Archive for March, 2024
Genomic insights into familial adenomatous polyposis: unraveling a rare case with whole APC gene deletion and … – Nature.com
Familial adenomatous polyposis (FAP) is an autosomal dominant disorder resulting from germline mutations in the APC gene. The APC gene, comprising 15 exons and encoding a protein with 2843 amino acids, is implicated in ~80% of FAP cases1. Extensive genetic analysis has revealed germline variants in FAP patients, and most APC mutations are found in the 5 half of the coding region. Genotypephenotype correlations have been reported for small-nucleotide alterations, including frameshift and nonsense mutations2,3. Large genomic deletions and duplications have been identified using multiplex ligation-dependent probe amplification (MLPA)4. Whole-genome array comparative genomic hybridization (aCGH) was used to identify a large deletion involving the middle portion of the long arm of chromosome 55. Here, we report a case of an FAP patient with intellectual disability that was attributed to a large deletion involving 5q22.2.
The proband was a 28-year-old female who was referred to the emergency hospital with acute abdominal pain. Computed tomography (CT) demonstrated perforation of the descending colon, multiple colorectal polyps, multiple liver metastases and lymph node swelling. She underwent left hemicolectomy, and the subsequent histological diagnosis was moderately differentiated adenocarcinoma (pT4a, pStage IVa). Chemotherapy was selected for treatment of the residual metastasis. Colonoscopy revealed advanced colon cancer with multiple adenomatous polyps (>100). Head CT revealed an osteoma in her skull, and the phenotype was subsequently defined as Gardners syndrome.
The patient had slight intellectual disability without developmental delay or neurogenic abnormalities. She and her mother requested comprehensive genomic panel (CGP) analysis (OncoGuideTM NCC oncopanel, Sysmex, Hyogo, Japan) of surgically resected colon cancer tissue after providing informed consent. This test can detect mutations in 124 genes and differentiate between germline and somatic mutations. The pathogenic mutations detected were KRAS G13D, PIC3CA H1047R, and TP53 M169fs*2, but no targeted therapy was recommended by the expert panel. No germline findings were reported, but whole APC gene deletion was suspected due to the low amplicon depth of the APC gene in both the tumor tissue and blood samples (Fig. S1).
According to her familial history (Fig. 1), her mother (II-3) was treated for sporadic colon cancer. She refused genetic testing due to receiving cancer chemotherapy. Her son (IV-1), whose intelligence was slightly low, had a single-parent history because his father was not identified.
The arrow indicates the patients who underwent genetic counseling. A closed circle indicates an individual with colorectal cancer. Colorectal polyposis was observed in the proband (III-1) but not in her ancestors.
After genetic counseling, aCGH (GenetiSure Dx Postnatal Assay, Agilent, Tokyo, Japan) was performed for further genetic testing. Notably, aCGH revealed the loss of chromosome 5 (chr5) q22.1-q22.2 (Fig. 2), the loss of chr3 p24.1-p23, and the gain of chr15 q15.3. The chr5 deletion included the entire APC gene (chr5:112043195-112181936 in GRCh37) located at 5q22.2 (Fig. S2), according to the Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources (DECIPHER, https://www.deciphergenomics.org).
A heterozygous 5q22 deletion was detected. The minimal and maximal deletion positions in GRCh37 (start_stop) were 111143360_112213143 and 111118900_112239978, respectively.
This case in which the entire APC gene was deleted, as determined by aCGH, is rare. Chromosome 5p22.1-22.2 deletion causes 1Mb of heterozygous loss, including the APC gene, which was reported as a cytogenetically detected deletion in previous reports. Previously, karyotyping and fluorescence in situ hybridization were used to detect large submicroscopic genomic deletions, and aCGH was used to detect high-resolution copy number variants in whole chromosomes6. aCGH is sensitive and comprehensive, allowing detection of multiple variations, and annotations by specialists are needed. DECIPHER catalogs common copy number changes, enabling the identification of potentially pathogenic variants. aCGH can also be used for sequencing targeted genes. For FAP patients, germline APC variants are identified by direct sequencing using next-generation sequencing (NGS) and MLPA5. Sequencing has been used to detect APC gene variants, but ~20% of FAP patients do not carry these variants. MLPA is useful for detecting whole or large APC gene copy number variants in mutation-negative FAP patients. There are several case reports in which germline variants of FAP were examined via aCGH7,8,9,10.
Our young patient with advanced colon cancer derived from multiple colorectal polyposis was diagnosed with FAP according to the clinical features. A CGP was performed using NGS for cancer precision medicine in this patient. Because metastatic colon cancer is treated by chemotherapy, somatic genomic analysis with CGP was also conducted to determine the optimal chemotherapy regimen. Next, we used NGS to determine the sequence of 100bp amplicons of 124 cancer-related genes from cancer tissue and peripheral blood. A large APC deletion was not detected by this targeted sequence, although both the somatic and germline amplicon depths of the APC gene were slightly low. A large number of APC variants have already been deposited in the ClinVar database (https://www.ncbi.nlm.nih.gov/clinvar/). For several FAP patients in which germline APC variants were not found, investigations of copy number variations have been performed. The genotypephenotype correlation of patients with chromosome 5q deletions has been discussed10. A classical FAP phenotype is associated with a mutation in codons 1681250 or codons 14001580. A severe phenotype is caused by a mutation in codons 12501464. A more attenuated form is associated with mutations in three regions: the 5 region of the APC gene, the alternative splicing region in exon 9, and the extreme 3 end of the gene11.
Whole or partial APC gene deletions can be detected with recently developed genetic techniques9,10,12. MLPA and aCGH are candidates for confirming large deletions or duplications, and the latter genetic test was chosen for our patient. In our patient, two chromosomal losses and one gain were detected. The advantage of chromosomal analysis is that it can reveal unexpected genetic changes even in separate chromosomes. The CGH database includes some patients with large deletions in chromosomal region 5q22, including the APC gene. In a very recent case report, aCGH was utilized to identify a large 19.85Mb deletion12. A case series with a literature review described a patient with intellectual disability and a colon neoplasm with an interstitial deletion of 5q identified by aCGH. Colorectal cancers are observed in some patients with 5q deletions, yet examination of colorectal polyposis in this context is limited. Among the primary dysmorphisms and symptoms linked to 5q deletions, the predominant manifestation identified in the analysis of 12 patients was mental retardation12. The cases documented in both the literature and the DECIPHER database are characterized by common clinical features, including predisposition to cancer, intellectual disability, and neurodevelopmental delay. Patients with these congenital changes should undergo genetic testing, including G-band, fluorescence in situ hybridization (FISH), and aCGH. aCGH offers high resolution, allowing for the detection of changes at the chromosomal level. This high sensitivity is particularly valuable when conventional methods, such as karyotyping or FISH, may not provide detailed information about genomic alterations. Moreover, this approach allows researchers and clinicians to explore potential genetic factors beyond the well-known APC genes. In the near future, long-read sequencing of large deletions may enable us to obtain detailed genomic information13. Additional clinical information is needed to establish the genotypephenotype correlations associated with the 5q22.2 deletion that includes the whole APC gene. The published cases have raised the question of whether whole APC deletion induces colorectal polyposis. Casper et al. reported a case of Gardner syndrome attributable to a substantial interstitial deletion of chromosome 5q, offering a comprehensive review of published cases9. Until 2014, 16 patients with FAP resulting from chromosome 5q deletions were documented, with all but one patient presenting with classic adenomatous polyposis rather than the profuse form. Most of these deletions were de novo alterations, consistent with our reported case in which the patients mother (II-3) exhibited sporadic colon cancer without polyposis. In the familial lineage (Fig. 1), our patients son (IV-1) carried a deletion in the 5q22.1-22.2 region, mirroring the genomic alteration of his mother (III-1). However, the genetic inheritance pattern of this large deletion is unclear. Meticulous follow-up of the young boy is important for addressing this issue.
In conclusion, this study describes a rare FAP patient characterized by a large deletion of chromosome 5q22.1-22.2 identified through comprehensive genomic analysis. The genetic variant was suspected by CGP and eventually identified by aCGH. These findings emphasize the importance of advanced genetic techniques in identifying complex genomic variations and suggest a need for additional research to elucidate the specific features associated with whole-APC gene deletions.
Genetic Analysis Market Size to Attain Around USD 23.60 BN by 2033 – BioSpace
The global genetic analysis market was evaluated at USD 10.55 billion in 2023 and is expected to attain around USD 23.60 billion by 2033, growing at a CAGR of 8.39% from 2024 to 2033. The increasing demand for genetic testing services is driving growth within the genetic analysis market.
Market Overview
The genetic analysis market is experiencing significant transformation due to advances in genetic technology, which are fundamentally changing perceptions and practices within the healthcare industry. At the heart of this transformation lies the process of genetic analysis, which involves the examination of DNA samples to identify mutations that may influence disease susceptibility or treatment response. This analysis is pivotal for understanding the structure and function of genes, with techniques such as gene cloning playing a crucial role in isolating and replicating specific genes for detailed examination.
Get report sample pages@ https://www.precedenceresearch.com/sample/3922
One notable aspect of genetic analysis is its diverse clinical applications. It serves as a diagnostic tool, aiding in the confirmation of diagnoses in symptomatic individuals, while also facilitating the monitoring of disease prognosis and treatment response. Additionally, genetic analysis enables predictive or predisposition testing, allowing for the identification of individuals at risk of developing certain diseases before symptoms manifest.
The emergence of predictive genetic testing is creating new market opportunities, as it enables proactive disease prevention strategies and early interventions. As perceptions regarding genetic testing continue to evolve, the market for genetic analysis is expected to witness sustained growth, driven by its potential to revolutionize patient care and improve health outcomes.
Key Insights
Get full access of this report@ https://www.precedenceresearch.com/checkout/3922
North America to sustain its position in the upcoming years with the U.S. being largest contributor
In 2023, North America emerged as the dominant force in the genetic analysis market, particularly in the United States. The US showcased a robust infrastructure with 200 laboratories actively conducting 37,124 clinical tests, underscoring the region's significant investment and adoption of genetic analysis technologies. Notably, 29 laboratories specialized in whole exome sequencing (WES), while 17 laboratories focused on whole genome sequencing (WGS), indicating a wide array of genetic testing capabilities available within the country.
The United States exhibits a proactive approach towards healthcare, as evidenced by mandatory newborn screening programs targeting a specific set of genetic diseases. Although the exact set of diseases screened may vary from state to state, the emphasis remains on conditions where early diagnosis is crucial for effective treatment or prevention strategies. This regulatory framework underscores the importance placed on leveraging genetic analysis for proactive healthcare management and disease prevention initiatives.
Beyond clinical applications, genetic analysis in North America extends to ecological and environmental contexts. The presence of invasive species such as Phragmites australis subsp. australis poses ecological challenges across multiple regions. The co-occurrence of this invasive subspecies with native counterparts and instances of hybridization necessitates precise differentiation methods for effective management strategies. Genetic analysis plays a pivotal role in distinguishing between phragmites subspecies or haplotypes, facilitating targeted management efforts to mitigate ecological harm and preserve native ecosystems.
Asia Pacific to witness lucrative opportunities in the upcoming years
Asia Pacific emerges as a pivotal region poised for substantial growth in the genetic analysis sector, driven by dynamic developments in genetic counselling and genome mapping initiatives. Forecasts indicate that Asia Pacific will experience the fastest growth rate in the genetic analysis market during the forecast period, underscoring the region's significance in shaping the future of genetic healthcare services.
A recent milestone in the region's genetic counselling landscape is the establishment of the Professional Society of Genetic Counsellors in Asia (PSGCA). Formed as a special interest group of the Asia Pacific Society of Human Genetics, PSGCA aims to spearhead the advancement and integration of the genetic counselling profession across Asia. With a vision to become the premier organization driving genetic counselling mainstream adoption in the region, PSGCA endeavors to ensure equitable access to genetic counselling services for individuals. Its mission centers on elevating standards of practice, curriculum, research, and continuing education to promote quality genetic counselling services throughout Asia.
The rapid evolution of genetic and genomic technologies has significantly transformed healthcare services in low- and middle-income countries (LMICs) across the Asia-Pacific region. Initially focused on population-based disease prevention strategies, genetic services have transitioned towards clinic-based and therapeutics-oriented approaches. Notably, the region's genetic diversity, exemplified by populous and genetically varied countries such as China, India, Japan, and Indonesia, positions them as prime candidates for genome mapping research endeavors.
How the genetic analysis market in Asia Pacific
Report Highlights
By Product
The reagents & kits segment asserted dominance in the genetic analysis market in 2023. DNA reagents play a pivotal role in various DNA-related processes and techniques, including sequencing, synthesis, cloning, and mutagenesis. These products encompass a diverse range, such as plasmids, buffers, labeling technology, columns, and comprehensive test kits utilized in DNA testing, including direct-to-consumer (DTC) genetic tests. While offering accessible information about the scientific basis of tests, the usage of DTC genetic tests carries inherent risks due to the absence of personalized guidance concerning the results.
The instruments segment emerged as the fastest-growing sector within the genetic analysis market. Core laboratory instruments constitute essential tools in genetic engineering research, facilitating precise and reliable experimentation. Polymerase Chain Reaction (PCR) machines, also known as thermal cyclers, stand as indispensable equipment in genetic engineering labs, enabling the amplification of specific DNA segments crucial for detailed analysis.
By Test
In 2023, the disease diagnostic testing segment emerged as the dominant force in the genetic analysis market. This segment specializes in identifying whether individuals harbor specific genetic diseases by detecting alterations in particular genes. While these tests excel at pinpointing gene mutations, they often fall short in determining disease severity or age of onset. Thousands of diseases stem from mutations in a single gene, making diagnostic testing pivotal in confirming or ruling out genetic diseases and chromosomal abnormalities. Frequently utilized during pregnancy or when symptomatic, diagnostic genetic testing offers crucial insights for accurate diagnosis and timely intervention.
