The long-form tracrRNA that complexes CRISPR-Cas9 enzyme doesnt need to bind to crRNA, and it doesnt cut. Instead, it merely lingers in place, preventing gene expression.

Essentially, long-form tracrRNA acts as a safety feature, dialing down a bacteriums immune system to prevent it from attacking the bacterium itself rather than foreign DNA. This self-protection function for long-form tracrRNA was uncovered by researchers at Johns Hopkins University. The researchers, led by Joshua W. Modell, PhD, also explored whether long-form tracrRNA could be reprogrammed to guide CRISPR-Cas9 to DNA sites other than the CRISPR-Cas9 promoter.

The researchers findings appeared in the journal Cell, in an article titled, A natural single-guide RNA repurposes Cas9 to autoregulate CRISPR-Cas expression. According to the researchers, long-form tracrRNA could serve as a programmable genetic dimmer switch, one that could be used to inhibit the expression of designated genes in research applications.

We show that in the S. pyogenes CRISPR-Cas system, a long-form transactivating CRISPR RNA folds into a natural single guide that directs Cas9 to transcriptionally repress its own promoter (Pcas), the articles authors wrote. Further, we demonstrate that Pcas serves as a critical regulatory node.

Scientists have long worked to unravel the precise steps of CRISPR-Cas9s mechanism and how its activity in bacteria is dialed up or down. Looking for genes that ignite or inhibit the CRISPR-Cas9 gene-cutting system for the common, strep-throat causing bacterium S. pyogenes, the Johns Hopkins scientists found a clue regarding how that aspect of the system works.

Specifically, the scientists found a gene in the CRISPR-Cas9 system that, when deactivated, led to a dramatic increase in the activity of the system in bacteria. The product of this gene appeared to re-program Cas9 to act as a brake, rather than as a scissor, to dial down the CRISPR system.

From an immunity perspective, bacteria need to ramp up CRISPR-Cas9 activity to identify and rid the cell of threats, but they also need to dial it down to avoid autoimmunitywhen the immune system mistakenly attacks components of the bacteria themselves, said graduate student Rachael Workman, a bacteriologist working in Modells laboratory.

To further nail down the particulars of the brake, the teams next step was to better understand the product of the deactivated gene, a tracrRNA. tracrRNAs belong to a unique family of RNAs that do not make proteins. Instead, they act as a kind of scaffold that allows the Cas9 enzyme to carry the guide RNA that contains a mug shot of previously encountered phage DNA. The mug shot allows Cas9 to cut matching DNA sequences in newly invading viruses.

tracrRNA comes in two sizes: long and short. Most of the modern gene-cutting CRISPR-Cas9 tools use the short form. However, the research team found that the deactivated gene product was the long-form of tracrRNA, the function of which has been entirely unknown.

In bacteria, DNA-cutting CRISPR-Cas9 complexes typically consist of a Cas9 enzyme and a guide RNA. The guide RNA consists of a short-form transactivating CRISPR RNA (tracrRNA) scaffold and a DNA-sequence-specific CRISPR (crRNA). Long-form tracrRNA, however, can complex with and guide Cas9 without crRNA. When long-form tracrRNA does so, it guides the Cas9 enzyme to a Cas9 promoter. The promoter is not cut, but expression is repressed. Left: A schematic of the long-form of the tracrRNA used by the CRISPR-Cas9 system in bacteria. Right: the standard guide RNA used by many scientists as part of the gene-cutting CRISPR-Cas9 system. (Often, the guide RNA is a single synthetic molecule, rather than a combination of tracrRNA and crRNA.) [Joshua Modell and Rachael Workman, Johns Hopkins Medicine]The long and short forms of tracrRNA are similar in structure and have in common the ability to bind to Cas9. The short-form tracrRNA also binds to the guide RNA. However, the long-form tracrRNA doesnt need to bind to the crRNA, because it contains a segment that mimics the crRNA. Essentially, long-form tracrRNAs have combined the function of the short-form tracrRNA and crRNA, explained Modell, assistant professor of molecular biology and genetics at the Johns Hopkins University School of Medicine.

The researchers used genetic engineering to alter the length of a certain region in long-form tracrRNA to make the tracrRNA appear more like a guide RNA. They found that with the altered long-form tracrRNA, Cas9 once again behaved more like a scissor.

Other experiments showed that in lab-grown bacteria with a plentiful amount of long-form tracrRNA, levels of all CRISPR-related genes were very low. When the long-form tracrRNA was removed from bacteria, however, expression of CRISPR-Cas9 genes increased a hundredfold.

Bacterial cells lacking the long-form tracrRNA were cultured in the laboratory for three days and compared with similarly cultured cells containing the long-form tracrRNA. By the end of the experiment, bacteria without the long-form tracrRNA had completely died off. De-repression causes a dramatic 3,000-fold increase in immunization rates against viruses, the articles authors noted. However, heightened immunity comes at the cost of increased autoimmune toxicity.

These findings suggest that long-form tracrRNA normally protects cells from the sickness and death that happen when CRISPR-Cas9 activity is very high. We started to get the idea that the long form was repressing but not eliminating its own CRISPR-related activity, recalled Workman.

To see if the long-form tracrRNA could be re-programmed to repress other bacterial genes, the research team altered the long-form tracrRNAs spacer region to let it sit on a gene that produces green fluorescence. Bacteria with this mutated version of long-form tracrRNA glowed less green than bacteria containing the normal long-form tracrRNA, suggesting that the long-form tracrRNA can be genetically engineered to dial down other bacterial genes.

Another research team, from Emory University, found that in the parasitic bacteria Francisella novicida, Cas9 behaves as a dimmer switch for a gene outside the CRISPR-Cas9 region. The CRISPR-Cas9 system in the Johns Hopkins study is more widely used by scientists as a gene-cutting tool, and the Johns Hopkins teams findings provide evidence that the dimmer action controls the CRISPR-Cas9 system in addition to other genes.

Using bioinformatic analyses, we provide evidence that tracrRNA-mediated autoregulation is widespread in type II-A CRISPR-Cas systems, the Johns Hopkins scientists added. Collectively, we unveil a new paradigm for the intrinsic regulation of CRISPR-Cas systems by natural single guides, which may facilitate the frequent horizontal transfer of these systems into new hosts that have not yet evolved their own regulatory strategies.

The researchers also found the genetic components of long-form tracrRNA in about 40% of the Streptococcus group of bacteria. Further study of bacterial strains that dont have the long-form tracrRNA, said Workman, will potentially reveal whether their CRISPR-Cas9 systems are intact, and other ways that bacteria may dial back the CRISPR-Cas9 system.

The dimmer capability that the experiments uncovered offers opportunities to design new or better CRISPR-Cas9 tools aimed at regulating gene activity for research purposes. In a gene editing scenario, Modell suggested, a researcher may want to cut a specific gene, in addition to using the long-form tracrRNA to inhibit gene activity.

Excerpt from:
Natural CRISPR's Safety Feature Could Become Genetic Dimmer Switch - Genetic Engineering & Biotechnology News

CRISPR (CRSP) Up More Than 80% in Past 3 Months: Here’s Why – Yahoo Finance

TipRanks

Big Tech has been in the news lately, and not necessarily for the right reasons. Accusations of corporate censorship have hit the headlines in recent weeks. While serious, this may have a salutary effect the public discussion of Big Techs role in our digital lives is long overdue. And that discussion will get underway just as the Q4 and full-year 2020 financial numbers start coming in. Of the FAANG stocks, Netflix has already reported; the other four will release results in the next two weeks. So, the upcoming earnings will garner well-deserved attention, and Wall Streets best analysts are already publishing their views on some of the markets most important components. Using TipRanks database, we pulled up the details on two members of the FAANG club to find out how the Street thinks each will fare when they publish their fourth quarter numbers. According to the platform, both have received plenty of love from the analysts, earning a Strong Buy consensus rating. Facebook (FB) Lets start with Facebook, the social media giant that has redefined our online interactions. Along with Google, Facebook has also brought us targeted digital marketing and advertising, and the mass monetization of the internet. Its been a profitable strategy for the company. Facebooks market cap is up to $786 billion, and in the third quarter of 2020, the company reported $21.5 billion at the top line. Looking ahead to the Q4 report, due out on January 27, analysts are forecasting revenues at or near $26.2 billion. This would be in-line with the companys pattern, of rising quarterly performance from Q1 to Q4. At the predicted sum, revenues would rise 24% year-over-year, roughly congruent with the 22% yoy gain already seen in Q3. The key metric to watch out for will be the growth in daily active users; this metric slipped slightly from Q2 to Q3, and further decline will be taken as an ominous sign for the companys future. As it stands now, Facebooks daily average user number is 1.82 billion. Ahead of the print, Oppenheimer analyst Jason Helfstein boosted his price target to $345 (from $300), while reiterating an Outperform (i.e. Buy) rating. Investors stand to pocket ~26% gain should the analyst's thesis play out. (To watch Helfsteins track record, click here) The 5-star analyst commented, "[We] anticipate 4Q advertising revenue will handily top Street estimates. We now forecast 4Q advertising revenue +30% y/y vs. Street's +25% estimate based on a regression of US Standard Media Index Data (r-squared 0.95) and accelerating global CPM data from Gupta Media (4Q +35% y/y vs. 3Q's -12%). Additionally, we are very bullish on FB's eCommerce opportunity following conversations with our checks and our initial work conservatively estimating Shops is a $2550B opportunity vs. current $85B revs. We believe shares currently trading at 7.1x EV/NTM sales offers the most favorable risk/ reward in internet large cap." Overall, the social media empire remains a Wall Street darling, as TipRanks analytics showcasing FB as a Strong Buy. This is based on 34 recent reviews, which break down to 30 Buy ratings, 3 Holds, and 1 Sell. Shares are priced at $276.10 and the average price target of $327.42 suggests a one-year upside of ~19%. (See FB stock analysis on TipRanks) Amazon (AMZN) Turning to e-commerce, we cant avoid Amazon. The retail giant has a market cap of $1.65 trillion, making it one of just four publicly traded companies valued over the trillion-dollar mark. The companys famously price is famously high, and has grown 74% since this time last year, far outpacing the broader markets. Amazons growth has been supported by increased online sales activity during the corona year. Globally, online retail has grew 27% in 2020, while total retail slipped 3%. Amazon, which dominates the online retail sector, is projected to end 2020 with $380 billion in total revenue, or 34% year-over-year growth, outpacing the global e-commerce gains. Cowen analyst John Blackledge, rating 5-stars by TipRanks, covers Amazon and is bullish on the companys prospects ahead of the earnings release. Blackledge rates the stock Outperform (i.e. Buy), and his price target, at $4,350, indicates confidence in a 31% upside on the one-year time horizon. (To watch Blackledges track record, click here) We forecast 4Q20 reported revenue of $120.8BN, +38.2% y/y vs. +37.4% y/y in 3Q20 led by AWS, advertising, subscription and 3P sales [..] We estimate US Prime sub growth accelerated in 4Q20 (reaching 76MM subs in Dec '20 and ~74MM on avg in 4Q20), helped by pandemic demand, Prime Day in Oct, & elongated shopping period, as well as 1 Day delivery [...] In '21, we expect strong top-line growth to continue driven by eCommerce (helped by COVID pull forward in Grocery), adv., AWS & sub businesses," Blackledge opined. That Wall Street generally is bullish on Amazon is no secret; the company has 33 reviews on record, and 32 of them are Buys, versus 1 Hold. Shares are priced at $3,301.26 and the average price target of $3,826 implies that it will grow another 16% this year. (See AMZN stock analysis on TipRanks) To find good ideas for stocks trading at attractive valuations, visit TipRanks Best Stocks to Buy, a newly launched tool that unites all of TipRanks equity insights. Disclaimer: The opinions expressed in this article are solely those of the featured analysts. The content is intended to be used for informational purposes only. It is very important to do your own analysis before making any investment.

See the rest here:
CRISPR (CRSP) Up More Than 80% in Past 3 Months: Here's Why - Yahoo Finance

The Zacks Analyst Blog Highlights: CRISPR Therapeutics, Vertex Pharmaceuticals and Intellia Therapeutics – Yahoo Finance

For Immediate Release

Chicago, IL January 20, 2021 Zacks.com announces the list of stocks featured in the Analyst Blog. Every day the Zacks Equity Research analysts discuss the latest news and events impacting stocks and the financial markets. Stocks recently featured in the blog include: CRISPR Therapeutics AG CRSP, Vertex Pharmaceuticals Incorporated VRTX and Intellia Therapeutics, Inc. NTLA.

Shares ofCRISPR Therapeutics have rallied 87.3% in the past three months compared with theindustry'sincrease of 15.4%.

The company has made rapid progress with the development of its lead pipeline candidate, CTX001. The candidate is an investigational ex vivo CRISPR gene-edited therapy, which is currently being developed for treating sickle cell disease ("SCD") and transfusion-dependent beta thalassemia ("TDT") in partnership withVertex Pharmaceuticals.

In December 2020, the companiesannouncedpromising additional data on CTX001, which demonstrated a consistent and sustained response in treating patients with SCD and TDT. Treatment with CTX001 showed that all seven patients with TDT remained transfusion independent until the last follow-up, while all three patients with SCD were free of vaso-occlusive crises through the last follow-up.

Both diseases have a significant unmet medical need, and if successfully developed and commercialized, the candidate can lend a huge boost to CRISPR Therapeutics' prospects.

Notably, CTX001 has been granted Regenerative Medicine Advanced Therapy, Fast Track, and Orphan Drug designations by the FDA for both TDT and SCD. The European Commission has granted Orphan Drug Designation to the gene therapy candidate for both indications.

Genomic editing to repair a defective genetic material that causes diseases using CRISPR technology is probably one of the most promising and exciting healthcare innovations seen in decades. The technology has the potential to change how diseases, especially those caused by genetic mutations, are treated.

Story continues

Though the market holds great potential, competition remains stiff in the space. Other companies likeIntellia Therapeutics are also engaged in developing candidates to address different indications using CRISPR/Cas9 gene-editing technology.

CRISPR Therapeutics is also developing three gene-edited allogeneic cell therapy programs, chimeric antigen receptor T cell (CAR-T) candidates, CTX110, CTX120 and CTX130 for the treatment of hematological and solid tumor cancers. Several data readouts on the above candidates are expected in the ongoing year and a positive outcome might drive the stock further up in the days ahead.

CRISPR Therapeutics currently carries a Zacks Rank #3 (Hold). You can seethe complete list of today's Zacks #1 Rank (Strong Buy) stocks here.

Each was hand-picked by a Zacks expert as the #1 favorite stock to gain +100% or more in 2020. Each comes from a different sector and has unique qualities and catalysts that could fuel exceptional growth.

Most of the stocks in this report are flying under Wall Street radar, which provides a great opportunity to get in on the ground floor.

Today, See These 5 Potential Home Runs >>

Media Contact

Zacks Investment Research

800-767-3771 ext. 9339

support@zacks.com

https://www.zacks.com

Past performance is no guarantee of future results. Inherent in any investment is the potential for loss. This material is being provided for informational purposes only and nothing herein constitutes investment, legal, accounting or tax advice, or a recommendation to buy, sell or hold a security. No recommendation or advice is being given as to whether any investment is suitable for a particular investor. It should not be assumedthat any investments in securities, companies, sectors or markets identified and described were or will be profitable. All information is current as of the date of herein andis subject to change without notice. Any views or opinions expressed may not reflect those of the firm as a whole. Zacks Investment Research does not engage in investment banking, market making or asset management activities of any securities. These returns are from hypothetical portfolios consisting of stocks with Zacks Rank = 1 that were rebalanced monthly with zero transaction costs. These are not the returns of actual portfolios of stocks. The S&P 500 is an unmanaged index. Visit https://www.zacks.com/performance for information about the performance numbers displayed in this press release.

Want the latest recommendations from Zacks Investment Research? Today, you can download 7 Best Stocks for the Next 30 Days. Click to get this free reportVertex Pharmaceuticals Incorporated (VRTX) : Free Stock Analysis ReportIntellia Therapeutics, Inc. (NTLA) : Free Stock Analysis ReportCRISPR Therapeutics AG (CRSP) : Free Stock Analysis ReportTo read this article on Zacks.com click here.Zacks Investment Research

See the rest here:
The Zacks Analyst Blog Highlights: CRISPR Therapeutics, Vertex Pharmaceuticals and Intellia Therapeutics - Yahoo Finance

Investors Who Bought CRISPR Therapeutics (NASDAQ:CRSP) Shares Three Years Ago Are Now Up 411% – Simply Wall St

Generally speaking, investors are inspired to be stock pickers by the potential to find the big winners. Not every pick can be a winner, but when you pick the right stock, you can win big. One such superstar is CRISPR Therapeutics AG (NASDAQ:CRSP), which saw its share price soar 411% in three years. On top of that, the share price is up 115% in about a quarter.