The prenatal and newborn testing segment emerged as the fastest-growing sector in the genetic analysis market during the forecast period. Prenatal genetic testing provides prospective parents with vital information regarding potential genetic disorders in the fetus. Prenatal screening tests assess the likelihood of fetal aneuploidy and select disorders, while prenatal diagnostic tests definitively ascertain the presence of specific disorders. These tests, conducted on fetal or placental cells obtained through procedures like amniocentesis or chorionic villus sampling (CVS), play a pivotal role in informed decision-making during pregnancy.
Newborn screening, a subset of prenatal and newborn testing, comprises a set of laboratory tests performed on newborns to detect known genetic diseases. Typically conducted via a heel prick within the first few days of life, newborn screening enables early identification and intervention for treatable genetic conditions, thereby improving health outcomes. As the demand for early detection and preventive measures rises, the prenatal and newborn testing segment is poised for continued growth, bolstering the comprehensive landscape of genetic analysis.
By Technology
In 2023, the real-time PCR system segment emerged as the dominant force in the genetic analysis market. Real-time PCR (RT-PCR) systems offer unparalleled capabilities for quantitative genotyping and detection of single nucleotide polymorphisms (SNPs), allelic discrimination, and genetic variations even in samples with minimal mutation carriers. Multiplex PCR systems, a subset of RT-PCR, are gaining prominence, particularly in plant/microbe associations, where standard PCR methods prove inadequate. Multiplex RT-PCR facilitates the identification of multiple genes through the utilization of fluorochromes and analysis of melting curves, providing enhanced accuracy and efficiency in genetic analysis.
The next-generation sequencing (NGS) segment emerged as the fastest-growing sector in the genetic analysis market. NGS technology revolutionizes DNA sequencing and RNA sequencing and variant/mutation detection by enabling high-throughput sequencing of hundreds to thousands of genes or whole genomes within a short timeframe. The sequence variants/mutations detected by NGS hold profound implications for disease diagnosis, prognosis, therapeutic decision-making, and patient follow-up, paving the way for personalized precision medicine initiatives.
By Application
In 2023, the infectious diseases segment asserted dominance in the genetic analysis market, offering molecular genetic tests capable of identifying common viruses or bacteria responsible for respiratory infections and infectious diarrhea. These tests, conducted on samples collected from the nose and throat or a single stool sample, facilitate rapid and accurate diagnosis, enabling timely treatment and containment of infectious outbreaks.
The genetic diseases segment emerged as the fastest-growing sector in the genetic analysis market during the forecast period. The extent to which genes contribute to diseases varies, presenting opportunities for advancements in understanding genetic mechanisms underlying various conditions. This progress facilitates the development of early diagnostic tests, novel treatments, and preventive interventions to mitigate disease onset or severity.
By End Use
In 2023, the research & development laboratories segment emerged as the dominant force in the genetic analysis market, actively driving advancements in genetic disease study and testing technology. These laboratories are pivotal in enhancing clinical patient care by conducting rigorous research and development activities aimed at improving test strategies and introducing novel genetic tests. Board-certified directors and genetic counsellors collaborate closely with laboratory supervisors and technologists to ensure the delivery of accurate and reliable results within stipulated timelines. With a focus on meeting stringent validation standards, approved tests undergo thorough evaluations of methodology and clinical utility. Research programs within these laboratories leverage collective expertise to propel the field of genetics and genetic testing forward.
The diagnostic centers segment is poised for significant growth in the genetic analysis market during the forecast period. Diagnostic centers offer a comprehensive range of testing services crucial for diagnosing diverse medical conditions. By providing accurate and informed diagnoses, diagnostic centers enable physicians to develop effective treatment plans, ultimately enhancing patient outcomes. Leveraging advanced diagnostic technologies and techniques, these centers play a vital role in identifying underlying causes of diseases, monitoring disease progression, and devising personalized treatment approaches. Collaborating with healthcare providers like primary care physicians, specialists, and hospitals, diagnostic centers ensure accurate and timely diagnoses across a spectrum of medical conditions, reinforcing their indispensable role in modern healthcare delivery.
Market Dynamics
Driver: Advances in Genetic Sequencing and Gene Therapy
Significant strides in genetic sequencing, human genome analysis, and medical genetics have revolutionized disease understanding, diagnostic accuracy, and drug development targets. A pivotal breakthrough in medical genetics is the emergence of gene therapy, which involves modifying or replacing genes to treat or prevent diseases. Already applied successfully in treating conditions like inherited blindness and severe combined immunodeficiency (SCID), gene therapy is poised to expand its impact further.
Future projections indicate that gene therapy will play an increasingly vital role in medical genetics, offering treatments for previously untreatable diseases. This trajectory is expected to fuel the growth of the genetic analysis market, as the demand for advanced genetic testing and analysis escalates to support the development and implementation of gene therapy treatments.
Restraint: Privacy Concerns in Genetic Analysis
Privacy concerns poses a major challenge in the genetic analysis domain due to the inherent uniqueness of genomic data, hindering true anonymization efforts. Additionally, security measures are crucial to restrict access to data based on authorized clearance levels, safeguarding against unauthorized breaches. Confidentiality emerges as a key ethical consideration, dictating the responsible sharing of genetic data. These privacy concerns, among others, including consent and data ownership, serve as significant restraints in the genetic analysis market. Addressing these challenges effectively is essential to ensure ethical practices and foster trust among stakeholders, thereby mitigating the barriers to market growth.
Opportunity: Integration of Artificial Intelligence in Genetic Analysis
The integration of artificial intelligence (AI) is revolutionizing clinical genetics, offering unprecedented opportunities for advancement. AI algorithms possess the capability to analyse vast volumes of genetic data rapidly and accurately, facilitating more precise diagnoses and tailored treatment plans. Furthermore, AI empowers predictive analysis of disease risk, enabling the development of proactive disease prevention strategies. In genetic engineering and gene therapy research, AI serves as a powerful tool, aiding in hypothesis generation and experimental techniques. Leveraging AI, researchers can detect hereditary and gene-related disorders with greater efficiency.
Moreover, AI-driven developments hold immense promise for rational drug discovery and design, ultimately impacting humanity's well-being. As AI and machine learning (ML) technologies continue to drive innovation in drug development, genetics emerges as a prime beneficiary, with AI expected to influence every facet of the human experience. This presents a compelling opportunity for the genetic analysis market to capitalize on AI-driven advancements and propel transformative growth.
Recent Developments
Key Players in the Clinical Trials Market
Segments Covered in the Report
By Product
By Test
By Technology
By Application
By End-use
By Geography
Get full access of this report@ https://www.precedenceresearch.com/checkout/3922
Contact Us
Call: USA: +1 650 460 3308 | IND: +91 87933 22019 | Europe: +44 2080772818
Email: sales@precedenceresearch.com
Here is the original post:
Genetic Analysis Market Size to Attain Around USD 23.60 BN by 2033 - BioSpace
Bill Introduced in Minnesota Would Increase Access To Genetic Testing – PR Newswire
Susan G. Komen Commends Bill Introduction; Urges Quick Passage
ST. PAUL, Minn., March 28, 2024 /PRNewswire/ --Susan G. Komen, the world's leading breast cancer organization, applauds Representative Patty Acomb (D-Minnetonka) for introducing legislation that would eliminate financial barriers to clinically appropriate genetic testing, as well as the recommended screenings based on the results of that testing.
In Minnesota, more than 5,480 people will be diagnosed with breast cancer and 630 are expected to die of the disease in 2024 alone. In the U.S., 5-10% of breast cancers are related to a known inherited gene mutation. The lifetime risk of breast cancer increases 20-49% for women with moderate risk inherited gene mutations and 50% or more for women with high-risk inherited gene mutations.
HF 5050, introduced by Rep Acomb, eliminates the patient out-of-pocket costs for multi-gene panel testing for inherited gene mutations and evidence-based screenings, ensuring individuals have access to critical information regarding their lifetime cancer risk and recommended early detection and cancer surveillance.
"Passage of this legislation will allow patients to better understand their lifetime cancer risk and access to needed risk reduction and treatment strategies," said Molly Guthrie, Vice President of Policy and Advocacy at Susan G. Komen. "Individuals should have all information needed to make informed decisions about their healthcare without burdensome financial barriers."
Germline testing is a type of test that looks for inherited mutations that have been present in every cell of the body since birth. These tests are conducted via the collection and analysis of blood, saliva or cheek cells. Identification of inherited cancer risk can help guide decisions regarding recommended screenings for the early detection of cancer, personalized cancer treatments and risk-reducing medical treatments.
Studies have shown an estimated 83 percent of eligible patients that underwent multigene panel testing had changes to their medical management, including modifications in follow-up and chemotherapy strategy.
"This legislation will ensure patients have equitable access to information concerning their lifetime risk of cancer, allowing them to make key decisions regarding risk reducing strategies and recommended screenings for early detection," said Rep. Patty Acomb.
According to a 2020 American Association for Cancer Research Report, 65% of young white women with breast cancer were offered genetic testing, while only 36% of young Black women with breast cancer were offered the same test options. Additional studies show that minority patients were more likely to utilize genetic testing following a cancer diagnosis but less likely following a family history of cancer, resulting in a missed opportunity for mutation detection and cancer prevention for these patients.
About Susan G. KomenSusan G. Komen is the world's leading nonprofit breast cancer organization, working to save lives and end breast cancer forever. Komen has an unmatched, comprehensive 360-degree approach to fighting this disease across all fronts and supporting millions of people in the U.S. and in countries worldwide.We advocate for patients, drive research breakthroughs, improve access to high-quality care, offer direct patient support and empower people with trustworthy information. Founded by Nancy G. Brinker, who promised her sister, Susan G. Komen, that she would end the disease that claimed Suzy's life, Komen remains committed to supporting those affected by breast cancer today, while tirelessly searching for tomorrow's cures. Visit komen.org or call 1-877 GO KOMEN. Connect with us on social at http://www.komen.org/contact-us/follow-us/.
CONTACT: Amanda DeBard Susan G. Komen (972) 701-2131 [emailprotected]
SOURCE Susan G. Komen for the Cure
See the original post:
Bill Introduced in Minnesota Would Increase Access To Genetic Testing - PR Newswire
Genetic variation passed down through generations may influence cancer development – Baylor College of Medicine | BCM
Genes affected by germline structural variation could conceivably influence cancer risk.
Researchers at Baylor College of Medicines Dan L Duncan Comprehensive Cancer Center and Human Genome Sequencing Center investigated the extent to which forms of genetic variation called germline or inherited structural variation (SV) influence gene expression in human cancers.
Structural variation is one type of genomic variation and can be beneficial, neutral or, if it affects functionally relevant regions of the genome, can seriously affect gene function and contribute to disease, including cancer, said corresponding author Dr. Chad Creighton, professor ofmedicineand co-director of cancer bioinformatics at theDan L Duncan Comprehensive Cancer Centerat Baylor.
Structural variations are larger differences in the genome that occur when a piece of DNA is duplicated, deleted, or switched around, which can impact genetic instructions encoded in DNA and affect the expression of nearby genes. Previous studies led by the researchers have shown that structural variations occurring in specific cell types, like breast cells, can strongly influence gene expression in ways that contribute to transforming a healthy breast cell into a cancer cell.
Its known that germline structural variation also can contribute to the molecular profile of cancers, Creighton said. Here we study the extent of its contribution. The study is published in Cell Reports Medicine.
The researchers worked with data developed by the Pan-Cancer Analysis of Whole Genomes consortium, which includes whole genome sequencing data from 2,658 cancers across 38 tumor types involving 20 major tissues of origin. The team integrated these data with RNA data to identify genes whose expression was associated with nearby germline structural variations.
We found most of the genes associated with germline structural variations would not necessarily have specific roles in cancer, but for some genes, the expression variation might be associated with other conditions, Creighton said.
At the same time, several genes affected by germline structural variation could conceivably contribute to cancer, for instance if these genes have an established cancer association or an association with patient survival.
This study shows that germline structural variation would represent a normal class of genetic variation passed down through generations and may play a significant role in cancer development. The researchers propose that the subset of genes with cancer-relevant associations arising in this study would represent strong candidates for further investigation on their value in genetic testing.
Fengju Chen, Yiqun Zhang and Fritz J. Sedlazeck also contributed to this work.
This study was supported by the National Institutes of Health grant P30CA125123.
By Ana Mara Rodrguez, Ph.D.
Follow From the Labs on X @BCMFromtheLabs and Instagram!
Read this article:
Genetic variation passed down through generations may influence cancer development - Baylor College of Medicine | BCM
Unusually mild case of AADC deficiency reveals new gene mutation – AADC News
Genetic testing done for a 55-year-old woman diagnosed with an unusually mild case of AADC deficiency revealed a disease-causing gene mutation never before reported, according to researchers.
The newly identified mutation, while indeed found to be a cause of the patients genetic disease, still allowed for the relatively preserved function of the AADC protein. The researchers said in a case report that the increased protein function may be why the patients symptoms were mild.
Details were given in An attenuated, adult case of AADC deficiency demonstrated by protein characterization, which was published in the journal Molecular Genetics and Metabolism Reports. The work was funded in part by PTC Therapeutics, makers of the AADC deficiency gene therapy Upstaza (eladocagene exuparvovec).
The researchers said their approach in the womans case provided the molecular basis for the mild presentation of the disease, and added that the experience can also be useful for personalized therapeutic decisions in other mild AADC deficiency patients.
AADC deficiency is caused by mutations in the DDC gene, which provides instructions for making the eponymous AADC enzyme. This enzyme is needed to make brain signaling molecules, or neurotransmitters, like dopamine and serotonin. Abnormally low levels of these neurotransmitters in AADC deficiency lead to disease symptoms.