Check out our latest analysis for CRISPR Therapeutics

CRISPR Therapeutics wasn't profitable in the last twelve months, it is unlikely we'll see a strong correlation between its share price and its earnings per share (EPS). Arguably revenue is our next best option. Generally speaking, companies without profits are expected to grow revenue every year, and at a good clip. Some companies are willing to postpone profitability to grow revenue faster, but in that case one does expect good top-line growth.

CRISPR Therapeutics' revenue trended up 81% each year over three years. That's much better than most loss-making companies. In light of this attractive revenue growth, it seems somewhat appropriate that the share price has been rocketing, boasting a gain of 72% per year, over the same period. Despite the strong run, top performers like CRISPR Therapeutics have been known to go on winning for decades. In fact, it might be time to put it on your watchlist, if you're not already familiar with the stock.

The company's revenue and earnings (over time) are depicted in the image below (click to see the exact numbers).

CRISPR Therapeutics is a well known stock, with plenty of analyst coverage, suggesting some visibility into future growth. So it makes a lot of sense to check out what analysts think CRISPR Therapeutics will earn in the future (free analyst consensus estimates)

Pleasingly, CRISPR Therapeutics' total shareholder return last year was 241%. So this year's TSR was actually better than the three-year TSR (annualized) of 72%. The improving returns to shareholders suggests the stock is becoming more popular with time. While it is well worth considering the different impacts that market conditions can have on the share price, there are other factors that are even more important. Case in point: We've spotted 3 warning signs for CRISPR Therapeutics you should be aware of.

If you would prefer to check out another company -- one with potentially superior financials -- then do not miss this free list of companies that have proven they can grow earnings.

Please note, the market returns quoted in this article reflect the market weighted average returns of stocks that currently trade on US exchanges.

PromotedIf you decide to trade CRISPR Therapeutics, use the lowest-cost* platform that is rated #1 Overall by Barrons, Interactive Brokers. Trade stocks, options, futures, forex, bonds and funds on 135 markets, all from a single integrated account.

This article by Simply Wall St is general in nature. It does not constitute a recommendation to buy or sell any stock, and does not take account of your objectives, or your financial situation. We aim to bring you long-term focused analysis driven by fundamental data. Note that our analysis may not factor in the latest price-sensitive company announcements or qualitative material. Simply Wall St has no position in any stocks mentioned. *Interactive Brokers Rated Lowest Cost Broker by StockBrokers.com Annual Online Review 2020

Have feedback on this article? Concerned about the content? Get in touch with us directly. Alternatively, email editorial-team (at) simplywallst.com.

Go here to read the rest:
Investors Who Bought CRISPR Therapeutics (NASDAQ:CRSP) Shares Three Years Ago Are Now Up 411% - Simply Wall St

We may have a CRISPR cure for red blood diseases sickle cell anemia and beta thalassemia – Genetic Literacy Project

Sickle cell anemia and thalassemia are genetic diseases that result in the production of anomalous hemoglobin (protein that carries oxygen) and deformed red blood cells. There is no cure for these ailments, but ten patients who have had their genes edited are on their way to get rid of them, thanks to the Clustered Regularly Interspaced Short Palindromic Repeats technique or CRISPR.

It is possible to edit human cells and safely infuse them in patients; this treatment has totally changed their lives, said haematologist Haydar Frangoul of the Sarah Cannon Research Institute. He is the doctor accompanying the studys first volunteer, the housewife and mother of three children Victoria Gray.

The work consisted of activating the generation of fetal hemoglobin, which is still produced in the womb and which results in healthy red blood cells. When the baby is born, the gene turns off and, in patients with thalassemia and sickle cell anemia, the result is the production of anomalous hemoglobin.

To receive the stem cells edited by CRISPR, patients first had to go through a painful stage: numerous rounds of chemotherapyAfter all the stem cells that produced the anomalous hemoglobin were destroyed, those edited were infused into the patients to reproduce and manufacture fetal hemoglobin.

Read the original post

Read more:
We may have a CRISPR cure for red blood diseases sickle cell anemia and beta thalassemia - Genetic Literacy Project

The ARKG ETF: Join the Genomics Revolution – ETF Trends

The genomics space is rapidly innovating. The ARK Genomic Revolution Multi-Sector Fund (CBOE: ARKG) makes accessing innovation much easier.

For investors, ARKGs active management and utility are vital because the fund is flexible and able to capitalize on genomics advancements more rapidly than index-based rivals. Those advancements include gene editing.

Crispr-Cas9 is the second generation of technologies that seek to repair thousands of inherited genetic disorders and battle cancer in new ways. Gene editing is advancing so quickly that next-generation technologies are already on the heels of Crispr-Cas9, including a more-precise tool called base editing, reports Bill Alpert for Barrons.

The CRISPR technology may also be under the spotlight as another disease fighting tool, with the world refocusing on the need for improved healthcare solutions.

The ARK Genomic Revolution ETF tracks the convergence of tech and healthcare. The underlying components are expected to substantially benefit from extending and enhancing the quality of human and other life by incorporating technological and scientific developments and advancements in genomics into their business.

While gene-editing start-ups will lose money during years of clinical trials, its hard to say the stocks are overvalued. If their one-time interventions can cure diseases that otherwise require chronic treatmentor lack any treatment at allthen the stocks will fly, according to Barrons.

That speaks to a big advantage with ARKG: investors dont have to stock pick in the gene editing arena.

Looking ahead, CRISPR-based innovations to accelerate given the technologys ease of use, cost-efficacy, a growing body of research surrounding its safety, and AI-powered CRISPR nuclease selection tools. CRISPR could also be utilized to address some of the most prominent healthcare problems, which opens up a significant investment opportunity in monogenic diseases.

CRISPR can cut DNA/RNA at a single point or in stretches; insert DNA/RNA and create novel gene sequences; activate and silence genes without making permanent changes; regulate protein expression levels epigenetically; record and timestamp biological events; track the movement of specific biological molecules; identify the presence of specific cancer mutations and bacteria; locate molecules without making changes; target and destroy specific viral and bacterial DNA and RNA; interrogate gene function multiplexed, and activate drug release at a specified trigger.

Because gene editing permanently changes the genome, it doesnt appear to suffer from these issues. Nature evolved many tools to cut DNA at specific spots in the genome, addsBarrons.

For more on disruptive technologies, visit our Disruptive Technology Channel.

The opinions and forecasts expressed herein are solely those of Tom Lydon, and may not actually come to pass. Information on this site should not be used or construed as an offer to sell, a solicitation of an offer to buy, or a recommendation for any product.

Go here to read the rest:
The ARKG ETF: Join the Genomics Revolution - ETF Trends

Gene-edited crops are now a reality but will the public be on board? – The Conversation UK

Once the UK left the EU, it would be free to invest in gene editing of crops and livestock to feed the world. Thats what the prime minister, Boris Johnson, told the House of Commons in 2019. And following the UKs formal departure from the EU in January 2021, the government quickly launched a public consultation on the issue.

Yet media reporting might cause plant scientists to have unpleasant flashbacks to the 1990s, when genetically modified (or GM) crops were first being commercialised in Europe. Some of the language used to report on the consultation is eerily similar: the Daily Mail asks its readers whether Frankenstein food is about to hit UK plates. Two decades ago, GM crops were also labelled Frankenfood.

Whereas GM crops typically contain the DNA of two different species, gene editing is more precise and allows scientists to tweak the DNA of a single species by itself. Today, many plant scientists see a clear difference between first-generation genetic modifications and the new plant breeding techniques of gene editing. These include tools like CRISPR, which can be used like genetic scissors to make changes to a plant that mimic natural variation.

In the US and Canada, for example, a non-browning mushroom has found a quick path to market thanks to breeders ability to knock-out the gene that controls the browning enzyme, improving shelf-life and potentially minimising food waste.

Although this was done in a laboratory, natural processes at the genetic level and in response to environmental conditions turn genes on and off in a similar fashion. These tools have health applications, too. CRISPR is being used to treat cancer and has the potential for many more medical applications.

Because gene-edited plants can be indistinguishable from their conventional cousins unlike GM crops countries around the world are grappling with how they should be regulated. In the European Union, a landmark 2018 ruling by the Court of Justice said that new gene-edited crops should be governed by existing legislation that was developed in response to first-generation GM crops and said that if you breed something that could not occur in nature, it counts as genetically-modified.

However, this does not mean as was widely reported that gene-edited crops are automatically GM crops, which by definition could not occur in nature. The EU, like the UK, is now revisiting this issue through a consultation.

As recipients of European plant science funding, we have seen that scientists and the public often talk past one another on the issue of biotechnology. Scientists, for their part, tend to view it in terms of risk (or lack thereof) and invoke humanitys long history of modifying plants for our own purposes. But we need to move beyond this framework and instead take account of the questions and concerns that the general public has about who benefits from this technology, who owns it and what impacts it will have.

First-generation genetic modification tended to focus on farm productivity. Protecting crops from pests was the top priority. Gene-edited crops could contribute to a wider variety of sustainability and health goals in future though, such as by improving nutrition or using resources more efficiently. In fact, a whole raft of technologies could be about to revolutionise the way we make food.

However, as we learned with GM crops, technologies are most effective when the wider public and key stakeholders, such as farmers, are actively included in their development.

There is greater and greater recognition among researchers and policymakers of the need to ensure that new technology meets the needs, expectations and values of the public. We have seen that the involvement of patients can make new health technologies more relevant and effective. Already, there is more talk of democratising new genomic tools like CRISPR.

So although plant scientists will hope to avoid repeating the same debates about biotechnology that they had two decades ago, there is still opportunity to gain public trust in these technologies through active and open dialogue. We must ask ourselves whether the gene editing consultation goes far enough to gain that trust, particularly for those that see this as Frankenstein-like technology.

Link:
Gene-edited crops are now a reality but will the public be on board? - The Conversation UK

Using gene therapy to mimic the effects of physical exercise – News-Medical.net

It sounds too good to be true - and it is. But Jose Bianco Moreira and the CERG research group at the Norwegian University of Science and Technology (NTNU) are convinced that some of the positive health effects of physical exercise can be achieved using gene therapy and medication.

"We're not talking about healthy people and everyone who can exercise. They still have to train, of course," says Moreira. He and his colleagues at NTNU's Department of Circulation and Medical Imaging are studying the effect of exercise on our cells.

But some people can't train, or only in a limited way. This could include individuals who've been in accidents, who are in wheelchairs, or who have diseases that prevent the possibility of physical expression. We want to create hope for these folks. A small group of healthy people out there also obtain very little effect from physical exercise - so-called low responders - and would benefit from a method that worked at the cellular level.

Jose Bianco Moreira, Norwegian University of Science and Technology

A lot of research confirms the health benefits of physical exercise, but we know far less about what happens in the cells that provides the positive effects.

"International research in this field is brand new. We've barely scratched the surface," says the researcher.

"We think increasing our knowledge about what happens at the cellular level will be important for discovering medications and treatments for heart disease. My group studies genes, proteins and mitochondria that produce energy and are key for chemical processes in the cells."

Moreira believes that gene therapy is the most effective method for reproducing the health benefits we normally get through physical exercise.

A medicine that uses gene therapy is already in use for spinal muscle atrophy, a serious disease that leads to muscle wasting. The drug uses a harmless virus to deliver a copy that replaces the damaged motor neuron network in patients.

This form of therapy can inhibit or enhance the expression of a gene. This is a very expensive medicine and has not been tried for heart disease, for example.

Moreira believes CRISPR will be the future go-to gene therapy method. He believes this method of editing the genes will revolutionize a lot of disease treatments.

"CRISPR is easier to use, faster and cheaper than today's gene therapy, which only attenuates or enhances the expression of a gene. CRISPR's potential is almost limitless. It can alter the gene itself. The parts of the gene that don't work properly are replaced with well-functioning parts."

Experiments on rats and mice have shown that the method works. Experiments have also been performed on human cells in the laboratory to confirm CRISPR's effectiveness, but it has not yet been tested on humans.

"CRISPR still has to be tested in large clinical studies. I'd be optimistic if I say gene editing will come into regular use in 10-15 years," says Moreira.

Moreira's research group has used CRISPR in its research, but the results are not yet ready for publication.

"We believe gene therapy is the most powerful method because patients don't have to take a pill every day. Usually, gene therapy changes the gene forever, perhaps with an injection or two. The challenge is to find the right gene that needs change, and an effective method to repair it," he says.

NTNU researchers are focusing on the heart. They have identified a protein that heart-diseased rats are deficit in, but which increases when the rats go through training.

"By increasing the amount of this protein through gene therapy, we've managed to strengthen the muscle cells and have replicated some of the positive effects of physical exercise," says Moreira.

Medications are another possible method of mimicking the effects of exercise. Some existing medicines might even be able to recreate some of the positive effect on the heart.

"The research now has powerful technology platforms to find possible other uses for medicines we already have. One problem, of course, is that medicine is chemistry that affects the whole body, not just the organ you want to help. Something that's good for the heart could be detrimental for the liver, for example. Compared to gene therapy, though, the potential for medications is much more limited," Moreira says.

When the research group at NTNU started their study, they had no idea which genes were affected by exercise. They performed experiments where rats with heart defects underwent training. Afterwards, the hearts were removed and examined. Then these hearts were compared with those from untrained rats with heart disease. Afterwards, the hearts of the trained and untrained rats with heart disease were compared to healthy rat hearts.

"We observed that genes were altered in the diseased hearts, but discovered that some of them were repaired in the rats that had trained. This way, we find genes that we can target. Through our measurements, we can find out exactly what training changes at the cellular level," says Moreira.

The NTNU researchers are collaborating with Johan Aurwerx and his group at the cole Polytechnique Fdrale in Lausanne.

Source:

Journal reference:

Moreira, J.B.N., et al. (2020) Exercise and cardiac health: physiological and molecular insights. Nature Metabolism. doi.org/10.1038/s42255-020-0262-1.

The rest is here:
Using gene therapy to mimic the effects of physical exercise - News-Medical.net

‘Incredible’ gene-editing result in mice inspires plans to treat premature-aging syndrome in children – Science Magazine

A 4-year-old with progeria, a syndrome with features of premature aging that stems from a mutated gene

By Jocelyn KaiserJan. 6, 2021 , 11:00 AM

One mouse is hunched over, graying, and barely moves at 7 months old. Others, at 11 months, have sleek black coats and run around. The videos and other results from a new study have inspired hope for treating children born with progeria, a rare, fatal, genetic disease that causes symptoms much like early aging. In mice with a progeria-causing mutation, a cousin of the celebrated genome editor known as CRISPR corrected the DNA mistake, preventing the heart damage typical of the disease, a research team reports today in Nature. Treated mice lived about 500 days, more than twice as long as untreated animals.

The outcome is incredible, says gene-therapy researcher Guangping Gao of the University of Massachusetts, who was not involved with the study.

Although the developers of the progeria therapy aim to improve it, they are also taking steps toward testing the current version in affected children, and some other scientists endorse a rush. The mouse results are beyond anyones wildest expectations, says Fyodor Urnov, a gene-editing researcher at the University of California, Berkeley. The new data are an imperative to treat a child with progeria and do so in the next 3 years.

About 400 people in the world are estimated to have Hutchinson-Gilford progeria syndrome, which results from a single-base change in the gene for a protein called lamin A that helps support the membrane forming the nucleus in cells. The resulting abnormal protein, called progerin, disrupts the nuclear membrane and is toxic to cells in many tissues. Toddlers soon become bald and have stunted growth, body fat loss, stiff joints, wrinkled skin, osteoporosis, and atherosclerosis. People with progeria die on average around age 14 from a heart attack or stroke.

Researchers have previously used CRISPR to disrupt activity of the mutated gene for lamin A in progeria mice. But their health improved only modestly, and disabling a persons good copy of the gene could cause harm. So David Liu of Harvard University and the Broad Institute turned to base editing, a DNA-changing method originally inspired by CRISPR and developed in his lab. Unlike CRISPR, which makes double-strand cuts in DNA, the base editor used in the progeria study nicks just one strand and swaps out a single base. Base editors have treated liver, eye, ear, blood, and brain disorders in mice, and Liu wanted to try one on an infamous and devastating disease that involves multiple organs or tissues.

Lius group teamed up with Vanderbilt University cardiologist Jonathan Brown and Francis Collins, director of the National Institutes of Health, whose group was one of two that identified the progeria mutation in 2003. The team first tested the base-editing approach in cultured cells from two progeria patients, finding that it corrected the mutation while making few unwanted changes elsewhere in the genome. They then packaged DNA encoding the base editor into adeno-associated viruses (AAVs), a standard delivery vehicle for gene therapies, and injected these into young mice with the progeria mutation.

The results were far better than we had dared to hope, Collins says. When the mice were examined 6 months later,between 20% and 60% of their bone, skeletal muscle, liver, heart, and aorta carried the DNA fix. Progerin levels fell and lamin A levels rose in several tissues. Even though the mice were already 2 weeks old when treated, or about age 5 in human years, their aortas months later bore virtually no signs of the fibrous tissue growth or loss of smooth muscle cells seen in mice and children with progeria. It hits home the potential of this technology, says gene-editing researcher Charles Gersbach of Duke University.

Some of the rodents eventually developed liver tumors, a problem seen before in mice receiving high-dose AAV gene therapy. No people have been shown to have developed liver tumors as a result of such treatments. Still, lowering the AAV dose to improve safety is a goal, Liu says. He and Collins are evaluating more efficient base editors to that end.

Study co-author Leslie Gordon, a Brown University physician whose son died from progeria and who co-founded the Progeria Research Foundation, doesnt want to wait for the next iteration before developing plans and raising money to test the treatment in children. Her foundation is talking to companies, including Beam Therapeutics, which Liu co-founded, in hopes of launching a clinical trial. We will find a way to get this done for these kids, Gordon says.

Go here to see the original:
'Incredible' gene-editing result in mice inspires plans to treat premature-aging syndrome in children - Science Magazine

CRISPR Therapeutics Is Still Looking Strong – RealMoney – RealMoney

During Tuesday's Mad Money program Jim Cramer cautioned viewers against the CRISPR stocks hoping that human genome editing will usher in the cure for cancer and other ailments. Genomics is indeed a hot science, he said, but it's also incredibly risky. Let's take a look at the charts of CRISPR Therapeutics AG (CRSP) again.

On Dec. 22 we looked at CRSP and concluded that, "if you are still long CRSP then you are way smarter than me. Longs should risk to $145. The round number of $200 and then the Point and Figure target of $230 are the price objectives for now."

In this updated daily bar chart of CRSP, below, we can see that prices remain in a strong uptrend above the rising 50-day moving average line and the rising 200-day moving average line. The On-Balance-Volume (OBV) line has moved higher to confirm the price gains while the Moving Average Convergence Divergence (MACD) is above the zero line and poised for a new buy signal.

In this weekly bar chart of CRSP, below, we can see a 2-1/2-year base pattern in place before the strong gains of this year. Prices are in an uptrend above the rising 40-week moving average line. The weekly OBV line is strong and so is the MACD oscillator.

In this daily Point and Figure chart of CRSP, below, we can see a price target of $200.

In this second Point and Figure chart of CRSP, below, we used weekly close-only price data with a five-box reversal filter. Here our $230 price target is confirmed.

Bottom-line strategy:Continue to hold longs risking to $149 now. Our price targets are $200 and $230 for now.

Get an email alert each time I write an article for Real Money. Click the "+Follow" next to my byline to this article.

See the original post:
CRISPR Therapeutics Is Still Looking Strong - RealMoney - RealMoney

Global CRISPR Technology Market Report 2020: COVID-19 Growth and Change – Market is Expected to Recover to Reach $1.55 Billion in 2023 – Forecast to…

DUBLIN, Jan. 6, 2021 /PRNewswire/ -- The "CRISPR Technology Global Market Report 2020-30: COVID-19 Growth and Change" report has been added to ResearchAndMarkets.com's offering.

CRISPR Technology Global Market Report 2020-30: COVID-19 Growth and Change provides the strategists, marketers and senior management with the critical information they need to assess the global crispr technology market.

Major players in the CRISPR technology market are Thermo Fisher Scientific, GenScript Biotech Corporation, CRISPR Therapeutics AG, Editas Medicine, Horizon Discovery Plc., Integrated DNA Technologies, Inc. (Danaher), Origene Technologies, Inc., Transposagenbio Biopharmaceuticals (Hera Biolabs), Intellia Therapeutics Inc., and GeneCopoeia, Inc.

The global CRISPR technology market is expected to increase from $0.76 billion in 2019 to $0.92 billion in 2020 at a compound annual growth rate (CAGR) of 20.91%. The exponential growth is mainly due to the COVID-19 outbreak that has led to the research for drugs for COVID-19 with gene-editing using CRISPR technology. The market is expected to reach $1.55 billion in 2023 at a CAGR of 19.13%.

The CRISPR technology market consists of sales of CRISPR technology products and services which is a gene-editing technology that allows researchers to alter DNA sequences and modify gene function. The revenue generated by the market includes the sales of products such as design tools, plasmid & vector, Cas9 & gRNA, libraries & delivery system products and services that include design & vector construction, screening and cell line engineering.

These products and services are used in genome editing/genetic engineering, genetically modifying organisms, agricultural biotechnology and others which include gRNA database/gene library, CRISPR plasmid, human stem cell & cell line engineering by end-users. The end-users include pharmaceutical & biopharmaceutical companies, biotechnology companies, academic & research institutes and contract research organizations.

North America was the largest region in the CRISPR technology market in 2019. Europe was the second-largest region in the CRISPR technology market in 2019.

In 2019, Cardea Bio Inc., a US-based biotechnology infrastructure company that manufactures biology-gated transistors (Cardean transistors) that utilizes biocompatible graphene instead of silicon and replaces optical signal observations with direct electrical molecular signal analysis, merged with Nanosens Innovations, Inc. The merger is aimed at accelerating the development of the genome sensor that combines Nanosens' CRISPR-Chip technology with Cardea's graphene biosensor infrastructure and is the first DNA search engine globally that runs on CRISPR-Chip technology. Nanosens will be operating as a subsidiary of Cardea Bio. Nanosens Innovations, Inc. is a US-based biotechnology company that develops CRISPR-Chip and FEB technology.

The CRISPR technology market covered in this report is segmented by product type into design tools; plasmid and vector; CAS9 and G-RNA; delivery system products. It is also segmented by application into genome editing/ genetic engineering; genetically modified organisms; agricultural biotechnology; others and by end-user into industrial biotech; biological research; agricultural research; therapeutics and drug discovery.

Stringent government regulations are expected to retard the growth of the CRISPR technology market during the period. There is no existence of internationally agreed regulatory framework for gene editing products and countries are in the process of evaluating whether and to what extent current regulations are adequate for research conducted with gene editing and applications and products related to gene editing. In July 2018, the Court of Justice of the European Union ruled that it would treat gene-edited crops as genetically modified organisms, subject to stringent regulation.

In April 2019, the Australian government stated that the Office of the Gene Technology Regulator (OGTR) will regulate only the gene-editing technologies that use a template, or that insert other genetic material into the cell. According to an article of 2020, in India, as per the National Guidelines for Stem Cell Research, genome modification including gene-editing by CRISPR-Cas9 technology of stem cells, germ-line stem cells or gamete and human embryos is restricted only to in-vitro studies. Thus, strict regulations by the government present a threat to the growth of the market.

Several advancements in CRISPR technology are trending in the market during the period. Advancements in technology will help in reducing errors, limiting unintended effects, improving the accuracy of the tool, widening its applications, developing gene therapies and more. In 2019, a study published in Springer Nature stated the development of an advanced super-precise new CRISPR tool that allows researchers more control over DNA changes. This tool seems to have the capability of providing a wider variety of gene edits which might potentially open up conditions that have challenged gene-editors.

Also, in 2020, another study in Springer Nature stated that researchers have used enzyme engineering to boost the accuracy of the technique of error-prone CRISPR-Cas9 system to precisely target DNA without introducing as many unwanted mutations. The advancements in CRISPR technology will result in better tools that are capable of providing better outcomes.

The application of CRISPR technology as a diagnostic tool is expected to boost the market during the period. The Sherlock CRISPR SARS-CoV-2 kit is the first diagnostic kit based on CRISPR technology for infectious diseases caused due to COVID-19. In May 2020, FDA announced the emergency use authorization to the Sherlock BioSciences Inc's Sherlock CRISPR SARS-CoV-2 kit which is a CRISPR-based SHERLOCK (Specific High-sensitivity Enzymatic Reporter unLOCKing) diagnostic test.

This test helps in specifically targeting RNA or DNA sequences of the SARS-CoV-2 virus from specimens or samples such as nasal swabs from the upper respiratory tract and fluid in the lungs from bronchoalveolar lavage specimens. This diagnostic kit has high specificity and sensitivity and does not provide false negative or positive results. Widening the application of CRISPR technology for the diagnosis of infectious diseases will increase the demand for CRISPR technology products and services.

Key Topics Covered:

1. Executive Summary

2. CRISPR Technology Market Characteristics

3. CRISPR Technology Market Size And Growth

3.1. Global CRISPR Technology Historic Market, 2015 - 2019, $ Billion

3.1.1. Drivers Of The Market

3.1.2. Restraints On The Market

3.2. Global CRISPR Technology Forecast Market, 2019 - 2023F, 2025F, 2030F, $ Billion

3.2.1. Drivers Of The Market

3.2.2. Restraints On the Market

4. CRISPR Technology Market Segmentation

4.1. Global CRISPR Technology Market, Segmentation By Product Type, Historic and Forecast, 2015-2019, 2023F, 2025F, 2030F, $ Billion

4.2. Global CRISPR Technology Market, Segmentation By Application, Historic and Forecast, 2015-2019, 2023F, 2025F, 2030F, $ Billion

4.3. Global CRISPR Technology Market, Segmentation By End-User, Historic and Forecast, 2015-2019, 2023F, 2025F, 2030F, $ Billion

5. CRISPR Technology Market Regional And Country Analysis 5.1. Global CRISPR Technology Market, Split By Region, Historic and Forecast, 2015-2019, 2023F, 2025F, 2030F, $ Billion 5.2. Global CRISPR Technology Market, Split By Country, Historic and Forecast, 2015-2019, 2023F, 2025F, 2030F, $ Billion

Companies Mentioned

For more information about this report visit https://www.researchandmarkets.com/r/vnvkue

Research and Markets also offers Custom Research services providing focused, comprehensive and tailored research.

Media Contact:

Research and Markets Laura Wood, Senior Manager [emailprotected]

For E.S.T Office Hours Call +1-917-300-0470 For U.S./CAN Toll Free Call +1-800-526-8630 For GMT Office Hours Call +353-1-416-8900

U.S. Fax: 646-607-1907 Fax (outside U.S.): +353-1-481-1716

SOURCE Research and Markets

http://www.researchandmarkets.com

Read the original:
Global CRISPR Technology Market Report 2020: COVID-19 Growth and Change - Market is Expected to Recover to Reach $1.55 Billion in 2023 - Forecast to...

What is the Market’s View on Crispr Therapeutics AG (CRSP) Stock’s Price and Volume Trends – InvestorsObserver

Crispr Therapeutics AG (CRSP) stock has gained 35.58% over the past week and gets a Bullish rating from InvestorsObserver's Sentiment Indicator.

In investing, sentiment generally means whether or not a given security is in favor with investors. It is typically a pretty short-term metric that relies entirely on technical analysis. That means it doesnt incorporate anything to do with the health or profitability of the underlying company.

Recent trends are a good indicator of current market sentiments. In its most basic form, stocks that are trending up are desirable by investors while stocks currently falling must be unattractive.

InvestorsObserver's Sentimental Indicator tracks both changes in price and volume to analyze the most recent trends. Typically an increase in volume indicates ongoing trends are getting stronger, while a decrease in volume usually signals an end to the current trend.

Available options can also represent current sentiments for a given stock. Since investors are able to bet on future trends of stocks using options, we consider the ratio of calls to puts when analyzing market sentiments .

Crispr Therapeutics AG (CRSP) stock is trading at $207.58 as of 10:53 AM on Friday, Jan 8, an increase of $13.15, or 6.76% from the previous closing price of $194.43. The stock has traded between $196.11 and $210.39 so far today. Volume today is below average. So far 1,482,585 shares have traded compared to average volume of 2,079,604 shares.

To see InvestorsObserver's Sentiment Score for Crispr Therapeutics AG click here.

CRISPR Therapeutics AG is a gene-editing company. It is engaged in the development of CRISPR/Cas9-based therapeutics. CRISPR/Cas9 is a technology that allows for precise, directed changes to genomic DNA. The company advanced programs target beta-thalassemia and sickle cell disease, two hemoglobinopathies that have a high unmet medical need.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

Go here to see the original:
What is the Market's View on Crispr Therapeutics AG (CRSP) Stock's Price and Volume Trends - InvestorsObserver

5 questions facing gene therapy in 2021 – BioPharma Dive

Three years ago, the Food and Drug Administration granted a landmark approval to the first gene therapy for an inherited disease, clearing a blindness treatment called Luxturna.

Since then, the regulator has approved one more gene therapy,the spinal muscular atrophy treatment Zolgensma, and given a green light for dozens of biotech and pharmaceutical companies to start clinical testing on others. Genetic medicines for a range of diseases, including hemophilia, sickle cell and several muscular dystrophies, appear in reach, and new science is galvanizing research.

But, entering 2021, the gene therapy field faces major questions after a series of regulatory and clinical setbacks have shaded optimism. "The ups and downs of adolescence are on full display" analysts at Piper Sandler wrote in September, summing up the state of gene therapy research.

Here are five questions facing scientists, drugmakers and investors this year. How they're answered will matter greatly to the patients and families holding out hope for one-time disease treatments.

The FDA was widely expected last year to approve a closely watched gene therapy for hemophilia A, the more common type of the blood disease. Instead, the agency in August surprisingly rejected the treatment, called Roctavian, and asked its developer, BioMarin Pharmaceutical, to gather more data.

The next day, Audentes Therapeutics reported news came a third clinical trial participant had died after receiving the biotech's experimental gene therapy for a rare neuromuscular disease. The tragedy brought flashbacks to past safety scares in gene therapy, although the current wave of treatments being tested have generally appeared safe.

A little less than five months later, the gene therapy field is grappling with two more setbacks. UniQure is exploring whether a study volunteer's liver cancer was caused by its gene therapy for hemophilia B. And Sarepta, one of the sector's top developers, faces significant doubts about its top treatment for Duchenne muscular dystrophy after disclosing a key study missed one of its main goals.

In each case, the drugmakers involved offered explanations and reasons for optimism. BioMarin still expects to obtain an approval; Audentes' trial is now cleared by the FDA to resume testing; UniQure thinks it's unlikely the cancer case is linked to treatment; and Sarepta argued its negative data were the product of unlucky study design.

But taken together, the developments are powerful reminders of both the stakes and uncertainty still facing gene therapy.

All four events also highlighted lingering worries about one-time genetic treatment. In rejecting Roctavian, for example, the FDA seemed to be concerned the impressive benefit hemophilia patients initially experienced may wane over time. The deaths in Audentes' study, meanwhile,renewed warnings about extremely high doses of gene therapy. Researchers have long watched for evidence that replacing or altering genes may cause cancer to develop in rare instances, particularly after four infants developed leukemia in a gene therapy study in the early 2000s.And Sarepta's negative findings were surprising because early signs of dramatic biological benefit that didn't seem to translate into clear-cut functional gains for all patients.

Experts are still confident gene therapy can deliver on its promise. Bu recent events suggest getting there may take a bit longer than some expected.

"The process is the product," is an often-used cliche about gene therapy, which are complex treatments with exacting manufacturing standards.

Most of the roughly 60,000 pages in Spark Therapeutics' application for approval of Luxturna, for instance, involved what's known in the industry as "chemistry, manufacturing and controls."

The therapeutic basis for gene therapy, by contrast, is much clearer for many of the rare, monogenic diseases that developers are targeting. If mutations in a single gene lead to disease, replacing or otherwise fixing that gene should have a large benefit.