Most people with AADC deficiency who do not receive treatment have very little ability to move or speak on their own. In marked contrast to the typical picture of severe disease, this patient had only some cognitive abnormalities and occasionally experienced moments of weakness in her legs. Overall, her cognitive issues were fairly mild, and she was able to walk and ascend stairs without too much difficulty.
The patient reported that her siblings also had experienced cognitive issues, and that, as a child, she had sometimes experienced episodes where her eyes would roll upward when she was tired. With the benefit of hindsight, the researchers suspect these childhood episodes may have been oculogyric crises, a characteristic symptom of AADC deficiency.
The woman sought medical attention in her mid-50s because she was experiencing mood swings, and the episodes of weakness in her legs had been getting worse, leading to sudden falls.
Analyses of the fluid around the patients brain indicated low levels of dopamine and serotonin, consistent with a diagnosis of AADC deficiency.
Tests of her blood showed AADC enzyme activity was about 28% of whats considered normal which is low enough to qualify for AADC deficiency, but only just, given that healthy AADC carriers typically have activity of 35% to 40%.
Every individual has two copies of the DDC gene, with one inherited from each biological parent. AADC deficiency only develops if both copies are mutated. Carriers, meanwhile, have one mutated copy and one healthy copy and, as such, dont develop disease.
Genetic testing of this patient showed one of her DDC genes carried a mutation dubbed p.Arg347Gln, which has previously been reported to cause AADC deficiency. Her other copy of the gene carried another mutation, p.Glu227Gln, which has never been reported before.
To better understand the molecular basis for this patients unusually mild symptoms, the researchers conducted a series of tests to characterize this combination of mutations. The AADC enzyme normally functions as a dimer that is, two individual AADC enzymes join together to carry out the enzymes function.
The researchers found that when an AADC dimer contained two proteins both with the known disease-causing mutation p.Arg347Gln, the dimer had essentially no ability to function at all. By contrast, an AADC dimer with two enzymes carrying the novel p.Glu227Gln mutation had near-normal functionality. A dimer containing one enzyme with each mutation had about 75% of the activity of a normal AADC dimer.
Altogether these data suggest that these two mutations cause AADC deficiency that is characterized by comparatively high enzyme activity likely explaining why this patient had such mild symptoms.
After the diagnosis of AADC deficiency was confirmed, the patient was started on treatment with vitamin B6 (pyridoxine). She reported more energy and less fatigue after starting the treatment.
Interestingly, in the last few years, many previously undiagnosed or misdiagnosed patients have been identified as mild cases of AADC deficiency, expanding the phenotype [characteristics] of this neurotransmitter disease, the researchers wrote.
Read more:
Unusually mild case of AADC deficiency reveals new gene mutation - AADC News
China Genetic Testing Analysis Report 2024: Market to Reach $14.9 Billion by 2032 from $4.3 Billion in 2023, Driven … – PR Newswire
DUBLIN, March 27, 2024 /PRNewswire/ -- The"China Genetic Testing Market Report by Test Type, Disease, Technology, Service Provider, Testing Sample 2024-2032" report has been added toResearchAndMarkets.com's offering.
The China genetic testing market size reached US$ 4.3 billion in 2023. The market is projected to reach US$ 14.9 billion by 2032, exhibiting a growth rate (CAGR) of 14.9% during 2023-2032.
Genetic testing is becoming popular in China. It may benefit many different interest groups, such as individuals and families with a history of genetic disorder, pregnant women, employers, and health or life insurance. This market is currently driven by a number of factors such as rising awareness regarding the benefits of genetic testing, availability of direct to consumer tests and increasing incidences of genetic disorders.
Over the past few years, there has been a significant rise in the awareness levels regarding the benefits of genetic testing in China. Genetic testing provides various technologies that help in the early detection of various chronic diseases and ensures its treatment and prevention. Moreover, a rise in the availability of Direct to consumer tests (DTC) which has increased the convenience and accessibility of such tests is also creating a positive impact in the growth of the market.
Moreover, In October, 2015, China announced that the iconic one-child policy had finally been replaced by a universal two-child policy. This is expected to increase the number of babies born each year and create a positive impact on the demand of the new born genetic testing segment. Other major factors that are expected to drive this market include growing middle class, aging population, and expanding healthcare system.
This report provides a deep insight into the China genetic testing market covering all its essential aspects. This ranges from macro overview of the market to micro details of the industry performance, recent trends, key market drivers and challenges, SWOT analysis, Porter's five forces analysis, value chain analysis, etc. This report is a must-read for entrepreneurs, investors, researchers, consultants, business strategists, and all those who have any kind of stake or are planning to foray into the China genetic testing industry in any manner.
Key Questions Answered in This Report
Competitive Landscape
Key Market Segmentation:
Breakup by Test Type:
Breakup by Disease:
Breakup by Technology:
Breakup by Service Provider:
Breakup by Testing Sample:
For more information about this report visit https://www.researchandmarkets.com/r/ob8wjd
About ResearchAndMarkets.com ResearchAndMarkets.com is the world's leading source for international market research reports and market data. We provide you with the latest data on international and regional markets, key industries, the top companies, new products and the latest trends.
Media Contact:Research and Markets Laura Wood, Senior Manager [emailprotected] For E.S.T Office Hours Call +1-917-300-0470 For U.S./CAN Toll Free Call +1-800-526-8630 For GMT Office Hours Call +353-1-416-8900 U.S. Fax: 646-607-1907 Fax (outside U.S.): +353-1-481-1716
Logo: https://mma.prnewswire.com/media/539438/Research_and_Markets_Logo.jpg
SOURCE Research and Markets
Read the original here:
China Genetic Testing Analysis Report 2024: Market to Reach $14.9 Billion by 2032 from $4.3 Billion in 2023, Driven ... - PR Newswire
UMass Amherst Engineers Create Bioelectronic Mesh Capable of Growing with Cardiac Tissues for Comprehensive … – Diagnostic and Interventional…
March 25, 2024 A team of engineers led by the University of Massachusetts Amherst and including colleagues from the Massachusetts Institute of Technology (MIT) recently announced in the journalNature Communicationsthat they had successfully built a tissue-like bioelectronic mesh system integrated with an array of atom-thin graphene sensors that can simultaneously measure both the electrical signal and the physical movement of cells in lab-grown human cardiac tissue. In a research first, this tissue-like mesh can grow along with the cardiac cells, allowing researchers to observe how the hearts mechanical and electrical functions change during the developmental process. The new device is a boon for those studying cardiac disease as well as those studying the potentially toxic side-effects of many common drug therapies.
Cardiac disease is the leading cause of human morbidity and mortality across the world. The heart is also very sensitive to therapeutic drugs, and the pharmaceutical industry spends millions of dollars in testing to make sure that its products are safe. However, ways to effectively monitor living cardiac tissue are extremely limited.
In part, this is because it is very risky to implant sensors in a living heart, but also because the heart is a complex kind of muscle with more than one thing that needs monitoring. Cardiac tissue is very special, saysJun Yao, associate professor of electrical and computer engineering in UMass Amhersts College of Engineering and the papers senior author. It has a mechanical activitythe contractions and relaxations that pump blood through our bodycoupled to an electrical signal that controls that activity.
But todays sensors can typically only measure one characteristic at a time, and a two-sensor device that could measure both charge and movement would be so bulky as to impede the cardiac tissues function. Until now, there was no single sensor capable of measuring the hearts dual properties without interfering with its functioning.
The new device is built of two critical components, explains lead author Hongyan Gao, who is pursuing his Ph.D. in electrical engineering at UMass Amherst. The first is a three-dimensional cardiac microtissue (CMT), grown in a lab from human stem cells under the guidance of co-author Yubing Sun, associate professor of mechanical and industrial engineering at UMass Amherst. CMT has become the preferred model for in vitro testing because it is the closest analog yet to a full-size, living human heart. However, because CMT is grown in a test tube, it has to mature, a process that takes time and can be easily disrupted by a clumsy sensor.
The second critical component involves graphenea pure-carbon substance only one atom thick. Graphene has a few surprising quirks to its nature that make it perfect for a cardiac sensor. Graphene is electrically conductive, and so it can sense the electrical charges shooting through cardiac tissue. It is also piezoresistive, which means that as it is stretchedsay, by the beating of a heartits electrical resistance increases. And because graphene is impossibly thin, it can register even the tiniest flutter of muscle contraction or relaxation and can do so without impeding the hearts function, all through the maturation process. Co-author Jing Kong, professor of electrical engineering at MIT, and her group supplied this critical graphene material.
Although there have already been many applications for graphene, it is wonderful to see that it can be used in this critical need, which takes advantage of graphenes different characteristics, says Kong.
Gao, Yao and their colleagues then embedded a series of graphene sensors in a soft, stretchable porous mesh scaffold they developed that has close structural and mechanical properties to human tissue and which can be applied non-invasively to cardiac tissue.
No one has ever done this before, says Gao. Graphene can survive in a biological environment without degrading for a very long time and not lose its conductivity, so we can monitor the CMT across its entire maturation process.
This is crucial for a number of reasons, adds Yao. Our sensor can give real-time feedback to scientists and drug researchers, and it can do so in a cost-effective way. We take pride in using the insights of electrical engineering to help build tools that can be useful to a wide range of researchers.
In the future, Gao says, he hopes to be able to adapt his sensor to grander scales, even to in vivo monitoring, which would provide the best-possible data to help solve cardiac disease.
This research was supported by the Army Research Office, the National Institutes of Health, the U.S. National Science Foundation, the Semiconductor Research Corporation, and the Link Foundation, as well as theInstitute for Applied Life Sciencesat UMass Amherst.
For more information:https://www.umass.edu/
Read the original here:
UMass Amherst Engineers Create Bioelectronic Mesh Capable of Growing with Cardiac Tissues for Comprehensive ... - Diagnostic and Interventional...
Microplastics dampen the self-renewal of hematopoietic stem cells by disrupting the gut microbiota-hypoxanthine-Wnt … – Nature.com
Mice
C57BL/6J (CD45.2) and C57BL6.SJL (CD45.1) mice were purchased from The Jackson Laboratory and housed under specific pathogen-free conditions. Male and female mice from 8 to 12 weeks were used in experiments and provided with a suitable environment and sufficient water and food. After a week of acclimatization, each mouse was randomly divided into groups, given 100L pure water, 0.01mg/100L, or 0.1mg/100L MPs by oral gavage every two days for five weeks in a gavage experiment (n=5 for each group). For the intravenous injection experiment, MPs were administered into mouse blood via the tail vein at a rate of 0.1g/100L per week for a duration of 4 weeks (n=5 for each group). All animal experiments were first approved by the Laboratory Animal Welfare and Ethics Committee of Zhejiang University (AP CODE: ZJU20220108).
Indocyanine green polystyrene (ICG-PS), polystyrene (PS) and polymethyl methacrylate (PMMA) particles were obtained from Suzhou Mylife Advanced Material Technology Company (China). Polyethylene (PE) particles were purchased from Cospheric (USA). Scanning electron microscopy (SEM, Nova Nano 450, FEI) was used to characterize the primary sizes and shapes of different MPs20. MPs were dispersed in ultrapure water with sonication before dynamic light scattering analysis (Zetasizer, Malvern, UK) to determine the hydrodynamic sizes and zeta potentials49.
Mice were sacrificed and organs were removed within six hours of ICG-PS gavage, including the heart, lung, kidney, spleen, liver, gastrointestinal tissues and bone marrow. Feces were collected 1h before the mice were sacrificed. Both organs and feces were monitored by ex vivo bioluminescence imaging with a small-animal imaging system50 (IVIS Spectrum, PerkinElmer).
For flow cytometry analysis and isolation of hematopoietic stem and progenitor cells, cells were stained with relevant antibodies51 in PBS with 2% fetal bovine serum for 3045min on ice. Antibody clones that were used: Sca-1-PE-Cy7, c-Kit-APC, CD150-PE, CD48-BV421, CD45.1-FITC, CD45.2 PE-Cy5, Gr-1-PE-Cy5, Mac1-PE-Cy5, IgM-PE-Cy5, CD3-PE-Cy5, CD4- PE-Cy5, CD8-PE-Cy5, CD45R-PE-Cy5 and Ter-119-PE-Cy5. Detailed antibody information is summarized in Supplementary Table S6. HSPCs were stained with a lineage antibody cocktail (Gr-1, Mac1, CD3, CD4, CD8, CD45R, TER119 and B220), Sca-1, c-Kit, CD150 and CD48. Cell types were defined as followed: LSK compartment (LinSca-1+c-Kit+), LT-HSC (LSK CD150+CD48), ST-HSC (LSK CD150CD48), MPP2 (LSK CD150+CD48+) and MPP3/4 (LSK CD150CD48+). B cells (CD45.2+Mac1Gr-1+B220+), T cells (CD45.2+Mac1Gr-1+CD3+) and myeloid cells (CD45.2+Mac1+Gr-1). Samples were analyzed on a flow cytometer (CytoFLEX LX, Beckman). For sorting HSCs, lineage antibody cocktail-conjugated paramagnetic microbeads and MACS separation columns (Miltenyi Biotec) were used to enrich Lin cells before sorting. Stained cells were re-suspended in PBS with 2% FBS and sorted directly using the Beckman moflo Astrios EQ (Beckman). Flow cytometry data were analyzed by FlowJo (BD) software.
Apoptosis of cells was detected by Annexin V staining (Yeason, China). After being extracted from the bone marrow of mice, 5106 cells were labeled with different surface markers for 30 to 45min at 4C and then twice rinsed with PBS. Subsequently, the cells were reconstituted in binding buffer and supplemented with Annexin V. After 30min of incubation, flow cytometry was detected in the FITC channel. Cell cycle analysis was performed with the fluorescein Ki-67 set (BD Pharmingen, USA), following the directions provided by the manufacturer. Briefly, a total of 5106 bone marrow cells were labeled with corresponding antibodies, as previously stated. Afterward, the cells were pre-treated with a fixation/permeabilization concentrate (Invitrogen, USA) at 4C overnight and subsequently rinsed with the binding buffer. The cells were stained with Ki-67 antibody for 1h in the dark and then with DAPI (Invitrogen) for another 5min at room temperature. Flow cytometry data were collected by a flow cytometer (CytoFLEX LX, Beckman, USA).
HSCs were sorted by flow cytometry according to the experimental group (ctrl and PSH mice, Rikenellaceae treatment or hypoxanthine treatment). 150 HSCs were seeded in triplicate on methylcellulose media52 (M3434, Stemcell Technologies, Inc.). After 8 days, the number of colonies was counted by microscopy. In addition, 5000 BM cells were seeded and analyzed the same way as HSCs. The cell culture media was diluted in PBS and subjected to centrifugation at 400g for 5min to determine the total cell number.
Recipient mice (CD45.1) were administered drinking water with Baytril (250mg/L) for 7 days pre-transplant and 10 days post-transplant. The day before transplantation, recipients received a lethal dose of radiation (4.5Gy at a time, divided into two times with an interval of 4h). In primary transplantation, 2105 bone marrow cells from the ctrl or PS group (CD45.2) mice and 2105 recipient-type (CD45.1) bone marrow cells were transplanted into recipient mice (CD45.1) mice. Cells were injected into recipients via tail vein injection. Donor chimerism was tracked using peripheral blood cells every 4 weeks for at least 16 weeks after transplantation. For secondary transplantation, donor BM cells were collected from primary transplant recipients sacrificed at 16 weeks after transplantation and transplanted at a dosage of 2106 cells into irradiated secondary recipient mice (9Gy). Analysis of donor chimerism and the cycle of transplantation in secondary transplantation were the same as in primary transplantation.
For limiting dilution assays52, 1104, 5104 and 2105 donor-derived bone marrow cells were collected from ctrl or PS mice (CD45.2) and transplanted into irradiated (9Gy) CD45.1 recipient mice with 2105 recipient-type (CD45.1) bone-marrow cells. Limiting dilution analysis was performed using ELDA software53. 16 weeks after transplantation, recipient mice with more than 1% peripheral-blood multilineage chimerism were defined as positive engraftment. On the other hand, recipient mice undergoing transplantation that had died before 16 weeks post transplantation were likewise evaluated as having failed engraftment54.
For histological analysis, small intestines were collected and fixed in 4% paraformaldehyde and embedded in paraffin, sectioned (5m thickness), and stained with H&E at ZJU Animal Histopathology Core Facility (China). We used Chius scores33,34 to evaluate the damage for each sample. The grade was as follows: 0, normal mucosa; 1, development of subepithelial Gruenhagens space at the tip of villus; 2, extension of the Gruenhagens area with moderate epithelial lifting; 3, large epithelial bulge with a few denuded villi; 4, denuded villi with lamina propria and exposed capillaries; and 5, disintegration of the lamina propria, ulceration, and hemorrhage. For TEM analysis, slices of the small intestine were fixed with 2.5% glutaraldehyde for ultra-microstructure observation of intestinal epithelial cells. The samples were postfixed for one hour at 4C with 1% osmium tetroxide and 30min with 2% uranyl acetate, followed by dehydration with a graded series of alcohol solutions (50%, 70%, 90% and 100% for 15min each) and acetone (100% twice for 20min). Subsequently, they were embedded with epon (Sigma-Aldrich, MO, US) and polymerized. Ultrathin sections (6080nm) were made, and examined using TEM (Tecnai G2 Spirit 120kV, Thermo FEI).
In the short-term and long-term mouse models for MP ingestion, mice were fasted for 4h before oral gavage of FITC-dextran (4kD, Sigma). The fluorescence intensity of FITC-dextran (50mg/100g body weight) was measured in the peripheral blood after 2h of gavage. Fluorescence was measured using a microplate reader (Molecular Devices, SpectraMax iD5) with excitation at 490nm and emission at 520 nm29.
Fecal samples (about 3050mg per sample) were collected from the ctrl, PSL and PSH mice, quickly frozen in liquid nitrogen, and stored at 80C. DNA samples for the microbial community were extracted using E.Z.N.A. Stool DNA Kit (Omega, USA), according to the manufacturers instructions. In brief, polymerase chain reaction (PCR) amplification of prokaryotic 16S rDNA gene V3V4 region was performed using the forward primer 341F (5-CCTACGGGNGGCWGCAG-3) and the reverse primer 805R (5-GACTACHVGGGTATCTAATCC-3)55. After 35 cycles of PCR, sequencing adapters and barcodes were included to facilitate amplification. The PCR products were detected by 1.5% agarose gel electrophoresis and were further purified using AMPure XT beads (Beckman Coulter Genomics, Danvers, MA, USA), while the target fragments were recovered using the AxyPrep PCR Cleanup Kit (Axygen, USA). In addition, the amplicon library was quantified with the Library Quantification Kit for Illumina (Kapa Biosciences, Woburn, MA, USA), and sequenced on the Illumina NovaSeq PE250 platform. In bioinformatics pipeline29,56, the assignment of paired-end reads to samples was determined by their unique barcode, and subsequently shortened by cutting off the barcode and primer sequence. The paired-end reads were combined by FLASH (v1.2.8). Quality filtering on the raw reads was carried out under precise parameters to obtain high-quality clean tags according to fqtrim (v0.94). The chimeric sequences were filtered by Vsearch software (v2.3.4). After the dereplication process using DADA2, we acquired a feature table and feature sequence. The bacterial sequence fragments obtained were grouped into Operational Taxonomic Units (OTUs) and compared to the Greengenes microbial gene database using QIIME2. Alpha diversity and beta diversity were generated by QIIME2, and pictures were drawn by R (v3.2.0). The species annotation sequence alignment was performed by Blast, with the SILVA and NT-16S databases as the alignment references. Additional sequencing results are provided in Supplementary Table S1. The experiment was supported by Lc-Bio Technologies.
The methods for the analysis of feces from HSCT donors were slightly different from those used for mice. All samples were stored in the GUHE Flora Storage buffer (GUHE Laboratories, China). The bacterial genomic DNA was extracted with the GHFDE100 DNA isolation kit (GUHE Laboratories, China) and quantified using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, USA). The V4 region of the bacterial 16S rDNA genes was amplified by PCR, with the forward primer 515F (5-GTGCCAGCMGCCGCGGTAA-3) and the reverse primer 806R (5-GGACTACHVGGGTWTCTAAT-3). PCR amplicons were purified with Agencourt AMPure XP Beads (Beckman Coulter, IN) and quantified by the PicoGreen dsDNA Assay Kit (Invitrogen, USA). Following the previously reported steps57, the paired-end 2150bp sequencing was performed on the Illumina NovaSeq6000 platform. The details of bacterial OTUs are summarized in Supplementary Table S5. Sequence data analyses were performed using QIIME2 and R packages (v3.2.0).
For metabolite evaluation, samples from mice feces were prepared and detected as previously described55,58,59. In a nutshell, metabolites were extracted from feces through precooled 50% methanol buffer and stored at 80C before the LCMS analysis. All chromatographic separations were conducted using an ultra-performance liquid chromatography (UPLC) system (SCIEX, UK). A reversed phase separation was performed using an ACQUITY UPLC T3 column (100mm * 2.1mm, 1.8m, Waters, UK). The temperature of the column oven was maintained at 35C and the flow rate was 0.4mL/min. Both positive (the ionspray voltage floating set at 5000V) and negative ion modes (4500V) were analyzed using a TripleTOF 5600 Plus high-resolution tandem mass spectrometer (SCIEX, UK). The mass spectrometry data were obtained in Interactive Disassembler Professional (IDA) mode, with a time-of-flight (TOF) mass range of 60 to 1200Da. The survey scans were acquired in 150 milliseconds and product ion scans with a charge state of 1+ and 100 counts per second (counts/s) were recorded up to 12. Cycle duration was 0.56s. Stringent quality assurance (QA) and quality control (QC) procedures were applied, as the mass accuracy was calibrated every 20 samples and a QC sample was obtained every 10 samples. LCMS raw data files underwent processing in XCMS (Scripps, La Jolla, CA) to perform peak picking, peak alignment, gap filling, and sample normalization. Online KEGG was adopted to annotate metabolites through the matching between the precise molecular mass data (m/z) of samples and those from the database. PCA and volcano plot were utilized to identify ion characteristics that exhibit significant differences between the groups. The details of metabolomes can be found in Supplementary Table S2. The experiment was supported by Lc-Bio Technologies.
Before FMT, SPF mice received a 200L antibiotic treatment (1g/L ampicillin, 0.5g/L neomycin, 0.5g/L vancomycin and 1g/L metronidazole) for three consecutive days by oral gavage. Fresh feces were collected from ctrl or PS mice and resuspended in reduced PBS (0.5g/L cysteine and 0.2g/L Na2S in PBS) at a ratio of about 120mg feces/mL reduced PBS. Feces were then centrifuged at 500g for 1min to remove insolubilize particles25. Recipients (C57BL/6J mice) were administered 100mL of the supernatant from different groups by oral gavage twice every week for 4 weeks. 2 days after the last FMT, recipients were euthanized to analyze the changes in the hematopoietic system.
The Rikenellaceae strain (ATCC BAA-1961), purchased from ATCC, was cultured in an anaerobic chamber using BD Difco Dehydrated Culture Media: Reinforced Clostridial Medium at a temperature of 37C with a gas mixture of 80% N2 and 20% CO2. The final concentration of Rikenellaceae was 2108 viable c.f.u. per 100L and hypoxanthine (200mg/kg, Sigma, Germany) was dissolved in double distilled water29. Mice first received antibiotic treatment (same as FMT) and were then treated by oral gavage with 100L of either Rikenellaceae or hypoxanthine suspension three times a week for 4 weeks. Reinforced Clostridial Medium or double distilled water was used as a vehicle control, respectively. 2 days after the last administration, recipients were euthanized to analyze the changes in the hematopoietic system. To examine the impact of hypoxanthine on HSCs, we exposed bone marrow cells to direct co-culture with hypoxanthine at a concentration of 100pg/mL for a period of 3 days.
Mouse bone marrow cells were harvested by flushing the mices tibia and femur in phosphate buffered saline (PBS) with 2% fetal bovine serum (GIBCO). Harvested cells were grown into 96-well u-bottom plates containing freshly made HSC culture medium (StemSpanTM SFEM, Stemcell Tec.) with SCF (50ng/mL; PeproTech) and TPO (50ng/mL; PeproTech), at 37C with 5% CO2. For HSC culture, the medium was changed every 3 days by manually removing half of the conditioned medium and replacing it with fresh medium60. To assess the effects of WNT10A, IL-17, TNF and NF-kappa B on hematopoiesis, we cultured HSCs in a basic medium and supplemented them with related proteins (10ng/mL; Cosmo Bio, USA) or PBS as a control for two days, followed by flow cytometry analysis. Different concentrations of PS were added to the medium and tested using CCK-8 and FACS to detect the effect of MPs on cultured HSCs.
1104 HSCs were obtained in triplicate from mouse bone marrow cells from the ctrl or PSH group by flow cytometry sorting and RNA was extracted with RNAiso Plus (Takara, Japan) according to the manufacturers protocol. The concentration and integrity of RNA were examined by Qubit 2.0 and Agilent 2100 (Novogene, China), respectively. Oligo (dT)-coated magnetic beads (Novogene, China) were used to enrich eukaryotic mRNA. After cDNA synthesis and PCR amplification, the PCR product was purified using AMPure XP beads (Novogene, China) to obtain the final library. The Illumina high-throughput sequencing platform NovaSeq 6000 was used for sequencing. Analysis of gene expression was calculated by R or the DESeq2 package61. Detailed information regarding RNA-seq is listed in Supplementary Table S3.
For RNA expression analysis, total RNA from bone marrow cells was extracted using Trizol (Invitrogen, US) and resuspended in nuclease-free water. Reverse transcription was performed using the QuantiTect Reverse Transcription kit (Qiagen NV). qPCR was conducted using cDNA, primers and SYBR-green (Takara, Japan) in 20L using the ABI 7500 Q-PCR system62. Results were calculated using the RQ value (RQ=2Ct). Mouse Actin was chosen as the normalization control. Gene-specific primer sequences are shown in Supplementary Table S7.
Bone marrow and Rikenellaceae supernatant in different groups were obtained by centrifugation. Fecal supernatant was obtained from human samples. Hypoxanthine (LANSO, China) and WNT10A (EIAab, China) were measured by ELISA with respective kits according to the manufacturers protocols.
Human feces and peripheral blood samples were obtained from 14 subjects who provided grafts for HSCT patients. They were divided into graft success group and graft failure (GS)/poor graft function (GF/PGF) group, with 7 participants in each group. Research involving humans was approved by the Clinical Research Ethics Committee of the First Affiliated Hospital, College of Medicine, Zhejiang University (IIT20230067B). All participants read and signed the informed consent. Detailed information on patients was listed in Supplementary Table S4.
The Agilent 8700 Laser Direct Infrared Imaging system was utilized for fast and automated analysis of MPs in feces received from donors. An excessive nitric acid concentration (68%) was added to the sample and heated to dissolve the protein. Large particles were first intercepted with a large aperture filter and then filtered by vacuum extraction. After rinsing with ultra-pure water and ethanol several times, the materials, including MPs, were dispersed in the ethanol solution. The LDIR test was carried out when the ethanol was completely volatilized63. The sample of MPs was positioned on the standard sample stage. The stage was then put into the sample stage, and the Agilent Clarity was initiated to advance the sample stage into the sample chamber. The software rapidly scanned the chosen test area using a constant wave number of 1800cm1, and accurately detected and pinpointed the particles within the selected area. The unoccupied area devoid of particles was automatically designated as the background. The background spectrum was gathered and readjusted, followed by the visualization of detected particles and the collection of the whole infrared spectrum. After obtaining the particle spectrum, the spectrum library was utilized to carry out qualitative analysis automatically, including the inclusion picture, size, and area of each particle. The test was supported by Shanghai WEIPU Testing Technology Group.