"Genetic medicine is not industrialized serendipity," said Gbola Amusa, an analyst at Chardan, contrasting gene therapy with chemical-based drugs."It often is an engineering question."

In 2020, the FDA gave ample notice that it's watching gene (and cell) therapy manufacturing closely.Sarepta,Voyager Therapeutics,Iovance Biotherapeuticsand Bluebird biowere all forced to revise their development timelines after the agency asked for new details about production processes.

"The FDA is saying to companies that you've got to up your standards," Amusa added.

For their part, FDA officials have indicated the spate of data requests are a product of the sharply higher numbers of companies advancing through clinical testing.

While setbacks have piled up for therapies that seek to replace genes, 2020 was a "transformative year" for therapies designed to edit them, according to Geulah Livshits, an analyst at Chardan.

CRISPR gene editing, already widely recognized as a scientific breakthrough, gained further prestige with the awarding of the Nobel Prize in Chemistry to two early pioneers, Jennifer Doudna and Emmanuelle Charpentier.

But the year also brought important progress from early biotech adopters.Editas Medicine and Intellia Therapeutics, for example, notched CRISPR firsts with use of the editing technology inside the human body.

And CRISPR Therapeutics and partner Vertex showed their experimental therapy, which uses CRISPR to edit stem cells, worked exceptionally well in the first 10 patients with either sickle cell disease or beta thalassemia treated in two early studies.

The data are the most concrete sign yet that CRISPR's clinical use can live up to its laboratory promise. While all three companies' therapies are still in early stages, their advances have ginned up substantial investor enthusiasm.

Together, the market value of CRISPR Therapeutics, Editas and Intellia totals nearly $25 billion. Beam Therapeutics, a startup that uses a more precise form of gene editing, is worth nearly $6 billion.

"Gene therapy will have a big role to play," said John Evans, Beam's CEO. "But I do think in the last year or so there's a growing realization that, when possible, you'd probably rather edit than add an extra gene."

Clinical tests will prove that out but, until then, the large upswing in share price for gene editing companies may not be sustainable as valuations creep higher and higher. Some of the recent run-up, for instance,appears driven by money flowing from generalist investors through exchange-trade funds, rather than from investors experienced in handicapping preclinical- or early clinical-stage companies.

"They're overdue for some type of rationalization," predicted Brad Loncar, CEO of Loncar Investments, adding that many companies are targeting similar diseases, most commonly sickle cell and beta thalassemia.

Tasked with replacing faulty genes with functional ones, scientists for the most part have turned to two types of viruses to safely shuttle genetic instructions into cells. Adeno-associated viruses, or AAVs,are typically used for infused treatments, while researchers working on cells extracted from patients generally opt for lentiviruses.

Each virus class has advantages, but also notable drawbacks. AAVs, for instance, can trigger pre-existing immune defenses in some people, making those individuals ineligible or poor candidates for gene therapy. Lentiviruses, by contrast, are known to integrate their DNA directly into the genomes of cells they infect a useful attribute in some regards but limiting in others.

Over decades of gene therapy research, scientists have found ways to tweak and modify these viral vectors to better suit their needs, but the basic tools are the same. Jim Wilson, a gene therapy pioneer who ran the study that led to the death of teenager Jesse Gelsinger in 1999, told attendees at a STAT conference last fall that he's "somewhat disappointed" by slow progress in viral vector research.

And as more and more gene therapies enter clinical testing, the limitations of current viral vectors have become more apparent.

The pace of research might be picking up, however. Recently, a number of companies aiming to build better delivery tools have launched, including Harvard University spinout Dyno Therapeutics and 4D Molecular Therapeutics, which recently raised $222 million in an initial public offering.

Larger companies are interested, too. Roche, Sarepta and Novartis have all partnered with Dyno, for example.

In gene editing, meanwhile, researchers are developing new ways to cut DNA, while Beam and others are advancing different editing approaches altogether.

Billions of dollars have flowed from pharmaceutical companies into gene therapy over the past few years, leaving few large multinational drugmakers without a research presence.

2020 was no different, with sizable acquisitions inked by Bayer and Eli Lilly, as well as an array of smaller investments from Pfizer, Novartis, Johnson & Johnson, Biogen,and UCB. And CSL Behring, best known for its blood plasma products, spent nearly half a billion dollars to buy UniQure's most advanced gene therapy, a treatment for hemophilia B.

Over the past three years, there's been at least $30 billion spent on biotechs involved in gene or cell therapy. (Four deals account for the majority of that value.)

All of that dealmaking, while following promising and compelling science, is ultimately a bet that one-time genetic treatments can be scaled up and commercialized into a lucrative business.

Many of the acquired companies are working on therapies for very rare disorders affecting hundreds or thousands of people. A handful, however, are taking aim at more prevalent conditions, starting with still relatively uncommon diseases like hemophilia to ones affecting millions of people like Parkinson's.

"For gene therapy to meet our lofty expectations not just for investors, but for society it has to make the leap from these ultra-rare diseases," said Loncar.

Commercially, the track record for the few therapies on the market in the U.S. is mixed.Luxturna, now owned by Roche, is a niche product.Zolgensma has broader use and earned Novartis about $1 billion in the year and a half it's been commercially available.

Two cell therapies from Novartis and Gilead, meanwhile, have struggled to gain traction.

Gene therapy's biggest commercial test yet was supposed to come this year, with the expected approval of BioMarin's Roctavian in hemophilia A. The FDA's surprise rejection could mean a yearslong delay in the U.S., but the challenges of pricing, reimbursement and patient access in gene therapy remain dauntingly large.

Read this article:
5 questions facing gene therapy in 2021 - BioPharma Dive

CRISPR-based strategies in infectious disease diagnosis and therapy – DocWire News

This article was originally published here

Infection. 2021 Jan 3. doi: 10.1007/s15010-020-01554-w. Online ahead of print.

ABSTRACT

PURPOSE: CRISPR gene-editing technology has the potential to transform the diagnosis and treatment of infectious diseases, but most clinicians are unaware of its broad applicability. Derived from an ancient microbial defence system, these so-called molecular scissors enable precise gene editing with a low error rate. However, CRISPR systems can also be targeted against pathogenic DNA or RNA sequences. This potential is being combined with innovative delivery systems to develop new therapeutic approaches to infectious diseases.

METHODS: We searched Pubmed and Google Scholar for CRISPR-based strategies in the diagnosis and treatment of infectious diseases. Reference lists were reviewed and synthesized for narrative review.

RESULTS: CRISPR-based strategies represent a novel approach to many challenging infectious diseases. CRISPR technologies can be harnessed to create rapid, low-cost diagnostic systems, as well as to identify drug-resistance genes. Therapeutic strategies, such as CRISPR systems that cleave integrated viral genomes or that target resistant bacteria, are in development. CRISPR-based therapies for emerging viruses, such as SARS-CoV-2, have also been proposed. Finally, CRISPR systems can be used to reprogram human B cells to produce neutralizing antibodies. The risks of CRISPR-based therapies include off-target and on-target modifications. Strategies to control these risks are being developed and a phase 1 clinical trials of CRISPR-based therapies for cancer and monogenic diseases are already underway.

CONCLUSIONS: CRISPR systems have broad applicability in the field of infectious diseases and may offer solutions to many of the most challenging human infections.

PMID:33393066 | DOI:10.1007/s15010-020-01554-w

Read more from the original source:
CRISPR-based strategies in infectious disease diagnosis and therapy - DocWire News

Plant Breeding And CRISPR Plants Market Is Expected To Reach USD 21.78 Billion By 2027 | Top Companies- Bayer AG, KWS SAAT SE & Co. KGaA, DuPont,…

Market research analysis is one of the finest options to resolve business challenges quickly by saving lot of time. The research work, market insights and analysis is carried out thoroughly in this report that puts forth marketplace clearly into the centre of attention. A transparent research method has been accomplished with the right tools and techniques to make this Plant Breeding and CRISPR Plants Market research report world-class. This business report gives an actionable market insight to the clients with which sustainable and profitable business strategies can be created. Analysis and discussion of important industry trends, market size, sales volume, and market share are also estimated in the report.

Competitive analysis conducted in this reliable Plant Breeding and CRISPR Plants report puts light on the moves of the key players in the Plant Breeding and CRISPR Plants industry such as new product launches, expansions, agreements, joint ventures, partnerships, and recent acquisitions. The industry analysis report puts forth an array of market insights which help with the more precise understanding of the market landscape, issues that may impose on the industry in the future, and how to position specific brands in the best way. The global Plant Breeding and CRISPR Plants Market research report offers market potential for each geographical region based on the growth rate, macroeconomic parameters, consumer preferences and buying patterns, market demand and supply scenarios.

Summary of the Report

The market would gain significant growth rate during the forecast period of 2020 to 2027 reaching a substantial market size by 2027. The market has been analyzed taking into considerations the different factors which includes the market drivers, restraints, opportunities, key competitor landscape, trend analysis, outlook, estimate and forecast factors.

Plant breeding and CRISPR plants market is expected to reach USD 21.78 billion by 2027 growing with the growth rate of 13.70% in the forecast period 2020 to 2027. Rising importance for sustainable crop production drives the growth of plant breeding and CRISPR plants market in the forecast period of 2020- 2027.

Get Free Sample Copy of the Report to understand the structure of the complete report @https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-plant-breeding-and-crispr-plants-market

Major Key Players of the Plant Breeding and CRISPR Plants Market

Bayer AG, KWS SAAT SE & Co. KGaA, DuPont, SGS SA, DLF Seeds Ltd, BioConsortia Inc., Hudson River Biotechnology., Pacific Biosciences of California, Inc, Eurofins Scientific, Syngenta, SGS SA, Land OLakes, Inc, Advanta Seeds Pty Ltd, J.R. Simplot Company among other domestic and global players.

Market Scope, Segments and Forecast of the Plant Breeding and CRISPR Plants Market

The Plant Breeding and CRISPR Plants Market is witnessing high demand due to the rise in demand of the product across different end-use areas. On the basis of product, geography and application the market is bi-furcated into different sub-segments as per the feasibility check and market estimation from 2020 to 2027 have been provided for these segments.

Market Overview, Key Trends Market Dynamics

The market would gain significant growth rate during the forecast period, reaching a substantial market size by 2020. The market has been analyzed taking into considerations the different factors which includes the market drivers, restraints, opportunities, key competitor landscape, trend analysis, outlook, estimate and forecast factors. The impact of COVID -19 could be seen on the market; however, the Plant Breeding and CRISPR Plants Market would recover from this pandemic by end of the next year. We have also mentioned the key trends of the market that would impact the growth of the market at present and in the coming years as well.

Check Table of Contents of This Report @https://www.databridgemarketresearch.com/toc/?dbmr=global-plant-breeding-and-crispr-plants-market

Geographical Coverage of Plant Breeding and CRISPR Plants Market

Table of Contents

Do You Have Any Query Or Specific Requirement? Ask to Our Industry Expert@https://www.databridgemarketresearch.com/speak-to-analyst/?dbmr=global-plant-breeding-and-crispr-plants-market

Key Pointers of the Report

Additional Pointers of the Report:

Given below are some of the added key points of the report:

About Us:

Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge Market Research provides appropriate solutions to the complex business challenges and initiates an effortless decision-making process.

Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude.We are content with our glorious 99.9 % client satisfying rates.

Contact Us:

Data Bridge Market Research

Tel: +18883872818

corporatesales@databridgemarketresearch.com

See the original post:
Plant Breeding And CRISPR Plants Market Is Expected To Reach USD 21.78 Billion By 2027 | Top Companies- Bayer AG, KWS SAAT SE & Co. KGaA, DuPont,...

Where Does Crispr Therapeutics AG (CRSP) Stock Fall in the Biotechnology Field? – InvestorsObserver

A rating of 80 puts Crispr Therapeutics AG (CRSP) near the top of the Biotechnology industry according to InvestorsObserver. Crispr Therapeutics AG's score of 80 means it scores higher than 80% of stocks in the industry. Crispr Therapeutics AG also received an overall rating of 64, putting it above 64% of all stocks. Biotechnology is ranked 30 out of the 148 industries.

Searching for the best stocks to invest in can be difficult. There are thousands of options and it can be confusing on what actually constitutes a great value. Investors Observer allows you to choose from eight unique metrics to view the top industries and the best performing stocks in that industry. A score of 64 would rank higher than 64 percent of all stocks.

These scores are not only easy to understand, but it is easy to compare stocks to each other. You can find the best stock in an industry, or look for the sector that has the highest average score. The overall score is a combination of technical and fundamental factors that serves as a good starting point when analyzing a stock. Traders and investors with different goals may have different goals and will want to consider other factors than just the headline number before making any investment decisions.

Crispr Therapeutics AG (CRSP) stock is trading at $180.75 as of 10:23 AM on Thursday, Jan 7, a rise of $16.90, or 10.32% from the previous closing price of $163.85. The stock has traded between $169.39 and $185.43 so far today. Volume today is light. So far 888,487 shares have traded compared to average volume of 1,989,285 shares.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

More here:
Where Does Crispr Therapeutics AG (CRSP) Stock Fall in the Biotechnology Field? - InvestorsObserver

CRISPR and CAS Gene Market 2021-2028 shooting revenue at US$ 7,603.8 Million with CRISPR Therapeutics, Mirus Bio, Caribou Biosciences, Editas…

CRISPR and CAS Gene Market witness to garner US$ 7,603.8 Million at a booming CAGR of +20% by the term of 2021-28.

CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome by removing, adding or altering sections of the DNA sequence. It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.

CRISPR is a tool that can be used to edit genes and, as such, will likely change the world. The essence of CRISPR is simple: its a way of finding a specific bit of DNA inside a cell. After that, the next step in CRISPR gene editing is usually to alter that piece of DNA.

When viruses infect bacteria, bacteria will produce this type of DNA and bind to virus DNAs; with working with one nuclease, called Cas, the Cas enzyme will cut the invaded DNA into pieces. Thus, CRISPR/Cas is a type of acquired immune defense mechanism for prokaryotes against virus.

Request a sample copy of report @ https://www.reportconsultant.com/request_sample.php?id=79563

The CRISPR and CAS Gene Market report gives the 360 degree perspective on the fundamentals of market, definitions, groupings, applications and industry chain review, industry arrangements and plans, item details, forms, cost structures and afterward on. At that point it examine the worlds primary district and economic situations, including the product value, benefit, limit, creation, limit usage, request and development pace of industry.

The investigator likewise centers around monetary and ecological variables, which impacts on the development of the business. Essential and auxiliary exploration methods have been utilized by analysts to get appropriate experiences into business. Requesting patterns and mechanical headways have been introduced in the examination report.

Key Players:

Caribou Biosciences Inc., CRISPR Therapeutics, Mirus Bio LLC, Editas Medicine, Takara Bio Inc., Synthego, Thermo Fisher Scientific, Inc., GenScript, Addgene, Merck KGaA (Sigma-Aldrich), Integrated DNA Technologies, Inc., Transposagen Biopharmaceuticals, Inc., OriGene Technologies, Inc., New England Biolabs, Dharmacon, Cellecta, Inc., Agilent Technologies, and Applied StemCell, Inc.

Highlights of the report:

The report covers the major driving factors influencing the revenue scale of the CRISPR and CAS Gene Market and details about the surging demand in this area. The report then highlights the latest trends and challenges that leading industry contenders could face. The significant applications and potential business areas are also added to this report. CRISPR and CAS Gene market research is provided for international markets as well as development trends, competitive landscape analysis and development status of key regions. Development policies and plans are discussed as well as manufacturing processes and analysis of cost structures. This report also shows import/export consumption, supply and demand, costs, prices, revenues and gross margins.

CRISPR and CAS Gene Market Report Segment: by product

CRISPR and CAS Gene Market Report Segment: by application

CRISPR and CAS Gene Market Report Segment: by end-user

CRISPR and CAS Gene Market Report Segment: by region

Get upto 40% Discount available on this Report @ https://www.reportconsultant.com/ask_for_discount.php?id=79563

The report provides major statistics of the industry and is a valuable source of guidance and direction for companies and individuals interested in the market. CRISPR and CAS Gene is explained in detail in various regions and various segments of the industry.

Table of Content:

About Us:

Report Consultant A worldwide pacesetter in analytics, research and advisory that can assist you to renovate your business and modify your approach. With us, you will learn to take decisions intrepidly by taking calculative risks leading to lucrative business in the ever-changing market. We make sense of drawbacks, opportunities, circumstances, estimations and information using our experienced skills and verified methodologies.