MPs in peripheral blood from donors were tested by Py-GC/MS. Nitric acid was added to samples for digestion at 110C for 12h, and then used deionized water to make the solution weakly acidic. After concentration, the solution was dribbled into the sampling crucible of Py-GCMS and tested when the solvent in the crucible was completely volatilized17. Various standards of MPs were prepared and analyzed using Py-GCMS in order to construct the quantitative curve. PY-3030D Frontier was employed for lysis, with a lysis temperature set at 550 C. The chromatographic column dimensions were 30m in length, 0.25mm inner diameter, and 0.25m film thickness. The sample was subjected to a heat preservation period of 2min at 40C, followed by a gradual increase in temperature at a rate of around 20C per minute until it reached 320C. The sample was maintained at this temperature for 14min and the entire process takes a total of 30min. The carrier gas utilized was helium, with the ion source temperature of 230C. The split ratio employed was 5:1, and the m/z scan range spanned from 40 to 60064. The experiment was supported by Shanghai WEIPU Testing Technology Group.
Each animal experiment was tested using at least 56 replicates and each in vitro experiment was at least three replicates. Specific replication details are provided in relevant figure captions. Statistical significance was ascertained through unpaired two-tailed t-tests by GraphPad Prism when the P value was less than 0.05. Error bars in all figures indicate the standard deviation (SD).
Hereditary Alzheimer’s Transmitted Via Bone Marrow Transplants – Neuroscience News
Summary: Alzheimers disease, traditionally seen as a brain-centric condition, may have systemic origins and can be accelerated through bone marrow transplants from donors with familial Alzheimers to healthy mice.
A new study underscores the diseases potential transmission via cellular therapies and suggests screening donors for Alzheimers markers to prevent inadvertent disease transfer.
By demonstrating that amyloid proteins from peripheral sources can induce Alzheimers in the central nervous system, this research shifts the understanding of Alzheimers towards a more systemic perspective, highlighting the need for cautious screening in transplants and blood transfusions.
Key Facts:
Source: Cell Press
Familial Alzheimers disease can be transferred via bone marrow transplant, researchers show March 28 in the journalStem Cell Reports. When the team transplanted bone marrow stem cells from mice carrying a hereditary version of Alzheimers disease into normal lab mice, the recipients developed Alzheimers diseaseand at an accelerated rate.
The study highlights the role of amyloid that originates outside of the brain in the development of Alzheimers disease, which changes the paradigm of Alzheimers from being a disease that is exclusively produced in the brain to a more systemic disease.
Based on their findings, the researchers say that donors of blood, tissue, organ, and stem cells should be screened for Alzheimers disease to prevent its inadvertent transfer during blood product transfusions and cellular therapies.
This supports the idea that Alzheimers is a systemic disease where amyloids that are expressed outside of the brain contribute to central nervous system pathology, says senior author and immunologist Wilfred Jefferies, of the University of British Columbia.
As we continue to explore this mechanism, Alzheimers disease may be the tip of the iceberg and we need to have far better controls and screening of the donors used in blood, organ and tissue transplants as well as in the transfers of human derived stem cells or blood products.
To test whether a peripheral source of amyloid could contribute to the development of Alzheimers in the brain, the researchers transplanted bone marrow containing stem cells from mice carrying a familial version of the diseasea variant of the human amyloid precursor protein (APP) gene, which, when cleaved, misfolded and aggregated, forms the amyloid plaques that are a hallmark of Alzheimers disease.
They performed transplants into two different strains of recipient mice: APP-knockout mice that lacked an APP gene altogether, and mice that carried a normal APP gene.
In this model of heritable Alzheimers disease, mice usually begin developing plaques at 9 to 10 months of age, and behavioral signs of cognitive decline begin to appear at 11 to 12 months of age. Surprisingly, the transplant recipients began showing symptoms of cognitive decline much earlierat 6 months post-transplant for the APP-knockout mice and at 9 months for the normal mice.
The fact that we could see significant behavioral differences and cognitive decline in the APP-knockouts at 6 months was surprising but also intriguing because it just showed the appearance of the disease that was being accelerated after being transferred, says first author Chaahat Singh of the University of British Columbia.
In mice, signs of cognitive decline present as an absence of normal fear and a loss of short and long-term memory. Both groups of recipient mice also showed clear molecular and cellular hallmarks of Alzheimers disease, including leaky blood-brain barriers and buildup of amyloid in the brain.
Observing the transfer of disease in APP-knockout mice that lacked an APP gene altogether, the team concluded that the mutated gene in the donor cells can cause the disease and observing that recipient animals that carried a normal APP gene are susceptible to the disease suggests that the disease can be transferred to health individuals.
Because the transplanted stem cells were hematopoietic cells, meaning that they could develop into blood and immune cells but not neurons, the researchers demonstration of amyloid in the brains of APP knockout mice shows definitively that Alzheimers disease can result from amyloid that is produced outside of the central nervous system.
Finally the source of the disease in mice is a human APP gene demonstrating the mutated human gene can transfer the disease in a different species.
In future studies, the researchers plan to test whether transplanting tissues from normal mice to mice with familial Alzheimers could mitigate the disease and to test whether the disease is also transferable via other types of transplants or transfusions and to expand the investigation of the transfer of disease between species.
In this study, we examined bone marrow and stem cells transplantation. However, next it will be important to examine if inadvertent transmission of disease takes place during the application of other forms of cellular therapies, as well as to directly examine the transfer of disease from contaminated sources, independent from cellular mechanisms, says Jefferies.
Funding:
This research was supported by the Canadian Institutes of Health Research, the W. Garfield Weston Foundation/Weston Brain Institute, the Centre for Blood Research, the University of British Columbia, the Austrian Academy of Science, and the Sullivan Urology Foundation at Vancouver General Hospital.
Author: Kristopher Benke Source: Cell Reports Contact: Kristopher Benke Cell Reports Image: The image is credited to Neuroscience News
Original Research: The findings will appear in Stem Cell Reports
More here:
Hereditary Alzheimer's Transmitted Via Bone Marrow Transplants - Neuroscience News
New Allo-HCT Approach Boosts Immune Response, Survival – Targeted Oncology
While ex vivo CD34-selected allogeneic hematopoietic stem cell transplants (HCTs) are promising treatments for patients with hematologic and myeloid malignancies, they can be limited by delayed immune recovery and increased risk of death not caused by relapse.
A late-breaking abstract presented at the 2024 Transplantation and Cellular Therapy Tandem Meetings investigated a new approach to allogeneic HCT. Investigators of the phase 2 PRAISE-IR study (NCT04872595) explored using a model-based approach to determine the optimal dose of antithymocyte globulin (ATG), which is used to prevent graft-vs-host disease after transplant. Previous studies suggested high ATG exposure might contribute to nonrelapse mortality.
According to Michael Scordo, MD, the model successfully achieved a low posttransplant ATG exposure, and immune reconstitution by day 100 was achieved in 69% of patients, meeting the studys primary end point. Further, the 2-year rates of nonrelapse mortality and relapse were 9% and 13%, respectively, and relapse-free survival and overall survival rates were high at 78% and 86%, respectively.
These findings suggest that using a model to determine the ATG dose for ex vivo CD34-selected allogeneic HCT can lead to improved immune reconstitution and excellent survival outcomes. This approach may help reduce nonrelapse mortality previously observed in other trials and improve the safety and effectiveness of this type of transplant.
In an interview with Targeted OncologyTM, Scordo, bone marrow transplant specialist and cellular therapist at Memorial Sloan Kettering Cancer Center in New York, New York, discussed the findings from this study and their implications for the allogeneic HCT treatment landscape.
Targeted Oncology: What was the rationale or inspiration for the study you presented at the Tandem Meetings?
Scordo: Ex vivo CD34-selected [allogeneic] transplant is one of the many methods of reducing graft-vs-host disease. It uses a myeloablative conditioning platform and integrates ATG, antithymocyte globulin, into that platform to help reduce the risk of rejection. This has been well studied over the years, but 1 of the downsides of this approach is the delayed immune recovery, particularly the T-cell immune recovery that occurs after [allogeneic] transplant with this approach. What we did based on a recent publication that we have from last year was we used a different dosing of ATG to ensure that the T-cell immune recovery after [allogeneic] transplant using ex vivo CD34 selection would be improved.
What are some of the unmet needs in this space?
There are many methods to reduce graft-vs-host disease after transplant CD34 selection. Many of the other methods including posttransplant cyclophosphamide [PTCy], which has now become a standard of care, are out there and should be used in the appropriate setting. In matched donor transplants, ex vivo CD34 selection is one of the methods of being able to use an ablative or intensive conditioning regimen with very low rates of particularly chronic graft-vs-host disease. We saw this as an opportunity to improve on this platform significantly, using a novel approach but a simple approach.
What were the goals of this study?
The primary end point of the study was the ability to improve the CD34 T-cell immune recovery by day 100 after transplant. This was a sort of a validated predictor in other studies. We had key secondary end points that included nonrelapse mortality, relapse rates, progression-free, and overall survival. With the primary end point, we exceeded that end point. With our trial, about 70% of our 56 patients achieved this appropriate immune recovery by day 100, which was significantly higher than our historical numbers had shown.
What were some of the other findings?
Aside from achieving the primary end point, we saw very low rates of nonrelapse mortality at 2 years, estimated at 8%, which is much lower than some of the previously published data using this platform in the last couple of years. [We also saw] low relapse rates [of] about 12% at 2 years and very favorable progression-free and overall survival, which was 80% and 87%, respectively, at 2 years.
What are some of the takeaways?
I look at this as a simple but novel approach to improving on a platform. We have existing platforms that work well, but we can improve them doing well. To community oncologists, I would say that for patients with myeloid malignancies, there are many different types of transplants that can be done safely and effectively. The appropriate choice of a platform really depends on many factors. We can improve on all these platforms individually, including PTCy. [For] ex vivo CD34 selection, I look at this as a method of just improving on what we have already shown to be an effective platform, being able to use dose-intensive chemotherapy or total body radiation to achieve maximal disease control but making the platform safe and tolerable.
Read this article:
New Allo-HCT Approach Boosts Immune Response, Survival - Targeted Oncology
ATG or post-transplant cyclophosphamide to prevent GVHD in matched unrelated stem cell transplantation? | Leukemia – Nature.com
Patient characteristics
The baseline characteristics of the study population are presented in Table1. A total of 8764 patients were included, from which 7725 (88%) received rATG, and 1039 (12%) received PTCy as GVHD prophylaxis.
Overall, the majority of patients were transplanted for acute leukemia (58%), myelodysplastic syndrome (MDS) (19.7%), myeloproliferative neoplasm (MPN) (9.7%) or lymphoma (9%). A high proportion of patients had a low/intermediate Disease Risk Index (DRI, 72.1%), and myeloablative conditioning (MAC) was more frequently performed (53.3%) than reduced intensity conditioning (RIC).
Patients in the rATG group were older, with a median age of 58.6 years (IQR (48.1, 65.4)) vs. 53 years in the PTCy group (IQR 38.6, 62.3) (p<0.01), with a similar proportion of males (57.3% in rATG vs. 58.9% in PTCy, p=0.33), along with a significantly lower use of TBI (14.5% vs. 24.7%, p<0.01) and lower use of MAC (52% vs. 62.3%, p<0.01). Also, the disease relapse index was lower and the year of transplant was more recent in the PTCy group (Table1). The remaining parameters were balanced between the two groups. Median follow up was 2.1 years in both arms. More detailed information is given in Table1.
Univariate outcomes are shown in Figs.1, 2and Table2. The results of the multivariate analyses are summarized in Table3. The P-values and hazard ratios (HR) presented in the following results section are derived from the multivariate analysis.
A NRM; B Overall survival, C Relapse incidence, D Progression-free survival and E GVHD-free relapse-free survival. Cumulative incidences are shown.
A Acute GVHD grades IIIV; B Acute GVHD grades IIIIV, C Chronic GVHD all grades and D Extensive chronic GVHD - Cumulative incidences are shown.
Patients receiving PTCy had a significantly lower NRM as compared to patients receiving rATG (2y incidence: 12.4% vs. 16.1%; HR: 0.72 [95% CI 0.550.94], p=0.016). Similarly, OS and PFS showed a statistically significant and clinically meaningful benefit for PTCy arm, with a higher OS (2y incidence: 73.9% vs. 65.1%; HR: 0.82 [95% CI 0.720.92], p=0.001), and a higher PFS (2y incidence: 64.9% vs. 57.2%; HR: 0.83 [95% CI 0.740.93], p<0.001). RI was lower in the PTCy arm (2y incidence: 22.8% vs. 26.6%; HR: 0.87 [95% CI 0.751.00], p=0.046).
The causes of death are given in Table4. No major differences between the two groups were apparent. Relapse of the underlying malignancy was the most frequent cause of death, accounting for ~50% of total deaths in both arms, followed by NRM causes: infections ~18%, GVHD~16% and other alloSCT-related causes ~8% of total deaths. Secondary malignancies contributed to approximately 1% of total deaths.
Overall chronic GVHD was lower in the PTCy group (2y incidence: PTCy 28.4% vs. rATG 31.4%; HR: 0.77 [95% CI 0.630.95], p=0.012). Extensive chronic GVHD was also reduced in patients receiving PTCy vs. rATG: (2y incidence: 11.9% vs. 13.5%; HR: 0.75 [95% CI 0.620.91], p=0.004).
The incidence of acute GVHD grades II-IV in patients receiving PTCy, compared to those receiving ATG was not statistically significant: (100d incidence: 24.1% vs. 26.5%; HR: 0.85 [95% CI 0.691.04], p=0.11). Similarly, for severe acute GVHD grades IIIIV (100d incidence: 8.7% vs. 9.7%; HR: 0.76 [95% CI 0.551.05], p=0.091).
GRFS was significantly higher in the PTCy arm compared to the rATG arm (2y incidence: 51% vs. 45%; HR: 0.86 [95% CI 0.750.99], p=0.035).
The EBMT Database does not contain data on graft failure/rejection. To get insight into the initial grafts success and any subsequent requirement for additional transplantation procedures, we investigated neutrophil recovery after the first alloSCT as well as the incidence of a second alloSCT. The median incidence of neutrophil recovery at days +30 and +60 in the ATG vs. PTCy groups was: d+30 ATG 96% (IC95% 95.596.4) vs. PTCy 91% (8992.7) and d+60 ATG 97.9% (97.698.2) vs. PTCy 97.4% (96.298.3). The median incidence of a second alloSCT at 2 years was 4.3% (3.84.8) in the ATG group and 3.2% (2.24.6) in the PTCy group.
Continue reading here:
ATG or post-transplant cyclophosphamide to prevent GVHD in matched unrelated stem cell transplantation? | Leukemia - Nature.com
New immunotherapy could make blood more ‘youthful,’ mouse study hints – Livescience.com
Scientists reversed some signs of immune aging in mice with a new treatment that could one day potentially be used in humans.
The new immunotherapy works by disrupting a natural process by which the immune system becomes biased towards making one type of cell as it ages.
The mouse study is an "important" proof-of-concept, but it's currently difficult to gauge the significance of the findings, Dr. Janko . Nikolich-Zugich, a professor of immunobiology at the University of Arizona who was not involved in the research, told Live Science in an email. More work is needed to see how well the therapy shifts the immune system into a more youthful, effective state.
All blood cells, including immune cells and the red blood cells that carry oxygen around the body, start life as hematopoietic stem cells (HSC) in the blood and bone marrow, the spongy tissue found within certain bones. HSCs fall into two main categories: those destined to become so-called myeloid cells and those that will develop into lymphoid cells.
Myeloid cells include red blood cells and immune cells belonging to our broadly reactive first line of defense against pathogens, including cells called macrophages that trigger inflammation. Lymphoid cells include cells that develop a memory of germs, such as T and B cells.
Related: 'If you don't have inflammation, then you'll die': How scientists are reprogramming the body's natural superpower
As we age, the HSCs slated to become myeloid cells gradually increase in number and eventually outnumber the lymphoid stem cells. This means we can't respond to infections as well when we're older as when we're young, and we're more likely to experience chronic inflammation triggered by increasing levels of myeloid cells that trigger inflammation.
Get the worlds most fascinating discoveries delivered straight to your inbox.
In the new study, published Wednesday (March 27) in the journal Nature, scientists developed an antibody-based therapy that selectively targets and destroys the myeloid HSCs, thus restoring the balance of the two cell types and making the blood more "youthful." The antibodies latch onto the targeted cells and flag them to be destroyed by the immune system.
The authors injected the therapy into mice aged 18 to 24 months, or roughly the equivalent of being between 56 and 69 years old as a human.
They then extracted HSCs from the mice after treatment and analyzed them, revealing the rodents had a smaller percentage of the myeloid HSCs than untreated mice of the same age.
This effect lasted for two months. Compared with untreated mice, the treated mice also produced more naive T cells and mature B cells. These cells can go on to form memory cells, which are directly involved in the immune attack; in the case of the B cells, they can form antibody-producing plasma cells.
"Not only did we see a shift toward cells involved in adaptive immunity, but we also observed a dampening in the levels of inflammatory proteins in the treated animals," Dr. Jason Ross, lead study author and postdoctoral researcher at Stanford University, said in a statement. Specifically, the researchers saw that the levels of one proinflammatory protein fell in the treated mice. This protein, called IL-1beta, is mainly made by myeloid cells.
Eight weeks post-treatment, the researchers vaccinated the mice against a virus they'd never been exposed to before. The mice that had received the immunotherapy had more apt immune responses to vaccination than the untreated mice, producing more T cells against the germ.
"We believe that this study represents the first steps in applying this strategy in humans," Ross said. However, other experts have cautioned against jumping to conclusions.
Nikolich-Zugich noted that, although the researchers measured changes in the numbers of naive T cells in the mice, they didn't look at the function of the organ that makes them: the thymus. The team also saw reductions only in IL-1beta and not other inflammatory proteins. They also didn't test whether the mice's baseline immunity to new infections could be improved with this therapy, without vaccination, he said.
Furthermore, the study didn't consider potential long-term side effects of the treatment, such as anemia, or a deficiency in red blood cells, said Dr. Ilaria Bellantuono, a professor in musculoskeletal aging at the University of Sheffield in the U.K. who was not involved in the research.
Although an "interesting" study, more work is needed to understand whether it can bring "meaningful changes" in the immune system, Bellantuono told Live Science in an email, whether that of mice or humans.
Ever wonder why some people build muscle more easily than others or why freckles come out in the sun? Send us your questions about how the human body works to community@livescience.com with the subject line "Health Desk Q," and you may see your question answered on the website!
Here is the original post:
New immunotherapy could make blood more 'youthful,' mouse study hints - Livescience.com
The Doctor Game: What women suffer most from menopause? – The Westerly Sun
Theres a universal fact for women. If they live long enough, their capacity to bring forth children will end, and they will become menopausal. Menopause can be when the thermostat becomes their most prized possession.
But not all women have hot flashes. Some go through this period wondering why they have no symptoms. The best advice for them is, Enjoy the smooth sailing!
Other women endure needless suffering. There are treatments, and these women should see their doctors.
The medical journal The Lancet has urged women to become educated about hormone replacement therapy. Menopause should not be considered a disease. It is a natural process. Be cautious with commercial interests of pharmaceutical companies propaganda. Seek information from a medical specialist.
The authors of The Lancet report stress they are not opposed to HRT, as it can be effective in treating hot flashes, vaginal dryness, and genital urinary symptoms. Many years ago, HRT was often used by women to control menopausal symptoms. The standard treatment involved the hormones estrogen and progestin, a synthetic form of progesterone.
But a large and widely publicized study called the Womens Health Initiative identified problems with HRT. Doctors and patients concluded HRT was dangerous, and this misconception lingers today. The study had significant shortcomings, however, and subsequent studies have more nuanced conclusions. For women under 60, or for those less than a decade out of menopause, the benefits of HRT in fighting debilitating symptoms outweighed the risk. There was one other caution. Those using HRT should not have a family history of stroke, breast cancer, or coronary heart disease.
Which women suffer the most from menopause? Its those who are affected by severe symptoms. Imagine a stalwart high school principal. She has handled the tough job for years. But with the onset of menopause, the slightest provocation has her bursting into tears behind closed doors. For the first time, she feels incapable of the task. If she meets the criteria mentioned above, then she is a textbook case for HRT. Within a week, her problem would be history.
Menopause is not just one event or one symptom, such as hot flashes. A gradual decrease in the production of estrogen influences organs such as the vagina and urinary bladder. Its these organs that women are loath to discuss with their family doctor, to say nothing of their partners.
It may come as a shock to younger people to know that seniors have sexual relations. But menopause can make vaginal tissues thinner and more easily irritated. Past columns have tried to explain this with a touch of eloquence, noting that its hard for females to sing with a sore throat. Put plainly, its hard for menopausal and post-menopausal women to enjoy sex with an inflamed vagina (atrophic vaginitis). Sometimes neither the woman nor her partner knows whats causing the severe pain. Unfortunately, many women suffer silently.
Those who ask for help will find there are good remedies. Something as simple as an estrogen cream can resolve an irritated vagina within two weeks. Other consequences of menopause, like the accelerated loss of bone density, may also be treated with HRT.
Sometimes problems are missed because a vaginal examination is not done during a check-up. Or patients dont mention issues to the doctor.
The comedian Joan Rivers made a joke about news that having a dog makes you 10 years younger. My first thought was to rescue two more, she said, before adding, but I dont want to go through menopause again.
Today, women can and should get their symptoms treated.
Dr. W. Gifford-Jones, aka Ken Walker, is a graduate of the University of Toronto and Harvard Medical School. You can reach him online at his website, docgiff.com, or via email at contact-us@ docgiff.com. Follow him and his daughter on Instagram @docgiff and @diana_gifford_jones.
Visit link:
The Doctor Game: What women suffer most from menopause? - The Westerly Sun
How CRISPR-Cas genome editing could be used to cure HIV – Cosmos
One of the most significant challenges in treating HIV is the virus ability to integrate its genome into the hosts DNA. This means that lifelong antiretroviral therapy is essential as latent HIV can reactivate from reservoirs as soon as treatment ends.
One potential technique being developed to address this problem is the use of gene editing technology to cut out and incapacitate HIV from infected cells. Currently, there is a Phase I/II Clinical Trial underway in people with HIV-1 (the most common strain of HIV)
Now, new research from another team shows that gene editing can be used to eliminate all traces of the HIV virus from infected cells in the laboratory.
The research is being presented early ahead of the European Congress of Clinical Microbiology and Infectious Diseases, which will be held from 27-30 April in Barcelona, Spain. Its been carried out by scientists from the Amsterdam Medical University in the Netherlands, and the Paul Ehrlich Institute in Germany, and has not yet been submitted for peer review.
Our aim is to develop a robust and safe combinatorial CRISPR-Cas regimen, striving for an inclusive HIV cure for all that can inactivate diverse HIV strains across various cellular contexts, they write in a conference abstract submitted ahead of ECCMID.
CRISPR-Cas gene editing technology acts like molecular scissors to cut DNA and either delete unwanted genes or introduce new genetic material, while guidance RNA (gRNA) tells CRISPR-Cas exactly where to cut at designated spots on the genome.
In this research, the authors used 2 gRNAs that target conserved parts of the viral genome this means they remain the same or conserved across all known HIV strains. This genetic sequence does not have a match in human genes, to prevent the system going off target and causing mutations elsewhere in the human genome.
The hope is to one day provide a broad-spectrum therapy capable of combating multiple HIV variants effectively. But before this dream can become a reality, the researchers had to address a number of issues with getting the CRISPR-Cas reagents into the right cells.
To delivered CRISPR components into cells in the body a viral vector, containing genes that code for the CRISPR-Cas proteins and gRNA, is used. This is the vehicle that delivers into the host cell the instructions to make all necessary components, but these instructions need to be kept as simple and short as possible.
Another issue is making sure the viral vector enters HIV reservoir cells specifically cells that express the receptors CD4+ and CD32a+ on their surface.
They found that in one system, saCas9, the vector size was minimised, which enhanced its delivery to HIV-infected cells. They also included proteins that target the CD4+ and CD32a+ receptors specifically in the vector.
This system showed outstanding antiviral performance, managing to completely inactivate HIV with a single guide RNA (gRNA) and excise (cut out) the viral DNA with two gRNAs in cells in the lab.
We have developed an efficient combinatorial CRISPR-attack on the HIV virus in various cells and the locations where it can be hidden in reservoirs and demonstrated that therapeutics can be specifically delivered to the cells of interest, the authors write.
These findings represent a pivotal advancement towards designing a cure strategy.
But the researchers stress that, while these preliminary findings are very encouraging, it is premature to declare that there is a functional HIV cure on the horizon.
See the original post:
How CRISPR-Cas genome editing could be used to cure HIV - Cosmos
Why Bayer and the Gates Foundation are using CRISPR to reduce food’s climate impact – GreenBiz
CRISPR gene editing technology is beginning to deliver on a promise to quickly create crops with traits that withstand a changing climate, resist aggressive pests and reinvigorate healthy soils, according to experts at the South by Southwest event in Austin earlier this month.
Companies exploring CRISPR to make climate-friendly foods and medicines are enjoying some tailwinds:
At the same time, startups and researchers are taking on investment partnerships with larger organizations to commercialize CRISPR innovations. Bayer has a project with Pairwise to create a corn crop that is more resilient to environmental factors. In 2011, The Gates Foundation gave a $10.3 million grant to the International Rice Research Institute (IRRI) and has re-invested more than $16 million to the organization in 2023 to create climate resistant rice varieties.
The past 200 years of industrialized agriculture have increased yields and eased shipping with large, durable produce often to the detriment of the soil, the planet and taste.
"We think with gene editing you wont have to make that choice," said Tom Adams, CEO of Pairwise. The startup is producing the first CRISPR consumer product by editing out the wasabi-like spiciness of a mustard green to make it more palatable to eaters.
Pairwise sold the green at a New York grocer earlier this year and is seeking to partner with companies to sell to consumers. The companys main focus is developing business-to-business markets by selling ingredient crops or seeds to big agricultural companies or seed banks.
Traditionally, farmers mated or cross-pollinated organisms to augment their desired characteristics. It could take decades to cultivate a plant to the desired enhancement for human consumption.
In the 1970s, scientists began genetically modifying organisms (GMOs) by cultivating foreign DNA in a bacteria or virus and then inducing those cells to add their modified DNA into a plant or animal. The modified DNA would typically offer resistance to pests or diseases.
CRISPR opens up new possibilities to modify crops by knocking out or enhancing genes that are already present. "Its more precise, and more accurate and more intuitive than breeding," said Elena Del Pup, a plant genetics researcher at Wageningen University in the Netherlands. "[It] allows us to make very specific edits."
"The hope and the promise of [CRISPR] is that by making a few simple edits, you confer a highly valuable disease resistance trait onto a crop," said Vipula Shukla, senior program officer at the Bill and Melinda Gates Foundation.
If European Union states eventually accept the recent parliamentary vote, they would exempt plants with CRISPR edits from GMO labeling requirements.
The EU has been notoriously strict on GMOs, requiring labeling under consumer "right to know" rules since 1997. Every GMO product must receive EU authorization and a risk assessment.
In the United States, the FDA began requiring clear labeling on consumer products containing GMOs in 2022. In 2018, the USDA decided that CRISPR-edited foods do not need to be regulated or labeled as genetically edited because these modifications could have been done with traditional breeding alone.