Our research reports will give you the most realistic and incomparable experience of revolutionary market solutions. We have effectively steered business all over the world through our market research reports with our predictive nature and are exceptionally positioned to lead digital transformations. Thus, we craft greater value for clients by presenting progressive opportunities in the global futuristic market.

Contact us:

Riaana Singh

(Report Consultant)

sales@reportconsultant.com

http://www.reportconsultant.com

Link:
CRISPR and CAS Gene Market 2021-2028 shooting revenue at US$ 7,603.8 Million with CRISPR Therapeutics, Mirus Bio, Caribou Biosciences, Editas...

The 221b Foundation Establishes Coalition to Control the Spread of COVID-19 in Nepal – Business Wire

CAMBRIDGE, Mass.--(BUSINESS WIRE)--The 221b Foundation, a nonprofit organization established by Sherlock Biosciences to address the global COVID-19 pandemic and diverse representation in STEM, today announced an initiative with the Ministry of Health and Population (MoHP) in Nepal to control the spread of SARS-CoV-2 throughout the country. With contributions from Sherlock Biosciences, Open Philanthropy, Integrated DNA Technologies and MoHP, The 221b Foundation will provide support to the country of Nepal through financial assistance and donations of equipment and Sherlock CRISPR SARS-CoV-2 kits, which the country has designated as an essential diagnostic test for combating the pandemic. The total value of the donations is $200,000.

Dr. Dig Bijay Mahat worked closely with Sherlock Biosciences and MoHP to introduce and facilitate the adoption of Sherlock CRISPR SARS-CoV-2 testing kits in Nepal. In addition to his work with the coalition, Dr. Mahat is also a research scientist in the lab of Nobel Laureate Phillip A. Sharp at the Koch Institute for Integrative Cancer Research at MIT.

According to MoHP, the daily COVID-19 positivity rate in Nepal is around 20-25%. Nepals capital, Kathmandu, and surrounding areas account for more than a third of all infections, raising concerns about the ability of hospitals to support the growing need for ventilators and intensive care.

When we established The 221b Foundation, we felt strongly that we needed to support efforts worldwide to confront COVID-19, said Rahul Dhanda, co-founder, president and CEO of Sherlock Biosciences and founding board member of The 221b Foundation. By establishing a strong coalition to support Nepal and its Ministry of Health, we are collectively working to provide a critical testing need to assist a region facing a surging challenge with this pandemic.

The testing will be supervised by MoHP with initial tests validated and run in the National Public Health Laboratory in Kathmandu. Initial efforts will support major cities, and the ramp up to support country-wide testing is expected to occur over the next few months. With infections increasing at alarming rates, a national testing strategy is the foundation of Nepals effort to manage the pandemic.

COVID-19 has become a severe threat to our national public health, and we have established a plan to contain its spread, which is built on a strong testing platform, said Dr. Jageshwor Gautam, the spokesperson for MoHP. Sherlocks CRISPR SARS-CoV-2 kit is ideally suited to address Nepals national diagnostic needs, and it represents one of many critical components in a broader plan that will successfully contain this pandemic.

The coalition members have each committed to addressing the pandemic through testing, tracing, providing equipment or supporting communities most severely affected by the pandemic. The Sherlock CRISPR SARS-CoV-2 kit should provide capacity for a single site to run thousands of tests per day on simple and accessible equipment.

The SHERLOCK diagnostic platform can achieve single molecule detection of nucleic acid targets; its name stands for Specific High Sensitivity Enzymatic Reporter unLOCKing. SHERLOCK utilizes CRISPR activity for smart amplicon detection and can be adapted for use with existing diagnostic instruments, improving time to result due to its significant multiplexing capacity. When a specific sequence of DNA or RNA is present, a CRISPR enzyme is activated and, much like a pair of scissors, starts cutting nearby genetic material, releasing a fluorescent signal that indicates a positive result. In May 2020, Sherlock received Emergency Use Authorization (EUA) from the U.S. Food and Drug Administration (FDA) for its Sherlock CRISPR SARS-CoV-2 kit, the first FDA-authorized use of CRISPR technology.

About The 221b Foundation

The 221b Foundation was founded with the dual mission to assist in the eradication of COVID-19, while supporting racial and gender diversity in STEM. By providing support and intellectual property that enables both non-profit and for-profit entities to develop CRISPR-based diagnostic testing, The 221b Foundation seeks to aid in the fight against the global COVID-19 pandemic while furthering access and diversity in STEM industries. Led by industry experts in the fields of diagnostic testing, STEM and diversity, The 221b Foundation envisions a world where advances in CRISPR technology fuel the innovations that will put an end to the COVID-19 pandemic. For more information, please visit: 221bfoundation.org.

About Sherlock Biosciences

Sherlock Biosciences is dedicated to providing global access to the simplest and most accurate tests that empower individuals to control their own healthcare. Through its Engineering Biology platforms, the company is developing applications of SHERLOCK, a CRISPR-based method for smart amplicon detection, and INSPECTR, a synthetic biology-based molecular diagnostics platform that is instrument-free. SHERLOCK and INSPECTR can be used in virtually any setting without complex instrumentation, opening up a wide range of potential applications in areas including precision oncology, infection identification, food safety, at-home tests and disease detection in the field. In 2020, the company made history with the first FDA-authorized use of CRISPR technology. For more information visit Sherlock.bio.

Continue reading here:
The 221b Foundation Establishes Coalition to Control the Spread of COVID-19 in Nepal - Business Wire

Strategies and applications for CRISPRko, RNAi and beyond – SelectScience

Watch this on-demand webinar to learn more about manipulating the genes within physiologically relevant human immune cells

In this on-demand SelectScience webinar, immunology expert Dr. Verena Brucklacher-Waldert, Horizon Discovery, shares successful strategies for the manipulation of genes within physiologically relevant human immune cells. A number of case studies are presented to highlight the techniques used in a variety of applications employed for gene interrogation, including CRISPRko, RNAi and more.

Read on for highlights from our Q&A session that followed the live webinar with Ryan Donnelly, Senior Product Manager for Gene Editing at Horizon Discovery.

RD: We've spoken to a lot of customers who do what we call orthogonal studies for hit follow-up. Say you run a CRISPR knockout screen, and you get a handful of hits back, you can then see what reagents are available, maybe via traditional RNAi methods, so siRNA or shRNA. You can then run those to see if you can replicate some of the phenotypes that you saw in your knockout screen for those specific hits. The thought is, if you see a positive correlation, you now have stronger evidence that that hit was actually real, since you've now generated a similar phenotype by targeting both DNA, with your CRISPR knockout screen, as well as the RNA with those traditional kinds of RNAi methods.

In essence, you've generated a similar phenotype by targeting two different sections of the central dogma. One of the nice things about Horizon is we have readily available reagents, all genome-wide for both CRISPR knockout, CRISPR activation, siRNA and shRNAs. So, most combinations that you would be looking at for validation, we can support.

RD: There are a few. But the first one that comes to mind is when working with primary immune cells, the availability and variability of the cell type. We can extract those cells from blood samples, but there's usually a limited amount of those types of cells that we can extract from each donor. We then need to keep in mind that there can be specific variability between donors. The complexities that come along with trying to stimulate immune cells, like T cells, also need to be considered.

Another challenge that we usually see is just in the biological differences between immune cell types. We talked a lot about proliferating cell types. Some cell types lose the ability to proliferate once they've been extracted from blood.

Lastly, is a variable that we look at routinely that also comes down to cell type: cells that are in suspension versus adherent cells. This can make screening protocols quite different, depending on whether your cell types are in suspension or if they're stuck down in the bottom of a well. Those are the three main considerations when looking to conduct screening experiments within immune cells.

RD: In principle, we usually suggest a minimum of three donors, but this is all cell type dependent. Functional assays can show a high degree of variability when using cell types such as natural killer cells. But if you shift into myeloid cells, that variability in functional assays is much more limited. Another thing to keep in mind is that donor variability is not necessarily a bad thing. By mixing donors, you spread a wider vision on things like the ethnicity of those donors, sex, age, and genetics that make up the donor pool. Since they're randomized, it will give you good insight into how a variety of donors would respond and can give you higher confidence in the performance characteristics of the target that you've identified within your screen.

RD: Controls, and multiple types of controls, are absolutely critical when doing this type of work. Without them, it's really impossible to check the efficiencies in large, arrayed screens.

At Horizon, we use multiple different types of controls, and for anybody that is taking these projects on, we would recommend a similar approach. For checking the transduction efficiency, we use a combination of both lethal controls and essential genes. This will give us a nice viability readout. In essence, the more cells that die, the higher the rate of transduction efficiency.

We also incorporate non-targeting controls, and a ROSA26 guide RNA. The non-targeting control won't cut the DNA, so incurs no DNA damage. The ROSA26 guide RNA will cut, but it cuts without a functional impact to the cell. This will give us insights into the potential for DNA damage, as well as a cutting efficiency control. Lastly, we would pick a positive control based on the cell type of interest. For example, in T cells, we target CD3, as it's consistently expressed as part of the T cell receptor complex.

By doing this, we have the ability to monitor across donors, across plates, and across replicates, to look at assay performance as a whole, with the screening experiment.

Q: How does pooled screening differ from arrayed screens? And what are the advantages?

RD: The main advantage of performing a pooled screen over an arrayed screen is really the ability to scale up and analyze the whole genome with a reasonably small amount of resources. Mining the whole genome is very important when we're looking to understand new biology without any preconceived ideas. It's really a discovery approach.

Thinking about using a pool versus an arrayed screen comes down to the biological question you're attempting to answer. If it's a simple, black and white question, such as "Do my cells survive a particular stimulus?", a pooled screen is a really nice way to go. If, however, the screen needs to assess multiple different types of outcomes that use different techniques so maybe combining FACS and HTRF assays for looking at more than one parameter, arrayed screens are what you would need to use.

Learn more about modulating gene function in primary immune cells: Watch this webinar on demand here>>

SelectScience runs 10+ webinars a month across various scientific topics, discover more of our upcoming webinars>>

See original here:
Strategies and applications for CRISPRko, RNAi and beyond - SelectScience

TRIM26 is a critical host factor for HCV replication and contributes to host tropism – Science Advances

Abstract

Hepatitis C virus (HCV) remains a major human pathogen that requires better understanding of virus-host interactions. In this study, we performed a genome-wide CRISPR-Cas9 screening and identified TRIM26, an E3 ligase, as a critical HCV host factor. Deficiency of TRIM26 specifically impairs HCV genome replication. Mechanistic studies showed that TRIM26 interacts with HCV-encoded NS5B protein and mediates its K27-linked ubiquitination at residue K51, and thus promotes the NS5B-NS5A interaction. Moreover, mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection. In conclusion, we identified TRIM26 as a host factor for HCV replication and a new determinant of host tropism. These results shed light on HCV-host interactions and may facilitate the development of an HCV animal model.

Hepatitis C virus (HCV) is an enveloped, single-stranded RNA virus belonging to the family Flaviviridae. The HCV RNA genome is 9.6 kb in length and consists of a single open reading frame (ORF) flanked by highly conserved 5 and 3 untranslated regions (UTRs). The ORF encodes a single polyprotein of over 3000 amino acids, which is cleaved by cellular and viral proteases into structural proteins (core, E1, and E2) and nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B). NS5B, an RNA-dependent RNA polymerase (RdRp), together with other nonstructural proteins NS3, NS4A, NS4B, and NS5A, forms intracellular membraneassociated replication complex and catalyzes viral genomic RNA replication. HCV infects over 71 million people worldwide (1). Among this infected population, about 80% develop persistent infection, leading to severe liver diseases, such as liver cirrhosis and hepatocellular carcinoma (HCC). Recently developed direct-acting antiviral agents (DAAs) targeting viral NS3 protease, NS5A and NS5B polymerases are highly effective in curing patients with HCV. However, global eradication of HCV remains challenging due to lack of an HCV vaccine, potential drug-resistant mutations, severe liver disease progression in DAA-cured patients, and other newly emerging problems (2). Better understanding of viral life cycle and virus-host interactions is still imperative for the prevention and control of HCV infection.

The tripartite motif (TRIM) family that consists of more than 70 members in human plays roles in multiple cellular processes including intracellular signaling, development, apoptosis, protein quality control, innate immunity, autophagy, and carcinogenesis (3). An increasing number of studies have focused on the roles of TRIM family proteins in host responses to virus infection. TRIM5 recognizes retroviral capsids to induce premature core disassembly and inhibits reverse transcription of the viral genome (4, 5). TRIM69 restricts dengue virus (DENV) replication by ubiquitinating viral NS3 (6). TRIM22 and TRIM41 inhibit influenza A virus infection by targeting nucleoprotein for degradation (7, 8). TRIM56 suppresses Zika virus (ZIKV) replication through sequestration of its genomic RNA (9).

As an E3 ligase, TRIM26 contains an N-terminal RING domain, B-box domain, coiled-coil domain, and a C-terminal SPRY domain. One study showed that TRIM26 promotes interferon regulatory factor 3 (IRF3) degradation and thus suppresses interferon- (IFN-) signaling (10), while another showed that TRIM26 promotes the interaction between the kinases TBK1 and NEMO, leading to activation of IFN signaling (11). In this study, we identified TRIM26 as a critical host factor of HCV by genome-wide CRISPR screening. A mechanistic study demonstrated that TRIM26 mediates NS5B ubiquitination and enhances its interaction with NS5A, which is crucial for HCV genome replication. Furthermore, we showed that mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B, providing new evidence for understanding the genetic basis underlying the exceptionally narrow host tropism of HCV infection. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection, providing clues for the development of an HCV animal model.

Taking advantage of the NIrD (NS3-4A inducible rtTA-mediated dual-reporter) reporter system to monitor HCV infection in real-time and live-cell fashion (12), we performed a genome-wide CRISPR-Cas9 screening to identify host factors essential for HCV infection (13) (Fig. 1A). Huh7.5 cells harboring the NIrD reporter showed red fluorescence (mCherry) upon cell culture-derived HCV (HCVcc) infection in the presence of doxycycline. The reporter cells transduced with a CRISPR single guide RNA (sgRNA) library targeting human proteincoding genes were infected with HCVcc at multiplicity of infection (MOI) of 0.1, and mCherry-negative cells were enriched by cell sorting. The abundance of each sgRNA in the enriched mCherry-negative cells was measured through deep sequencing and analyzed with the RIGER (RNAi Gene Enrichment Ranking) algorithm (tables S1 and S2). Many host factors were identified from this screening (Fig. 1B). Among the top candidates, CD81, occludin (OCLN), and claudin 1 (CLDN1) are the well-defined HCV entry factors (1416). Peptidylproly isomerase A (PPIA), also known as cyclophilin A (CypA), has been shown critical for HCV replication (17). ELAV-like RNA binding protein 1 (ELAVL1) interacted with HCV 3UTR and enhanced HCV replication (18). These positive results validated our CRISPR screening. Except for these previously described hits, TRIM26 is a top hit from our screening and was also identified in a previous screening (19). To investigate the role of TRIM26 in HCV infection, we silenced TRIM26 expression in Huh7 cells through CRISPR interference (CRISPRi) (20). Two TRIM26 sgRNAs (sg1 and sg2) that efficiently reduced the TRIM26 expression (Fig. 1C), which had no effect on cell viability (Fig. 1D), were selected for the following experiments. TRIM26 knockdown cells were infected with HCVcc at MOI of 0.1, and the intracellular HCV RNA, NS3 protein levels, and extracellular HCV titer were measured at the indicated time points after HCVcc infection. As shown in Fig. 1 (E to G), TRIM26 knockdown reduced the HCV RNA level, NS3 protein expression, and extracellular HCV titer. We further reconstituted wild-type TRIM26 and the RING domaindeleted mutant (TRIM26R) in the TRIM26 knockdown and control cells. The expression of TRIM26 and TRIM26R in these cells was verified by Western blot (fig. S1A). As shown in fig. S1 (B to D), exogenous expression of wild-type TRIM26, but not TRIM26R, restored HCV infection in the TRIM26 knockdown cells.

(A) Schematic of whole-genome scale CRISPR screening. (B) The hits identified in CRISPR screening were shown after RIGER analysis. Top hits in the screening were marked by the gene symbols with different colors. (C) Western blot analysis of TRIM26 expression in three TRIM26 knockdown Huh7 cells. (D) Effect of TRIM26 knockdown on cell viability. (E to G) Control and TRIM26 knockdown Huh7 cells were infected with HCVcc at MOI of 0.1 for the indicated time points, and intracellular HCV RNA (E), extracellular HCV titer (F), and NS3 protein (G) were determined. HCV RNA was expressed as values relative to the actin mRNA level. The error bars represent SDs from two independent experiments. FFU, focus-forming units. One-way ANOVA was used for statistical analysis. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control cells.

To further confirm the role of TRIM26 in HCV infection, we generated Huh7.5.1 TRIM26 knockout cells (fig. S2, A and B). We then infected Huh7.5.1 TRIM26 knockout and control cells with HCVcc at MOI of 0.1. Consistently, TRIM26 knockout reduced the HCV RNA level, NS3 expression, and extracellular HCV titer (fig. S2, C to E). Together, these results demonstrated that TRIM26 plays an important role in HCV infection.

Previous studies showed that TRIM26 is involved in IFN signaling (10, 11). To examine the potential effect of IFN signaling in TRIM26 knockdown cells on HCV infection, Huh7-TRIM26 knockdown and control cells were infected with HCVcc at MOI of 0.1. IFN- and IFN-stimulated gene (ISG) mRNA levels were determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR). As shown in fig. S3, no difference was observed between the TRIM26 knockdown and control cells after HCV infection, suggesting that involvement of TRIM26 in HCV infection is not mediated by its potential action on host IFN signaling.

To investigate in which step of the HCV life cycle TRIM26 is involved, we used HCVE1 that lacks the E1 region in viral genome and only undergoes single-round infection in Huh7 cells (21). Huh7-TRIM26 knockdown and control cells were infected with the HCVE1 virus at MOI of 0.1, and HCV RNA level was determined. As shown in Fig. 2A, TRIM26 knockdown reduced HCVE1 RNA level for about sevenfold at 72 hours after infection, suggesting that TRIM26 may contribute to HCV entry or genome replication. Next, we used the pseudotyped HCV particles (HCVpp) that harbor HCV envelope glycoproteins and serve as a surrogate model for HCV entry (22). Huh7-TRIM26 knockdown cells and control cells were infected with HCVpp. As shown in Fig. 2B, no substantial difference was observed between the TRIM26 knockdown and control cells, suggesting that TRIM26 has no effect on HCV entry. To assess the potential effect of TRIM26 on HCV polyprotein cleavage and translation, the TRIM26 knockdown and control cells were transfected with plasmids expressing nonstructural proteins NS3-5B or an RdRp-deficient HCV genome (JFH1-GND-Rz) that recapitulates internal ribosomal entry site (IRES)dependent viral protein translation and polyprotein cleavage. As shown in fig. S4, TRIM26 knockdown had no effect on HCV polyprotein cleavage and translation. Last, we examined the impact of TRIM26 on HCV genome replication using HCV subgenomic replicon that serves as a surrogate model for viral genome replication (23). The JFH1 subgenomic replicon cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. HCV RNA and NS3 protein levels were analyzed by RT-qPCR and Western blot, respectively. As shown in Fig. 2 (C and D), TRIM26 knockdown reduced both HCV RNA and NS3 protein levels. Together, these results demonstrated that TRIM26 is likely involved in HCV genome replication.

(A) Control and TRIM26 knockdown Huh7 cells were infected with the single-round infectious HCVE1 for the indicated time points. The HCV RNA level was detected by RT-qPCR. (B) Control and TRIM26 knockdown Huh7 cells were infected with HCVpp. The infectivity was quantified by luciferase assay. (C and D) JFH1-SGR cells were transduced with sgEGFP or sgTRIM26 for the indicated time points. HCV RNA (C) and NS3 protein levels (D) were determined by RT-qPCR and Western blot, respectively. The error bars represent SDs from two independent experiments. One-way ANOVA (A and B) and t test (C) were used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control.

Next, we determined whether TRIM26 is required for the replication of other HCV genotypes. Con1 (genotype 1b) (23) and PR87 (genotype 3a) (24) subgenomic replicon-harboring cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. As shown in fig. S5 (A to D), TRIM26 knockdown reduced Con1 and PR87 viral RNA and NS5A protein expression. Furthermore, we showed that TRIM26 knockdown inhibited the infection of PR63cc, another genotype 2a HCVcc strain (fig. S5E) (25). Collectively, these results demonstrated that TRIM26 contributes to replication of HCV from multiple genotypes.

Next, we examined whether TRIM26 functions in infection of other flaviviruses, such as DENV and ZIKV. Huh7-TRIM26 knockdown and control cells were infected with DENV or ZIKV at MOI of 0.1. Intracellular viral RNA (fig. S6, A and D), extracellular viral titer (fig. S6, B and E), and DENV E protein level (fig. S6C) were measured. The results showed that TRIM26 knockdown had no effect on DENV and ZIKV infection.

To elucidate the underlying mechanism by which TRIM26 promotes HCV replication, we determined the interactions of TRIM26 with HCV-encoded proteins. Plasmids expressing TRIM26 and FLAG-tagged HCV proteins were cotransfected into human embryonic kidney (HEK) 293T cells to perform coimmunoprecipitation (co-IP) assays. As shown in fig. S7 (A to H), TRIM26 was coimmunoprecipitated with NS5B, but not with core, E1, E2, NS2, NS3, NS4B, or NS5A. Conversely, NS5B was coimmunoprecipitated with hemagglutinin (HA)tagged TRIM26 (Fig. 3A). We further confirmed the colocalization of NS5B and TRIM26 by confocal microscopy (fig. S7I). To verify the TRIM26-NS5B interaction in the context of HCV infection, Huh7 cells ectopically expressing FLAG-tagged TRIM26 were infected with HCVcc at MOI of 1 for 48 hours, and co-IP assay was performed. Consistently, NS5B, but not NS3, was coimmunoprecipitated with TRIM26 (Fig. 3B). This interaction was also confirmed in JFH1 subgenomic replicon cells (Fig. 3C).

(A) HEK293T cells were transfected with plasmids expressing HA-tagged TRIM26 and FLAG-tagged NS5B. The co-IP assay was performed with an anti-HA antibody. IB, immunoblot; IP: immunoprecipitation. (B) Huh7 cells transfected with FLAG-tagged TRIM26 for 24 hours were infected with HCVcc for another 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (C) JFH1 subgenomic replicon cells were transfected with FLAG-tagged TRIM26 for 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, or TRIM26R together with HA-tagged ubiquitin for 48 hours. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and TRIM26 along with HA-tagged ubiquitin or ubiquitin mutants. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (F) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26 along with HA-tagged ubiquitin. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (G) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (H) Control and TRIM26 knockdown Huh7 cells were electroporated with in vitro transcribed JFH1 or JFH1-K51R subgenomic RNA. After G418 selection, the subgenomic replicon cells were harvested for detecting HCV RNA level by RT-qPCR. The error bars represent SDs from two independent experiments. t test was used for statistical analysis. ns, P > 0.05; **P > 0.01. The protein levels were quantified by ImageJ, normalized against TRIM26 input protein level, and expressed as values relative to FLAG IP protein level.

Next, we sought to map the key domains that are indispensable for TRIM26-NS5B interaction. We constructed TRIM26 mutants with a deletion in the N-terminal RING domain (TRIM26R) or the C-terminal SPRY domain (TRIM26SPRY) (fig. S8A), as well as NS5B mutants with a deletion in the N-terminal finger domain (NS5BN), the central palm domain (NS5B188-371), or the C-terminal thumb domain (NS5BC) (fig. S8B). The co-IP assays showed that the SPRY domain of TRIM26 and the C-terminal region of NS5B were required for the interaction (fig. S8, A and B).

As the function of TRIM26 in HCV replication requires its RING domain that is known to be responsible for ubiquitinating its substrates (fig. S1, B to D), we next examined whether TRIM26 mediates NS5B ubiquitination. HEK293T cells were cotransfected with plasmids expressing wild-type or RING-deleted TRIM26, FLAG-tagged NS5B, and HA-tagged ubiquitin, and then, NS5B was immunoprecipitated and its ubiquitination was analyzed by Western blot. As shown in Fig. 3D, wild-type, but not the RING-deleted TRIM26, promoted the ubiquitination of NS5B. Ubiquitin is known to link to substrate protein through its internal lysine residues at position 6, 11, 27, 29, 33, 48, or 63 (26); therefore, we constructed a series of ubiquitin mutants with the lysine (K)toarginine (R) change at each of these positions. We found that ubiquitin with the K27R mutation significantly reduced the TRIM26-mediated NS5B ubiquitination (Fig. 3E), suggesting that K27 is likely the ubiquitin lysine residue linked to NS5B.

Next, we sought to identify critical lysine residues of NS5B targeted by TRIM26. There are 30 lysine residues in NS5B of JFH1. We analyzed the conservation for these individual lysine residues among different HCV genotypes and their positions in the three-dimensional structure of NS5B (Protein Data Bank ID: 2XYM) (fig. S9A) (27). Given that TRIM26 is involved in the replication of HCV genotypes 1, 2, and 3, we selected 11 lysine residues that are highly conserved among the three genotypes (conservation, >90%) and located on the surface of NS5B structure (highlighted red in fig. S9A). As shown in Fig. 3F and fig. S9C, the K51R mutation in NS5B significantly reduced TRIM26-mediated NS5B ubiquitination, suggesting that TRIM26 promotes K27-linked ubiquitination of NS5B at the residue of K51.

Next, we investigated whether the K51R mutation in NS5B affects its interaction with TRIM26. Plasmids expressing TRIM26 and either wild-type or K51R-mutated NS5B were cotransfected into HEK293T cells to perform a co-IP experiment. As shown in Fig. 3G, the K51R mutation did not impair the interaction between NS5B and TRIM26.

Last, we assessed the effect of K51R mutation on HCV replication. The wild-type or NS5B-K51R mutant JFH1 subgenomic replicon was established in wild-type and TRIM26 knockdown Huh7 cells. As shown in Fig. 3H, NS5B K51R mutation reduced HCV replication in wild-type cells but not in the TRIM26 knockdown cells. Together, these results demonstrated that the TRIM26-mediated ubiquitination of NS5B at the K51 residue is critical for HCV replication.

To investigate how TRIM26-mediated NS5B ubiquitination enhances HCV replication, we examined the interaction of NS5B with other nonstructural proteins involved in the viral replication complex. Huh7-TRIM26 knockdown and control cells were transfected with the plasmid expressing the NS3-5B polyprotein. As shown in Fig. 4A, TRIM26 knockdown reduced the interaction between NS5B and NS5A but had little effect on the interaction between NS5B and NS3. Consistently, TRIM26 overexpression specifically enhanced the interaction between NS5B and NS5A (Fig. 4, B and C).

(A) Control and TRIM26- knockdown Huh7 cells were transfected with plasmids expressing NS3-5B-3 FLAG. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (B and C) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, and NS3 (B) or NS5A (C). The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and NS5A together with TRIM26 or TRIM26R. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and NS5A together with TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The NS3 and NS5A protein levels were quantified by ImageJ, normalized against their input protein levels, respectively, and expressed as values relative to FLAG IP protein levels.

To assess whether TRIM26-mediated NS5B ubiquitination affects NS5B-NS5A interaction, FLAG-tagged NS5B, NS5A, and TRIM26 or TRIM26R expression plasmids were cotransfected into HEK293T cells to perform a co-IP assay. As shown in Fig. 4D, deletion of RING domain in TRIM26 reduced the interaction of NS5B and NS5A. To further confirm it, HEK293T cells were cotransfected with plasmids expressing wild-type or K51R-mutated NS5B, together with NS5A and TRIM26. As shown in Fig. 4E, NS5B K51R mutation reduced the NS5B-NS5A interaction. Together, these results demonstrated that TRIM26 mediates ubiquitination of NS5B and promotes its interaction with NS5A.

TRIM26 is expressed in a wide range of animals and highly conserved among different species (fig. S10 and Fig. 5A). Next, we determined whether TRIM26 from different species supports HCV replication. We cloned TRIM26 from mouse that does not efficiently support HCV replication and from tupaia (tree shrew) that has been reported to moderately support HCV replication (28). Human, mouse, and tupaia TRIM26, designated hTRIM26, mTRIM26, and tTRIM26, respectively, were stably expressed in control and TRIM26 knockdown Huh7 cells (Fig. 5B). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (C and D), ectopic expression of hTRIM26 and tTRIM26 in the TRIM26 knockdown cells restored HCV replication, whereas ectopic expression of mTRIM26 did not restore HCV replication in the TRIM26 knockdown cells or exert a dominant-negative effect on HCV infection in Huh7 cells.

(A) Alignment of TRIM26 protein of different species. (B) Western blot analysis of reconstituted TRIM26 of different species in control and Huh7-TRIM26 knockdown cells. (C and D) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV NS3 protein expression (C) and RNA level (D) were analyzed at 48 hours after infection. (E) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (F) Western blot analysis of reconstituted mTRIM26-del expression in control cells and Huh7-TRIM26 knockdown cells. (G and H) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV RNA level (G) and NS3 protein expression (H) at 48 hours after infection were analyzed. (I) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, or mTRIM26-del were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The error bars represent SDs from two independent experiments. One-way ANOVA was used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as relative to control (C and H) or normalized against TRIM26 input protein level and expressed as values relative to immunoprecipitated FLAG-tagged protein level (E and I).

Next, we performed a co-IP assay to determine the interaction of NS5B and TRIM26 of different species. Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with FLAG-tagged NS5B. As shown in Fig. 5E, NS5B interacted with hTRIM26 and tTRIM26, while it had very weak interaction with mTRIM26. The amino acid sequence alignment showed that there is a unique insert of six amino acids in mTRIM26 (located at 257262) but not in TRIM26 of human, chimpanzees, rhesus monkey, or tupaia (Fig. 5A and fig. S10). To determine whether this sixamino acid insert within mTRIM26 influences its function in HCV infection, we deleted it in mTRIM26 (designated mTRIM26-del) and stably expressed it in control and TRIM26 knockdown Huh7 cells (Fig. 5F). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (G to H), in contrast to the full-length mTRIM26, mTRIM26-del reconstitution in TRIM26 knockdown cells partially restored HCV replication. Consistently, mTRIM26-del acquired the ability to interact with NS5B (Fig. 5I). Collectively, these results demonstrated that TRIM26 not only plays a role in HCV replication but also contributes to viral host tropism.

Last, we examined whether human TRIM26 can enhance HCV replication in murine hepatocytes that normally do not support HCV infection. For this purpose, we used a previously reported murine hepatoma cell line Hep561D7A7 that had been reconstituted with CD81, SRBI, CLDN1, OCLN, SEC14L2, and miR122, which are host factors essential for HCV infection (29). Hep561D7A7 and its parental control Hep561D cells were first transfected with hTRIM26 or mTRIM26 for 24 hours and then infected with Gluc-labeled HCVcc (JC1-Gluc) that can secret Gluc into culture supernatants upon infection. The expression of hTRIM26 and mTRIM26 was verified by Western blot (Fig. 6A). The culture supernatants at days 0, 1, 2, 3 after infection were harvested for the luciferase assay. As shown in Fig. 6B, hTRIM26 expression enhanced about eightfold HCV infection in Hep561D7A7 cells but not in Hep561D cells, while mTRIM26 had no effect in the both cells. To confirm this, we established Hep561D7A7 cells that stably express hTRIM26 by lentiviral transduction (designated Hep561D7A7-hTRIM26). The expression of hTRIM26 was identified by Western blot (Fig. 6C). Next, Hep561D7A7 and Hep561D7A7-hTRIM26 cells were infected with HCV and then analyzed by NS5A immunofluorescence staining. As shown in Fig. 6D, although the infection in the both cells was not very efficient, there were more HCV-positive cells in Hep561D7A7-hTRIM26 cells. Consistently, flow cytometry analysis showed that HCV infection was more efficient in hTRIM26-transduced Hep561D7A7 cells, and this increased HCV infection was more evident in the hTRIM26high expressing Hep561D7A7 cells (Fig. 6E). Together, these data suggested that hTRIM26 reconstitution enhances HCV infection in murine hepatocytes.