Experts think the new EU vote that exempts CRISPR from these rules indicates a willingness to embrace new tools to address the challenges of providing enough food for a growing population facing climate change.
Heres how advocates foresee CRISPR helping the food system become more resilient to climate change.
In agriculture, maximizing yield remains a top priority. Crops that produce more food and use less fertilizer, water and pesticides also decrease embedded emissions.
Pairwise, in collaboration with Bayer, is editing corn that yields more kernels per ear. Another edited corn grows to 6 feet rather than the conventional 9 feet tall.
"The advantage is that it's much sturdier," said Adams. "So if there's a big wind it doesn't get blown over." It also makes applying insecticides, fungicides and herbicides easier.
To engineer the next generation of climate-efficient plants, scientists need to find specific genes in them, such as for controlling water usage or nitrogen fixation.
"One of the biggest limitations [for CRISPR] is our relatively limited knowledge of the biology of the organisms that were trying to edit," Shukla said. "You can't apply CRISPR to a gene if you don't know what the gene does."
Farmers and researchers are field-testing a strain of CRISPR-edited rice designed to resist bacterial blights, which can kill 75 percent of a crop. Rice blight is a particular problem in India and Africa.
Since 2011, The Gates Foundation has been funding field trials of CRISPR rice in India. It has engaged in similar field tests of a virus-resistant corn in Mexico since 2015. "The Gates Foundation wants to come in at a point where there's a testable hypothesis," Shukla said. "We're focusing on developing and delivering these innovations to people."
The foundation looks for preliminary laboratory results or small scale, proven field testing. It then funds a larger scale pilot in real-world conditions in developing countries.
"I don't personally have a lot of faith that we're going to reverse climate change," Adams said. "So, I think we probably should be investing in adapting to it."
Farmers need plants that can survive temperature extremes, including higher nighttime temperatures, as well as erratic rainfall patterns. CRISPR can help native plants adapt to their changing environment by enhancing their genes.
"One of the consequences of climate change is having to move crops into places they havent been before because it's warmer or wetter or drier," Shukla said. "And crops are not adapted to those pests [in the new locations]. We have the ability with gene editing to confer traits that make those crops more tolerant to pests and diseases that they haven't experienced before."
The Gates Foundation is looking at genes for heat tolerance as its next target for research and investment, according to Shukla.
CRISPR technology may also diversify the genetic composition of current crops and domesticate new crops. That could help address the damage done by industrial, monoculture farming practices, in which a single crop species dominates a field or farm, depleting the soil of its nutrients.
"Wild relatives of plants contain traits that can be super-valuable for agriculture," Shukla said. "But we haven't had a way through crossing or other methods to bring those traits into the agricultural system."
If Pairwises mild mustard green becomes a hit, it might offer an incentive for farmers to plant a new leafy green alongside their kale, lettuce and spinach adding to biodiversity.
See the original post:
Why Bayer and the Gates Foundation are using CRISPR to reduce food's climate impact - GreenBiz
CRISPR/Cas9 targeting of passenger single nucleotide variants in haploinsufficient or essential genes expands cancer … – Nature.com
TCGA data acquisition and pre-processing
TCGA SNV data for 16 cancer types (BLCA, BRCA, COAD, GBM, HNSC, KIRC, KIRP, LIHC, LUAD, LUSC, OV, PAAD, PRAD, READ, STAD, and UCEC) were downloaded from the GDC data portal (https://portal.gdc.cancer.gov/, DR-7.0). The mutation files were initially collected as VarScan2 processed protected mutation annotation format (MAF) files. To eliminate low-quality and potential germline variants, we further processed the files according to the guidelines provided by the GDC portal (https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/) to generate high-confidence somatic mutation files. For gene expression analysis, we obtained fragments per kilobase of exon per million mapped fragments (FPKM) data using the TCGAbiolinks19 R package (version 2.26.0). The gene expression values were then normalized to log2(FPKM+1).
The DepMap CRISPR/Cas9 screen dataset20 (https://depmap.org/portal/, DepMap Public 21Q2) was used to collect essential genes. Haploinsufficient genes were compiled from three sources: (1) Vinh T Dang et al.s study11, (2) ClinGen12 (https://clinicalgenome.org, genes with haploinsufficiency scores of 2 or 3, downloaded on January 20, 2021), and (3) DECIPHER13 (https://deciphergenomics.org, genes located in the top 5% probability of haploinsufficiency scores, version 3). Oncogenes were obtained from the COSMIC Cancer Gene Census9 (https://cancer.sanger.ac.uk/census, v94) data by applying the filter Somatic=yes and including genes with the role of oncogene in cancer. Hotspot mutations were annotated using data from the Cancer Hotspots portal3 (https://www.cancerhotspots.org, Hotspot Results V2).
To generate targetable SNVs and the corresponding sgRNA sequences from a given SNV list of a sample, we followed the following steps: First, we identified the SNVs located within essential or haploinsufficient genes. If an SNV was encoded by an essential gene, only homozygous SNVs were further analyzed. Next, we calculated the allele frequency (AF) threshold ({AF}_{cut}) using the following equation:
$${AF}_{cut}={AF}_{M}+MAD(hetAF)$$
(1)
where ({AF}_{M}) is the median of AFs of SNVs from the sample, and (MAD(hetAF)) is the median absolute deviation (MAD) of AFs of heterozygous SNVs from the patient or sample. SNVs with AF below the samples ({AF}_{cut}) were filtered out. We then considered the expression of the gene in which an SNV was located and retained SNVs where the gene expression (log2(FPKM+1)) was greater than 1.
To identify SNVs that generate a novel and specific targetable site for the CRISPR/Cas9 approach, we searched for a PAM sequence (NGG, where N represents any nucleotide) within a 12-base pair region around the SNV or checked if the SNV itself created a new PAM sequence. For the satisfying SNVs, a 20-nucleotide sgRNA sequence was obtained.
To obtain sgRNAs with precise knockout efficiency and low potential off-target effects, we calculated the on- and off-target scores and applied strict cutoffs as follows: First, on-target scores were calculated using the Azimuth 2.015 method implemented in the crisprScore21 R package (version 1.2.0). sgRNAs with on-target scores greater than 0.5 were examined for possible off-target sites using CasOFFinder16 (offline version 2.4). The UCSC human reference genome assembly (GRCh38) was used as a reference, and off-target sites with a maximum of three mismatches were searched. If an sgRNA was found to have off-target sites, the off-target score was calculated using the CFD15 method, which was also implemented in the crisprScore21 R package. If off-target sites with scores>0.175 were present, the sgRNA was filtered out to mitigate potential off-target risks. Finally, the SNVs were reported along with their corresponding sgRNAs, on-target scores, and off-target scores.
All cells were maintained at 37C in a 5% CO2 atmosphere. Human embryonic kidney 293T (HEK293T) cells were purchased from ATCC. HEK293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillinstreptomycin (Invitrogen, USA). Human colorectal cancer cell lines (SNUC4, SW620, and NCIH498) were also purchased from the Korean Cell Line Bank and cultured in RPMI-1640 medium (Gibco) supplemented with 10% FBS and 1% penicillinstreptomycin.
The lentiviral plasmids lentiCas9-Blast and lentiGuide-puro were purchased from Addgene USA (#52,962, #52,963). The sgRNA sequences were cloned following the lentiCRISPR v2 cloning protocol22,23. For transfection, 7.5105 HEK293T cells were seeded in 60-mm plates one day before transfection. Transfection was performed using Opti-MEM I Reduced Serum Medium (Gibco) with 1g of lentiviral plasmid, 0.25g of pMD2.G (#12,259; Addgene), 0.75g of psPAX2 (#12,260; Addgene), and 6 L of FuGENE (Promega, USA). The medium was changed after 16h of incubation at 37C under 5% CO2. Viral supernatants were collected 48 and 72h after transfection, filtered through a 0.45-m membrane (Corning, USA), and stored at -80C. Cells were transduced with lentivirus encoding lentiCas9-Blast to establish stable Cas9-expressing cells, followed by selection with blasticidin (10g/mL) (Invitrogen) for seven days.
Stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the RRP9 SNV of SNUC4 (sgRRP9-SNV). After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL, Invitrogen) for 72h, 1103 cells/well were seeded into six-well plates. The medium was replaced every 72h. After 14days, the medium was removed, and the cells were stained with 0.05% crystal violet solution in a 6% glutaraldehyde solution for 30min. The crystal violet solution was then removed, and the cells were washed with H2O and allowed to dry. Colonies comprising more than 50 cells were counted using the ImageJ software24.
Parental or stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL) for 72h, 1105 cells/well were seeded into six-well plates. After 3days, cells were trypsinized, stained with trypan blue (Bio-Rad, USA), and counted. All harvested cells were seeded onto 60-mm plates. After 3days of incubation, cells were trypsinized and counted with trypan blue again. The subculture was repeated once more using 100-mm plates. Growth curves were generated using cell counts obtained during the subculture.
Total RNA was extracted from SW620 cell line using the RNeasy Plus Mini Kit (QIAGEN, Germany) following the manufacturers instructions. cDNA was synthesized with PrimeScript RT Master Mix (Takara Korea Biomedical Inc, Korea), and full-length RRP9 cDNA was PCR amplified with CloneAmp HiFi PCR Premix (Takara Korea Biomedical Inc). The PCR-amplified RRP9 wild-type cDNA was cloned into pcDNA3 Flag HA (#10,792, Addgene) using In-Fusion HD Cloning Kit (Takara Korea Biomedical Inc). RRP9 sequence was confirmed by Sanger-sequencing.
Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (10g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After a 24h incubation, 2g of empty or RRP9 plasmids were transfected with FuGene HD (Promega) according to the manufacturers protocol. Cell viability was assessed after 4days using Cell Titer Glo (Promega), and relative luminescence units (RLU) were measured using an EnVision plate reader (Perkin-Elmer, USA).
Stable Cas9-expressing NCIH498 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the SMG6 SNV of NCIH498 (sgSMG6-SNV). After selection with puromycin (NCIH498: 10g/mL, SW620: 2g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After 6days, cell viability was determined with Cell Titer Glo according to the manufacturers protocol, and RLU were measured using an EnVision plate reader.
Cells and tissues were harvested, washed with phosphate-buffered saline (PBS), and lysed on ice for 15min in a radioimmunoprecipitation assay buffer (R0278; Sigma, USA) supplemented with a protease and phosphatase inhibitor cocktail (GenDEPOT, USA). Cell lysates were centrifuged at 4C for 10min at 15,000rpm. Protein concentrations were determined using Bradford assay (Bio-Rad). Equal amounts of total protein were separated via sodium dodecyl sulfate gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1h at 22C and then incubated overnight at 4C with a primary antibody against the target protein in a buffer containing 0.1% Tween 20. Subsequently, the membranes were washed with Tween-PBS buffer three times for 10min each and incubated with a secondary antibody (anti-rabbit IgG or anti-mouse IgG) diluted in a blocking buffer containing 0.1% Tween 20 for 1h at 22C. The membranes were then washed with Tween-PBS three times for 10min each. The immunoreactive bands were visualized using Pierce enhanced chemiluminescence western blotting substrate (32,106; Thermo Fisher Scientific, USA). Mouse monoclonal anti-Cas9 (#14,697; Cell Signaling Technology, USA), rabbit polyclonal anti-RRP9 (#ab168845, Abcam, UK), rabbit polyclonal anti-FLAG (DYKDDDDK) (#2368; Cell Signaling Technology) and rabbit monoclonal anti-heat shock protein 90 (HSP90) (#4877, Cell Signaling Technology) and were used at a 1:1000 dilution. Anti-rabbit IgG (#111-035-144; Jackson ImmunoResearch, USA) was used at a 1:5000 dilution except for anti-FLAG which was used at a 1:10,000 dilution. Anti-mouse IgG (#115-035-146, Jackson ImmunoResearch) was used at a 1:10,000 dilution.
Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Libraries were prepared with a two-step PCR reaction, in which the first step uses target-specific primers, and the second step utilizes primers containing unique barcodes and Illumina sequencing adaptor sequences. The primers used here are listed in Supplementary Data 4. PCR reactions were performed with KAPA HiFi HotStart Ready Mix (Roche Molecular Systems, Inc. USA). For the first PCR step, 100ng of genomic DNA was denatured at 95 for 5min, followed by 30 cycles of (98C at 20s, 61C for 15s, and 72C for 15s), and a final extension at 72C for 1min. Primers with unique barcodes and Illumina sequencing adaptor sequences were added to the PCR product from step 1 for the second PCR reaction, where denaturation at 95C for 5min was followed by 12 cycles of (98C at 20s, 61C for 15s, 72C for 15s), and a final extension at 72C for 1min. PCR products were verified with 2% agarose gel electrophoresis and extracted using the Zyomoclean Gel DNA Recovery Kit (Zymo Research, USA) according to the manufacturers instructions. The barcoded PCR products were pooled and subjected to paired-end sequencing (2150bp reads) on an Illumina NovaSeq-6000 instrument (Macrogen, Korea). InDel quantification was conducted using CRISPResso225 with default parameters.
Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Target regions were PCR-amplified with nTaq (Mg2+plus) (Enzynomics, Korea) with the following primers: sgRRP9-SNV region (Forward: 5-TCAAGGCCCTCGTTGATTCC-3, Reverse: 5-TTTTTGGGCTTTGTGGCTGC-3), sgSMG6-SNV region (Forward: 5-TCTGCATCGAAAGTGACACGA-3, Reverse: 5- CTATCAGCCTGGACGACGTTT-3). PCR products were purified with PureLink Quick PCR Purification Kit (Invitrogen). 200ng of purified PCR product were denatured at 95C for 10min, re-annealed at 2C per second temperature ramp to 85C, followed by a 1C per second ramp to 25C. 1l of T7E1 enzyme (Enzynomics) was added to the heterocomplexed PCR product and incubated at 37C for 15min. Products were electrophoresed on a 2% agarose gel using TAE buffer. Band intensities were measured with ImageJ, and the estimated non-homologous end joining (NHEJ) event was calculated with the following formula:
$$NHEJleft( % right) = 100 times left[ {1 - left( {1 - fraction; cleaved} right)^{{left( {frac{1}{2}} right)}} } right]$$
(2)
where the fraction cleaved is (frac{(Density; of; digested; products)}{(Density; of; digested; products,+,undigested; parental; band}).