(A) Western blot analysis of hTRIM26 and mTRIM26 expression in Hep561D and Hep561D7A7 cells. (B) Hep561D and Hep561D7A7 cells transfected with hTRIM26 or mTRIM26 as well as Huh7 cells were infected with JC1-Gluc for the indicated time points. The culture supernatants were harvested for the luciferase assay. The error bars represent SDs from two independent experiments. RLU, relative light units. (C) Western blot analysis of hTRIM26 expression in Hep561D7A7 and Hep561D7A7-hTRIM26 cells. (D) Parental and hTRIM26-transuced Hep561D7A7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody (red) for immunofluorescence microscopy. ZsGreen coexpressed in the same lentiviral vector with hTRIM26 was labeled green. The error bars represent SDs from the number of NS5A-positive cells in three wells from one representative experiment. t test was used for statistical analysis. ns, P > 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. (E) Parental, hTRIM26-transuced Hep561D7A7 cells, or Huh7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody for flow cytometry analysis of HCV-positive cells. Meanwhile, ZsGreen-positive hTRIM26-transuced Hep561D7A7 cells (2.8% of total) were also analyzed.

Host factors participate in each step of the HCV life cycle. In this study, we performed a genome-wide CRISPR-Cas9 screen to uncover host factors crucial for HCV replication. A variety of host factors were identified from this screen, including the well-defined HCV entry factors CD81, OCLN, and CLDN1 (1416). PPIA has been shown to be critical for HCV replication and as a druggable target for HCV (17). ELAVL1 binds the 3 ends of the HCV RNAs and protects viral RNAs from degradation (18). The aforementioned candidates were also identified from a previous CRISPR-based screen, which was also performed in a hepatoma cell line (19). Besides, CSNK1A1 is responsible for NS5A hyperphosphorylation and crucial for viral production (30). DNA methyltransferase 1 (DNMT1), a key factor involved in establishing and maintaining DNA methylation, is also required for HCV propagation (31). Collectively, our CRISPR screening results are highly consistent with previous findings.

We found that TRIM26 is a critical host factor for efficient HCV replication. This conclusion is supported by multiple lines of evidence. First, deficiency of TRIM26 reduces replication of HCV from multiple genotypes (Fig. 2 and fig. S5). Second, TRIM26 specifically interacts with viral polymerase NS5B (Fig. 3 and fig. S7). Third, TRIM26 promotes K27-linked ubiquitination of NS5B at residue K51, which enhances its binding to NS5A, a critical interaction for assembly of viral replication complex (Figs. 3 and 4). The role of TRIM26 in HCV replication seems virus specific, as it is not involved in the life cycle of other closely related flaviviruses such as DENV and ZIKV (fig. S6). It is important to point out that TRIM26 knockout greatly diminishes HCV replication but does not completely abolish it. This implies that a possible redundant host function may compensate the TRIM26 deficiency.

Previous studies showed that TRIM26 plays a role in the regulation of antiviral IFN response (10, 11). Our results showed that neither IFNs nor ISGs were induced significantly in HCV-infected Huh7 cells (fig. S3). This observation was consistent with many previous studies demonstrating that HCV has multiple strategies to antagonize host innate immune responses (3234). There was no difference in the levels of IFNs or ISGs between the TRIM26 knockdown and control cells upon HCV infection, which further rules out the possibility that TRIM26 contributes to HCV replication via regulation of IFN signaling. In addition, TRIM26 was reported to function as a tumor suppressor of HCC, as TRIM26 knockdown promotes cell proliferation and metastasis (35). We found that TRIM26 knockdown had no effect on the cell viability of Huh7, a human HCC cell line (Fig. 1D).

Together with host factors, HCV nonstructural proteins form a membrane-associated replication complex, which is required for HCV genome replication. In this study, we found that TRIM26 binds NS5B, which requires both the SPRY domain of TRIM26 and the C-terminal region of NS5B (fig. S8). TRIM26-mediated ubiquitination of NS5B at residue K51 enhances the interaction between NS5B and NS5A and, in turn, enhances HCV genome replication (Figs. 3 and 4). As shown in fig. S9A, K51 is highly conserved among all HCV genotypes. In addition, we found K51 is 99.8% conserved among 2045 HCV sequences in the ViPR-HCV database, highlighting a critical role of this residue in the biological function of NS5B. NS5B functions as an RdRp, which that contains finger, palm, and thumb subdomains (3638). While the C-terminal thumb domain is required for the NS5B-TRIM26 interaction, residue K51 is located at the base of a finger loop, which is not essential for the interaction. However, there is an extensive interaction between the finger and thumb subdomains, leading to an encircled catalytic active site located in the central palm subdomain (3638). Therefore, we speculate that the finger and thumb interaction also serves as a platform for TRIM26-mediated ubiquitination of NS5B at residue K51. A cocrystal structure of NS5B and uridine 5-triphosphate (UTP) showed that K51 is adjacent to the triphosphate moiety of UTP and makes an electrostatic interaction with UTP (39). In addition, NS5B K51 has been shown to be a contacting residue with nascent RNA during RNA synthesis (40). Our result demonstrated that ubiquitination of NS5B at residue K51 is required for its interaction with NS5A (Fig. 4E). Future studies will be needed to investigate whether the NS5B K51 ubiquitination affects its contact with RNA substrates.

Humans are the sole known natural host for HCV infection. Although chimpanzees can be experimentally infected by HCV, it has become ethically difficult to use it as an in vivo model to study the virus and evaluate HCV vaccine candidates. In recent years, much progress has been made to develop small-animal models supporting HCV infection. Tupaia (also called tree shrew), a nonrodent small mammal, moderately supports HCV infection. However, its application for HCV animal model has been impeded by its outbred genetic background. Mice are excellent animal model for its inbred genetic background and related research tools but are not naturally permissive for HCV infection because of lack of critical HCV host factors (41). Reconstitution of human HCV entry factors in mice renders limited HCV infection (16, 42), raising a possibility that mice may still lack other HCV host factors. In our study, we found that human and tupaia TRIM26 are capable of supporting HCV replication, while mouse TRIM26 is not (Fig. 5B). Consistently, NS5B interacts with human and tupaia TRIM26, but not with mouse TRIM26 that contains a mouse specific sixamino acid insert. Deletion of this insert restores at least partially the ability of mouse TRIM26 to bind NS5B and to support HCV replication (Fig. 5, G and H). Although this sixamino acid insert (257262) is not located within the SPRY domain (294539) of TRIM26 that is required for its interaction with NS5B, its relative close proximity to the SPRY domain suggests that this extra insert may interfere with access of NS5B to the binding site of TRIM26. A more detailed structural analysis of the NS5B-TRIM26 complex is needed.

Expression of hTRIM26 can further boost HCV infection in Hep561D7A7 cells that have already been reconstituted with six critical human factors for HCV entry and replication (Fig. 6). This raises a possibility that introduction of hTRIM26 into a previously developed transgenic mouse model that expresses human HCV entry factors CD81, SR-B1, CLDN1, and OCLN (42) may further increase its permissiveness to HCV infection, an important step to develop a fully permissive small-animal model for HCV infection.

This study aimed to identify host factors essential for HCV infection by genome-wide CRISPR-Cas9 screening. Among the top candidates, TRIM26 was identified as a novel host factor for HCV infection. We then analyzed at which step of the HCV life cycle TRIM26 is involved and deciphered the underlying mechanism by which TRIM26 promotes HCV replication. Last, we compared the role of TRIM26 from different species in HCV infection and explored its potential roles in contribution to host tropism.

HEK293T and Huh7 cells were obtained from the Cell Bank of Shanghai Institute of Biological Sciences, Chinese Academy of Sciences. Huh7.5.1 cells were obtained from F. Chisari at Scripps Research Institute. Hep561D and Hep561D7A7 cells were obtained from A. Ploss at Princeton University. The cells were maintained in complete Dulbeccos modified Eagles medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum, 10 mM Hepes, 2 mM l-glutamine, 100 U of penicillin/ml, and 100 mg of streptomycin/ml. All cells were cultured in humidified air containing 5% CO2 at 37C.

The coding sequences of human, mouse, and tupaia TRIM26 were amplified by PCR/RT-PCR from an hTRIM26-containing plasmid (provided by J. Han at Xiamen University), murine L929 cells, and tupaia liver tissue, respectively, using the following primers: hTRIM26 (forward: CGAAAATATCGAACGCCTCAAGGTGGACAAGGGCAGGC; reverse: GAGGCGTTCGATATTTTCGACCAGGCTGGCCAGTTGC), mTRIM26 (forward: GCGCTCGAGATGGCAGTGTCAGCCCCCTTGAGGAG; reverse: GCGTCTAGATCAGGGTCTCAGCAGAAGGCGTGCTC), and tTRIM26 (forward: GCGCTCGAGATGGCCACGTCAGCCCCTCTGCG; reverse: GCGTCTAGATCAGGGTCTCAGCAGGAGGCGTG). The amplified PCR products were cloned into pLVX-IRES-Puro vector or pLVX-IRES-zsGreen vector (Fig. 6, C to E). The plasmids expressing core, NS2, NS3, NS4B, NS5A, and NS5B contain a FLAG tag at the N terminus. The E1- and E2-expressing plasmids contain a signal peptide at the N terminus and a FLAG tag at the C terminus. The mutant TRIM26 and NS5B plasmids were made by homologous recombination using a Gibson assembly cloning kit [New England Biolabs (NEB), USA]. All the constructs were verified by DNA sequencing.

The amino acids of NS5B of different HCV genotypes were downloaded from the HCV database site map, and the number of the sequences from each genotype is listed in fig. S9. The conservation and location of NS5B lysine residues among different HCV genotypes were analyzed by Vector NTI and PyMOL, respectively.

The human whole-genome sgRNA library that consists of approximately 180,000 sgRNAs that target 19,271 genes was designed. sgRNA oligos were synthesized (CustomArray), and the sgRNA-coding DNA fragments were amplified with PCR from the synthesized oligos with primers flanking the sgRNA target sequences. The amplified sgRNA-coding DNA fragments were purified (DNA Clean & Concentrator TM-5 Kit, Zymo Research) and ligated into the lentiviral vector expressing green fluorescent protein (GFP) by Golden Gate Assembly. The plasmids were transformed into trans1-T1 competent cells. The plasmid library was packaged into pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and VSV-G (glycoprotein of vesicular stomatitis virus) plasmids. Huh7.5-NIrD, a reporter cell line described in (12), was transduced with lentiviral vectors at MOI of 0.3, and GFP-expressing cells were enriched by fluorescence-activated cell sorting (FACS) (BD FACSAria III), which were ready for the following screening experiments after cell culture for 2 weeks.

The cell library was equally divided into two parts: the reference and experimental groups. The genomic DNA from the reference group was extracted, and the sgRNA-coding sequences integrated into chromosomes were amplified by PCR, followed by next-generation sequencing (Illumina HiSeq 2500). The cells of the experimental group were infected with HCVcc at MOI of 0.1 for 30 days, during which most cells died due to HCV replication. After that, mCherry-negative cells were enriched again by FACS in the presence of doxycycline (1 g/ml). The sgRNA sequences from the mCherry-negative cells were decoded by deep sequencing. Comparison of sgRNA abundance between the experimental group and the reference group was analyzed by the RIGER algorithm. The low count reads (less than 10) were filtered out.

The following three sgRNA sequences were used for the TRIM26 knockdown via CRISPRi (43) (sg1: GCGGCACCCCTCCTCTCTCA; sg2: GGAATAGCCGGGAGATTACG; sg3: GCTCGTGCAGGAGCGGGACC). The sgRNA targeting AAVS1 transcription start site (TSS) region was used as control (AAVS1 sg: CGGAACCTGAAGGAGGCGGC). The sgRNAs were cloned into a lentiviral vector expressing GFP and later packaged into VSV-G pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and pVSV-G plasmids into HEK293T cells. Meanwhile, the KRAB-dCas9-P2A-mCherry (Addgene, #60954) vector was also packaged by cotransfection with pCMVR8.74 and pVSV-G plasmids. Huh7 cells were then transduced with both pseudotyped lentiviral vectors that express sgRNA and KRAB-dCas9-P2A-mCherry. Three days after transduction, the GFP and mCherry double-positive cells were sorted by FACS and further cultured. The knockdown efficiency of TRIM26 was measured by Western blot.

Oligonucleotides (TRIM26 oligo F: ACCGTGTGGCAACTGGCCAGCCTGG and TRIM26 oligo R: AAACCCAGGCTGGCCAGTTGCCACA) of TRIM26 sgRNA were synthesized (Ruibiotech) and annealed in 50 l of TransTaq HiFi Buffer II at a final concentration of 9 M. The annealed oligos were ligated into a lentiviral vector bearing a puromycin selection marker with Golden Gate Assembly (NEB). The ligation products were then transformed into Trans1-T1 competent cells (Transgen, CD501). Pseudotyped lentiviral vectors expressing sgRNA were generated by cotransfection of a vector expressing the VSV-G, pCMVR8.74 (containing lentiviral gal/pol), and the lentiviral vector expressing sgRNAs. Huh7.5.1 cells were transduced with the pseudotyped lentiviral vectors expressing sgRNA and selected with puromycin (1 g/ml). The single-cell clones resistant to puromycin were selected. Genomic DNA were extracted from the single-cell clones, and the insertions and deletions (indels) caused by sgRNA/Cas9 in each cell clone were confirmed by Sanger sequencing after PCR amplification.

The protocols and sequences of primers for quantifying HCV RNA, human IFN-, MxA, ISG56, and actin were described previously (34). The cells were lysed in TRIzol (Tiangen), and RNA was isolated according to the manufacturers protocol. The cDNA was synthesized using the ReverTra Ace qPCR RT kit (Toyobo). RT-qPCR was performed using quantitative PCR SYBR green RT-PCR master mix (Toyobo). The sequences of the primers targeting DENV and ZIKV were as follows: ZIKV, CAACTACTGCAAGTGGAAGGGT (forward) and AAGTGGTCCATATGATCGGTTGA (reverse); DENV, ACAAGTCGAACAA CCTGGTCCAT (forward) and GCCGCACCATTGGTCTTCTC (reverse). The expression of target genes was normalized to actin.

The JC1-GLuc virus was constructed as previously described (44). The GLuc gene and an autocleaving peptide 2A were inserted between p7 and NS2 of the JC1 cDNA clone. HCVcc, ZIKV, and DENV preparation and titration were as previously described. Briefly, 1 105 Vero cells were seeded in a 24-well plate for 24 hours, then washed with phosphate-buffered saline (PBS), and infected with the serially diluted ZIKV for 1 hour. Viral inoculations were replaced with 1.2 ml of DMEM containing 1.5% fetal bovine serum and 1% carboxymethyl cellulose sodium salt. Viral plaques were developed at day 4 after infection. Huh7.5.1 (1 104) cells were seeded in a 96-well plate and infected with serially diluted DENV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against DENV envelope protein (clone D1-4G2-4-15; Millipore) followed by incubation with Alexa Fluor 488conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HCVpp were generated as previously described (22). HEK293T cells were cotransfected with plasmids expressing HCV envelope glycoproteins, retroviral core packaging component, and luciferase. Supernatants were collected 72 hours later and filtered through 0.45-M pore size membranes. For infection, targeted cells were seeded in 96-well plates and infected with HCVpp. At 72 hours after infection, the firefly luciferase activity was measured by luciferase assay according to the manufacturers instructions (Promega).

HEK293T cells were cotransfected with indicated plasmids and lysed in NP-40 buffer containing 50 mM tris-HCl (pH 7.5), 150 mM NaCl, and 0.5% NP-40, with protease inhibitor (Sigma-Aldrich) at 48 hours after transfection. The cell lysates were centrifuged at 10,000g at 4C for 10 min, and supernatants were transferred to new tubes and incubated with normal immunoglobulin G (Santa Cruz Biotechnology) as well as protein A/G agarose beads at 4C for 30 min to eliminate nonspecific binding proteins. After centrifugation at 1000g at 4C for 5 min to remove the protein A/G agarose beads, the supernatants were incubated overnight with specific primary antibody at 4C and then with protein A/G agarose beads for an additional 2 hours. The samples were collected by centrifugation at 1000 g at 4C for 5 min, washed with NP-40 buffer for four times, and then resuspended in 40 l of loading buffer for Western blot.

The protocol was as described previously (34). The following antibodies were used: anti-FLAG (Sigma-Aldrich); anti-HA and anti-actin (Abmart); anti-TRIM26 antibody, goatanti-mouse horseradish peroxidase (HRP) antibody, and goatanti-rabbit HRP antibody (Santa Cruz Biotechnology); monoclonal antibodies against HCV NS3 and NS5A (generated by J. Zhongs laboratory); and anti-DENV E protein (D1-11, Abcam).

The protocol was as described previously (45). A BioLux Gaussia luciferase assay kit (NEB) was used to measure the GLuc activity.

Hep561D7A7 cells (1 104) were seeded in a 96-well plate and infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HEK293T cells transfected with the indicated plasmids were seeded on 14-mm-diameter glass coverslips for 48 hours. The cells were washed with PBS and fixed with paraformaldehyde for 1 hour. Then, the cells were incubated with the primary antibody for 1 hour followed by incubation with the secondary antibody conjugated with Alexa Fluor 488 (Invitrogen) or Alexa Fluor 555 (Invitrogen). Images were acquired with an Olympus FV1200 laser scanning confocal microscope (Olympus, Tokyo, Japan) and analyzed using ImageJ software. Pearsons coefficiency functioned as the indicator of colocalization.

Huh7 and Huh7-TRIM26 knockdown cells were seeded in a 96-well plate for 72 hours. Then, luminescent signal was acquired for cell viability analysis using the CellTiter-Glo 2.0 assay.

Hep561D7A7, Hep561D7A7-hTRIM26, and Huh7 cells were infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with permeabilization buffer. Next, the cells were incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody. The cells were analyzed by flow cytometry. For each staining, at least 5000 events were collected for analysis. The FlowJo software was used for HCV-positive cell analysis.

Statistical analysis was performed using GraphPad Prism 8 software. Students t test was used for analyzing the difference between two groups, and one-way analysis of variance (ANOVA) followed by Tukey post hoc test was used for analyzing the differences among groups of more than three. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Acknowledgments: Funding: This study was supported by the grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB29010205, to J.Z.); the National Natural Science Foundation of China (31670172, to J.Z.; 31930016, to W.W.; 31670169, to Z.Z.; and 31770189, to Y.T.); the support from Beijing Municipal Science and Technology Commission (Z181100001318009), the Beijing Advanced Innovation Center for Genomics at Peking University, and the Peking-Tsinghua Center for Life Sciences to W.W.; the West Light Foundation of the Chinese Academy of Sciences (xbzg-zdsys-201909) to J.Z.; and the Natural Science Foundation of Guangdong Province (2019A1515110668) to G.Z. Author contributions: J.Z., W.W., and G.Z. conceived and designed the study. Y.L., G.Z., and Q.L. designed, performed, and analyzed the experiments. L.H. and Y.X. contributed to the DENV and ZIKV infection experiments. Y.G. and G.Z. performed the bioinformatics analysis. X.H., X.Z., and Q.D. contributed to the establishment of murine hepatoma cells. W.T., M.G., T.G., Y.T., and Z.Z. participated in data analysis. Y.L. and G.Z. drafted the manuscript. All authors contributed to and revised the final version of the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original post:
TRIM26 is a critical host factor for HCV replication and contributes to host tropism - Science Advances

Four Predictions for the Future of Food in 2021 – The Spoon

It goes without saying that 2020 was a challenging year for the food industry. A worldwide pandemic that wreaked havoc on food supply chains, forced the permanent closure of thousands of restaurants worldwide, and pushed millions of people deeper into food insecurity showed us just how fragile the systems that keep us nourished and fed are.

But its also the recognition of this fragility thats led to an increasing sense of urgency to invest in the future of food. The good news is the timing couldnt be better. We are at a culmination point in the fields of bioengineering, chemistry and food science where decades of hard work and progress have allowed ideas that once seemed the domain of science fiction to leap into the labs and, now and in the not-to-distant future, onto our plates.

And while 2020 was a year of unprecedented progress across our food system, I expect 2021 to be even more impactful. Below are four predictions for some of what we could see this year.

Cultured Meat Milestones Will Accelerate

Throughout 2020, announcements of milestones for cultured meat flowed with increasing regularity. New prototypes of practically every type of meat ranging from chicken to beef to kangaroo debuted, heads of state and other famous folks got their first tastes of lab-grown meat, and at the end Eat Just announced the first regulatory approval and retail sale of cultured chicken in Singapore.

And well see even more milestones this year. Investment will grow and excitement will build as more companies move out of the labs and into early pilot production facilities for their cultured meat products. Other countries will follow Singapores lead and give regulatory green light for the sale of cultured meat. And finally, well see the debut of more cultured meat products in high-end cuisine as chefs look to achieve similar firsts for their restaurants. We may even see the rollout of cultured meat in some select experiential, high-end retail.

Fermentation Powers Growth in Exciting New Consumer-Facing Products

One of the of most exciting areas in the future of food is microbial fermentation. High-volume production of interesting new biomass proteins such as mycelium-based meat replacements and the arrival of animal-free proteins, fats and other compounds created using precision fermentation helped illustrate why the Good Food Institute called fermentation the third leg of the alternative protein market.

Looking forward, you can expect lots of new products to debut powered by precision fermentation in 2021. MeliBio, a maker of bee-free honey, expects to debut their first product in 2021, while Clara Foods plans to release its animal-free egg this year as well, and I expect to see more companies like Brave Robot rise up and offer new products built around precision fermented food platforms created by companies like Perfect Day.

CRISPR and Gene-Edited Food See Accelerated Product Pipelines

There was big news in the CRISPR and gene-edited food realm in December when the USDA proposed a change in the regulatory oversight of gene-edited animals for human consumption. The organization proposed that they take over oversight responsibility for approving gene-edited animal products from the FDA which, in 2018, famously declared that gene-edited animals should be regulated in the same manner as drugs.

Under a new USDA regulatory framework, the organization is proposing a fairly light regulatory approach to animals compared to the previous oversight of the FDA, which in turn could speed up time to market for new products. While there has been lots of focus on CRISPR-derived future food innovation, I expect changes to US regulatory oversight of gene-edited animal products to create a wave of new interest in developing CRISPR-based product lines from both startups and established food product companies.

Finally, the US may not be the only market to see a change in oversight for gene-edited food. The UK is looking to extract itself from the heavier-handed oversight of the EU post-Brexit, and some in Europe are suggesting that the EUs classification of all gene-edited food as GMO might be overbroad and need adjusting.

3D Food Printing Moves Beyond the Cake

While 3D food printing has largely been relegated to the world of confections and cake decorating, a world with food replicators from the pages of science fiction novels seems to be inching closer to reality.

Companies like Redefine Meat are making high-volume plant-based meat printers and plan to have meat in supermarkets in a year, while others like Meat-Tech are showing off prototypes of cultured meat printers. One of the challenges for food printing will be scaling the technology to make it quicker, something Novameat is working on as it begins to enter commercial rollout phase of its plant-based meat printing technology. On the consumer front, while I dont expect the food printers to start printing out Jamie Oliver recipes this year, companies like Savoreat are working on commercializing products for the professional space with the end-goal of eventually creating a home consumer food printer like the one you might see in a show like Upload.

Finally, these advances and technologies do not happen in a vacuum. The future of food is reliant on a multitude of new innovations and technologies. CRISPR, precision fermentation and 3D food printing are just some of the tools being interwoven and utilized together to help bring innovative new products to cultured, plant-based and other emerging food markets.

While we dont know what 2021 will hold for us with any certainty, what we can be certain of is that progress in these important building blocks for the future of food will continue to march forward.

Related

Read more:
Four Predictions for the Future of Food in 2021 - The Spoon

Why CRISPR Therapeutics, Editas Medicine, and Intellia Therapeutics Stocks Are Sinking Today – The Motley Fool

What happened

CRISPR gene-editing stocks are being hit hard by a broader biotech sell-off on Tuesday. Shares of CRISPR Therapeutics (NASDAQ:CRSP) were down 9.1% as of 12:05 p.m. EST. Editas Medicine (NASDAQ:EDIT) stock had declined 13.7%, while Intellia Therapeutics (NASDAQ:NTLA) shares had slumped 11.4%.

There wasn't a clear reason behind today's rout of biotech stocks. The biggest negative story in the biopharmaceutical industry centered on Arcturus Therapeutics' disappointing early-stage results for its single-dose COVID-19 vaccine candidate.

Image source: Getty Images.

CRISPR Therapeutics, Editas, and Intellia tend to be more volatile than most stocks. None of the companies have products on the market yet. Their valuations are based solely on investors' optimism about their future prospects. When that optimism wanes, the stocks sink.

It's important to keep in mind, though, that nothing has actually changed about the prospects for any of these three gene-editing biotechs. In many ways, those prospects are as strong as they've ever been.

CRISPR Therapeutics and its big partner, Vertex Pharmaceuticals, reported encouraging new data earlier this month for experimental gene-editing therapy CTX001 in treating rare genetic blood disorders beta-thalassemia and sickle cell disease. Editas also announced positive preclinical data for its candidate targeting the same diseases a few weeks ago and filed for U.S. regulatory clearance to begin a phase 1 clinical study in treating sickle cell disease. Intellia presented promising preclinical data in early December for its experimental gene-editing therapies targeting acute myeloid leukemia (AML) and rare genetic disease alpha-1 antitrypsin deficiency.

Each of these stocks is falling today based on no news directly related to their businesses or pipelines. That creates a buying opportunity for investors who remain confident about each company's direction.

What really matters for these three biotechs is the clinical progress for their respective pipeline candidates. And key developments are on the way for all three companies.

CRISPR Therapeutics expects to report additional data from early-stage studies of immuno-oncology candidates CTX110, CTX120, and CTX130 in 2021. Editas hopes to begin a phase 1 study evaluating EDIT-301 in treating sickle cell disease and continue patient enrollment in a phase 1 study of EDIT-101 in treating eye disease Leber congenital amaurosis type 10 (LCA10) in the new year. Intellia anticipates submitting for regulatory clearance to begin early-stage studies of NTLA-5001 in treating AML and for NTLA-2002 in treating hereditary angioedema next year.

View original post here:
Why CRISPR Therapeutics, Editas Medicine, and Intellia Therapeutics Stocks Are Sinking Today - The Motley Fool

Should Crispr Therapeutics AG (CRSP) be in Your Portfolio? – InvestorsObserver

The 65 rating InvestorsObserver gives to Crispr Therapeutics AG (CRSP) stock puts it near the top of the Biotechnology industry. In addition to scoring higher than 80 percent of stocks in the Biotechnology industry, CRSPs 65 overall rating means the stock scores better than 65 percent of all stocks.

Searching for the best stocks to invest in can be difficult. There are thousands of options and it can be confusing on what actually constitutes a great value. Investors Observer allows you to choose from eight unique metrics to view the top industries and the best performing stocks in that industry. A score of 65 would rank higher than 65 percent of all stocks.

This ranking system incorporates numerous factors used by analysts to compare stocks in greater detail. This allows you to find the best stocks available in any industry with relative ease. These percentile-ranked scores using both fundamental and technical analysis give investors an easy way to view the attractiveness of specific stocks. Stocks with the highest scores have the best evaluations by analysts working on Wall Street.

Crispr Therapeutics AG (CRSP) stock is down -4.15% while the S&P 500 is higher by 0.12% as of 10:57 AM on Tuesday, Dec 29. CRSP is down -$7.01 from the previous closing price of $168.93 on volume of 2,016,389 shares. Over the past year the S&P 500 has risen 16.09% while CRSP is higher by 161.84%. CRSP lost -$3.25 per share the over the last 12 months.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

View original post here:
Should Crispr Therapeutics AG (CRSP) be in Your Portfolio? - InvestorsObserver

Can CRISPR Save Florida Citrus? – AG INFORMATION NETWORK OF THE WEST – AGInfo Ag Information Network Of The West

Here with your Southeast Regional Ag Report, Im Tim Hammerich.

Its nearly impossible to talk about the Florida citrus industry in 2020, without at least mentioning citrus greening disease. Otherwise known as huanglongbing, citrus greening is spread by the asian citrus psyllid which serves as a vector for the disease.

Citrus greening has done enormous damage to the Florida citrus industry despite years of research to try to develop effective management tools. Scientists are now hopeful that CRISPR can help. The tool for editing genomes, allows breeders to select for very specific traits, and iterate more quickly.

And they have a roadmap to follow. CRISPR has been used to develop resistant varieties to citrus canker. A program started in 2013 was able to identify the citrus canker susceptibility gene in 2014, and through CRISPR found a way to knock out this susceptibility gene. They have now made, this year, citrus varieties that are resistant to citrus canker.

Dr. Nian Wong, professor at the Citrus Research at Education Center for the University of Florida IFAS at Lake Alfred, says they were able to make progress on citrus canker much quicker than traditional breeding, and he hopes this can also be applied to citrus greening.

While there can be no guarantees on timing, Dr. Wong hopes that progress can be made on citrus greening on a similar timeline to what theyve been able to do these past seven years with citrus canker.

Original post:
Can CRISPR Save Florida Citrus? - AG INFORMATION NETWORK OF THE WEST - AGInfo Ag Information Network Of The West

2020: The year science took centre-stage – The Hindu

Apart from new findings on coronavirus every single day, the year was also filled with stories from outer space, archeology and anatomy

The year 2020 also termed as the year of the pandemic, social distancing, work from home, was also the year of research at breakneck speed. Virologists, immunologists, computational biologists, epidemiologists, and medical professionals across the globe turned into superheroes without capes.

Quick sequencing of the whole genome of the novel coronavirus (SARS-CoV-2) helped develop various test kits. We now have not one or two, but multiple COVID-19 vaccines that have succeeded in human clinical trials. Moderna's and Pfizer-BioNTechs vaccines that use messenger RNA have reported efficacy of about 95%, and the United Kingdom, the United States and the United Arab Emirates have already launched mass vaccinations.

Apart from new findings on coronavirus every single day, the year was also filled with stories from outer space, archeology and anatomy. Here is a list of a few of them in random order

In October, NASA confirmed, for the first time, water on the sunlit side of the Moon indicating that water may be distributed across the moons surface, and not limited to the cold and shadowed side.

Researchers from the Netherlands Cancer Institute announced in October that they have discovered a new pair of salivary glands hidden between the nasal cavity and throat. The team proposed the name tubarial glands and noted that this identification could help to explain and avoid radiation-induced side-effects such as trouble during eating, swallowing, and speaking.

In September, an international scientific team announced that they have spotted phosphine gas on Venus. On Earth, microorganisms that live in anaerobic (with no oxygen) environments produce phosphine. Massachusetts Institute of Technology molecular astrophysicist and study co-author Clara Sousa-Silva said in a release, This is important because, if it is phosphine, and if it is life, it means that we are not alone. It also means that life itself must be very common, and there must be many other inhabited planets throughout our galaxy.

Read our detailed explainer here.

In March, a person suffering from Leber congenital amaurosis, a rare inherited disease that leads to blindness, became the first to have CRISPR/Cas-9-based therapy directly injected into the body.

In June, two patients with beta-thalassemia and one with sickle cell disease had their bone marrow stem cells edited using CRISPR techniques.

Click here to read our explainer on the genome-editing tool that won this years Nobel Prize for Chemistry.

The year 2020 marks 100 years of discovery of Indus Valley Civilisation, and a new study showed that dairy products were being produced by the Harappans as far back as 2500 BCE.

Another study found the presence of animal products, including cattle and buffalo meat, in ceramic vessels dating back about 4,600 years.

Chinas Change-5 probe brought back about 1,731 grams of samples from the moon becoming the third country to bring moon samples after the U.S and Soviet Union.

Also, Japans Hayabusa 2 brought back the first extensive samples from an asteroid. The spacecraft, launched from Japan's Tanegashima space centre in 2014, took four years to reach the asteroid Ryugu before taking a sample and heading back to Earth in November 2019.

Mars rover Perseverance blasted off for the red planet on July 30 to bring the first Martian rock samples back to Earth. If all goes well, the rover will descend to the Martian surface on February 18, 2021.

You have reached your limit for free articles this month.

Find mobile-friendly version of articles from the day's newspaper in one easy-to-read list.

Enjoy reading as many articles as you wish without any limitations.

A select list of articles that match your interests and tastes.

Move smoothly between articles as our pages load instantly.

A one-stop-shop for seeing the latest updates, and managing your preferences.

We brief you on the latest and most important developments, three times a day.

Support Quality Journalism.

*Our Digital Subscription plans do not currently include the e-paper, crossword and print.

Excerpt from:
2020: The year science took centre-stage - The Hindu

Archives