All animal procedures were approved by the Institutional Animal Care and Use Committee of Yonsei University, Seoul, Korea (2021-0106). All methods were performed in accordance with the relevant guidelines and regulations for the care and use of laboratory animals. Six-week-old female BALB/c-nu Slc mice were purchased from Orient Bio (Korea) and SLC Inc. (Japan). The mice were housed in individual ventilation cages equipped with a computerized environmental control system (Techniplast, Italy). The animal room temperature was maintained at 222C with a relative humidity of 5010%. Before the experiments, the animals were acclimated for seven days under a 12-h lightdark cycle.
Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 10g/mL puromycin for 72h, 3106 cells were subcutaneously injected into the left (control sgRNA) or right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Similarly, stable Cas9-expressing SW620 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 2g/mL puromycin for 72h, 2106 cells were subcutaneously injected into the left (control sgRNA) and right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Among the mice, we excluded those with no observable tumor growth in the left flank (control sgRNA) from further analysis.
Tumor sizes were measured using a caliper, and the volume was calculated using the formula: 0.5lengthwidth2. Mice were sacrificed when the largest tumor reached a volume of 1000 mm3. Each tumor was considered an experimental unit. The sample size was determined to be sufficient to identify statistically significant differences between groups.
Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Whole-exome capture was performed using the SureSelect Human All Exon V4 51Mb Kit (Agilent Technologies, USA). The captured DNA was then sequenced on the HiSeq 2500 platform (Illumina, USA), generating a minimum of 98.9 million paired-end sequencing reads of 100bp per sample.
The Burrows-Wheeler Alignment26 tool was used with the default parameters to align the paired-end reads to the UCSC human reference genome assembly (GRCh37/hg19). An average of 98.3% of the reads were successfully aligned to the human genome. Duplicate reads were removed using the Picard software package. The Genome Analysis Tool Kit (GATK) version 3.446 was used for read quality score recalibration and local realignment to identify short InDels using the HaplotypeCaller27 package. The variants were filtered using the GATK Best Practices quality control filters.
SNVs were identified using Mutect28, specifically the tumor-only option, with default parameters. Variants supported by at least five high-quality reads (Phred-scaled quality score>30) and detected with at least 20% AF were selected for further analysis. The detected SNVs and InDels were annotated using various databases, including the single nucleotide polymorphism (SNP) database (dbSNP29, build 147), 1000 Genomes Project30 (Phase 3), Korean dbSNP (build 20,140,512), and somatic mutations in TCGA colon adenocarcinoma (COAD), using the Variant Effect Predictor software31 (version 87). ANNOVAR32 was used to annotate regions of known germline chromosomal segmental duplications and tandem repeats.
Several steps were performed to filter variants. Patients with germline polymorphisms, chromosomal segmental duplications, or tandem repeats were excluded. The variants were then filtered to include known somatic mutations observed in at least one sample from TCGA COAD dataset. Additionally, nonsynonymous mutations observed in genes belonging to the Cancer Gene Census, as reported in at least ten samples in the COSMIC9 database (version 87), were included in the analysis.
Total RNA was extracted from colorectal cancer cell lines using the RNeasy Plus Mini Kit (QIAGEN) following the manufacturers instructions. The TruSeq RNA Sample Prep Kit v2 (Illumina) was used to generate mRNA-focused libraries. Libraries were sequenced on the HiSeq 2500 platform, generating at least 40 million paired-end reads of 100bp per sample.
The TopHat-Cufflinks33 pipeline was employed to align the reads to the reference genome and calculate normalized gene expression values in FPKM. TopHat was used to align and map the reads to the reference genome. The resulting alignments were then processed using Cufflinks, which estimates transcript abundance and calculates FPKM values, providing a measure of gene expression levels that takes the length of exons and the total number of mapped reads into account.
R (ver. 4.2.1) (R Foundation, Austria) and the ImageJ software were used to analyze the data.
The figures were generated using the R software, and statistical analyses were performed using RStudio software (version 2022.07.2+576). Specific statistical tests are identified in the figure legends for each experiment.
The study design, animal use and all experimental methods were conducted and reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).
Go here to read the rest:
CRISPR/Cas9 targeting of passenger single nucleotide variants in haploinsufficient or essential genes expands cancer ... - Nature.com
CRISPR drug licensing deals secure $21bn in top three therapy areas over five years – Pharmaceutical Technology
Figure 1: Total deal value by deal therapy area of licensing agreements for innovator drugs utilising the CRISPR system, globally, 2019-2024, year to date. Credit: GlobalData.
Licensing agreements for innovator drugs utilising clusteredregularly interspaced short palindromic repeats (CRISPR) technologies saw oncology, immunology, and central nervous system as the top three therapy areas by total deal value with a combined $21bn over the past five years.
Furthermore, haematological disorders saw almost three times more licensing agreement deal value in 2022 compared to 2020, reaching a total deal value of $1.8bn in the past five years (Figure 1), as reported by GlobalDatas Pharma Intelligence Center Deals Database.
This highlights the growing importance of advancements in CRISPR for haematological disorder therapies.
In December 2023, the US Food and Drug Administrations approval of Casgevy, the first CRISPR and CRISPR-associated protein 9 (Cas9) genome editing therapy developed by Vertex Pharmaceuticals and CRISPR Therapeutics for sickle cell disease and beta thalassemia represented a major milestone in gene therapy.
Casgevy precisely edits DNA in blood stem cells by utilising CRISPR/Cas9 technology, involving taking the patients bone marrow stem cells and enhancing their expression of fetal haemoglobin before reintroducing these edited stem cells back into the patient.
This restores healthy haemoglobin production in patients with sick cell disease and beta thalassemia, effectively alleviating the symptoms of these diseases.
Access the most comprehensive Company Profiles on the market, powered by GlobalData. Save hours of research. Gain competitive edge.
Your download email will arrive shortly
We are confident about the unique quality of our Company Profiles. However, we want you to make the most beneficial decision for your business, so we offer a free sample that you can download by submitting the below form
Country * UK USA Afghanistan land Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Sint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos Islands Colombia Comoros Congo Democratic Republic of the Congo Cook Islands Costa Rica Cte d"Ivoire Croatia Cuba Curaao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Holy See Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati North Korea South Korea Kuwait Kyrgyzstan Lao Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macao Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Runion Romania Russian Federation Rwanda Saint Helena, Ascension and Tristan da Cunha Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and The Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and The South Sandwich Islands Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syrian Arab Republic Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates US Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam British Virgin Islands US Virgin Islands Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe Kosovo
Industry * Academia & Education Aerospace, Defense & Security Agriculture Asset Management Automotive Banking & Payments Chemicals Construction Consumer Foodservice Government, trade bodies and NGOs Health & Fitness Hospitals & Healthcare HR, Staffing & Recruitment Insurance Investment Banking Legal Services Management Consulting Marketing & Advertising Media & Publishing Medical Devices Mining Oil & Gas Packaging Pharmaceuticals Power & Utilities Private Equity Real Estate Retail Sport Technology Telecom Transportation & Logistics Travel, Tourism & Hospitality Venture Capital
Tick here to opt out of curated industry news, reports, and event updates from Pharmaceutical Technology.
Submit and download
Figure 1 shows innovator drugs harnessing CRISPR systems saw 182% growth in total licensing agreement deal value from $5.6bn in 2020 to $15.8bn in 2022, according to GlobalDatas Pharma Intelligence Center Deals Database.
Oncology represented more than half of the total deal value for the top three therapy areas with $11.9bn, followed by immunology with $6.7bn, and central nervous system with $2.3bn, according to GlobalDatas Pharma Intelligence Center Deals Database.
Pharma giants such as Lily and Sanofi have recently partnered with companies developing CRISPR-based technologies.
Last year, Prevail Therapeutics, a subsidiary of Lily, secured exclusive rights to Scribe Therapeutics CRISPR X-Editing (XE) technologies for $1.65bn.
This licensing agreement, aimed at developing genetic therapies for neurological and neuromuscular diseases, stands as the largest CRISPR-based deal of the year.
Concurrently, Sanofi expanded its collaboration with Scribe in July 2023, with a deal worth up to $1.24bn, focusing on leveraging Scribes XE genome editing technologies for the development of in vivo therapies, particularly sickle cell disease and other genomic disorders.
Moreover, Lilys expertise in cardiometabolic diseases prompted the company to partner with Beam Therapeutics in October last year.
This agreement, valued at up to $600m, involved acquiring rights held by Beam in Verve Therapeutics, a gene-editing company focused on single-course gene editing therapies for cardiovascular disease.
This includes Verves programmes targeting PCSK9 and ANGPTL3, both set for clinical initiation this year.
CRISPR technology is revolutionising targeted gene therapies for various unmet diseases by precisely targeting diverse genomic sites.
This advancement in precision medicine offers hope for more tailored treatments and improved patient outcomes.
Furthermore, the growing number of CRISPR-based therapies in clinical trials is expected to fuel significant interest and drive further progress in this field.
View original post here:
CRISPR drug licensing deals secure $21bn in top three therapy areas over five years - Pharmaceutical Technology
Synthego Announces CEO Transition to Focus on Enabling CRISPR Therapeutics – PR Newswire
Leadership change simultaneous to the Eclipse Cell Engineering platform spinout asEditCo Bio
REDWOOD CITY, Calif., March 27, 2024 /PRNewswire/ -- Synthego Corporation, a leading provider of genome engineering solutions, announced that Paul Dabrowski will step down as Chief Executive Officer, effective immediately. Craig Christianson has been appointed Chief Executive Officer following an extensive search process. Mr. Dabrowski, a co-founder of the company, will continue his role as a Board Director and advisor. Additionally, the company announces the divestiture of the Eclipse Cell Engineering platform as EditCo Bio, Inc., enablingSynthego's unique focus on therapeutic applications of CRISPR.
"Founding and growing Synthego the past 12 years has been the privilege of a lifetime," said Dabrowski. "Our team has transformed the CRISPR landscape by staying true to our values and providing everyone, from individual scientists to the world's leading biotechnology companies, with unprecedented access to advanced genome engineering. I'm confident Craig is an ideal fit to further our mission by building a robust commercial engine leveraging Synthego's platform - in addition to his impeccable track record, he embodies Synthego's culture of innovation and excellence. As the world enters the era of CRISPR based therapeutics, Synthego is now focused to be the premier supplier to hundreds of programs entering the clinic."
Christianson has a track record of spearheading global commercial strategies, business development and operations to build global life sciences and other businesses. He joins Synthego from Water Street Healthcare Partners, preceded by 12 years with global biotechnology company Promega Corporation where he led commercial operations, accelerating their growth to $700M+ in annual sales through profit-driven strategies and successful digital transformation.
"I am honored to join this pioneering organization which plays an important role in the impact CRISPR has on life science research and clinical development," said Christianson. "Paul is a visionary who has built a foundation upon which Synthego will become the best partner for clients in terms of co-development and regulatory compliance for the advancement of therapies and, ultimately, human health."
Christianson's appointment, along with the spinout of EditCo Bio, previously operating as Synthego's Eclipse platform, reinforces Synthego's commitment to provide CRISPR therapeutic developers with best-in-class guide RNAs. With its state-of-the-art GMP facility and extensive experience of producing leading products, Synthego is uniquely positioned to address escalating clinical requirements and changing regulatory frameworks. Bolstered by the FDA approval of the first CRISPR-based therapy, Synthego is more dedicated than ever to accelerating life-saving technologies for improved human health in its next chapter.
For more information, click here.
About Synthego:Synthego is a genome engineering company that enables the acceleration of life science research and development in the pursuit of improved human health. Based on a foundation of engineering and chemistry, Synthego leverages automation and machine learning to synthesize high-quality CRISPR reagents for science at scale. Synthego's mission is to enable agile life science research and development from discovery through clinical trials by providing scientists with comprehensive CRISPR solutions for each phase coupled with full technical and regulatory support from industry-leading experts. With its technologies cited in hundreds of peer-reviewed publications and utilized by thousands of commercial and academic researchers and therapeutic drug developers, Synthego is at the forefront of innovation, enabling the next generation of medicines by delivering genome editing at an unprecedented scale.
SOURCE Synthego
Read more:
Synthego Announces CEO Transition to Focus on Enabling CRISPR Therapeutics - PR Newswire
New Genetic Analysis Tool Tracks Risks Tied to CRISPR Edits – University of California San Diego
The new Integrated Classifier Pipeline system uses genetic fingerprints to identify unintended bystander CRISPR edits. A confocal microscope image of an early blastoderm-stage nucleus in aDrosophila(fruit fly) embryo uses colorful fluorescent markers to highlight the homothorax gene undergoing transcription from two separate parental chromosomes (two distinct signal clusters). Credit: Bier Lab, UC San Diego
The ICP system can cleanly establish whether a given individual insect has inherited specific genetic components of the CRISPR machinery from either their mothers or fathers since maternal versus paternal transmission result in totally different fingerprints, said Bier, a professor in the UC San Diego School of Biological Sciences.
The ICP can help untangle complex biological issues that arise in determining the mechanisms behind CRISPR. While developed in insects, ICP carries vast potential for human applications.
There are many parallel applications of ICP for analyzing and following CRISPR editing outcomes in humans following gene therapy or during tumor progression, said study first author Li. This transformative flexible analysis platform has many possible impactful uses to ensure safe application of cutting-edge next-generation health technologies.
ICP also offers help in tracking inheritance across generations in gene drive systems, which are new technologies designed to spread CRISPR edits in applications such as stopping the transmission of malaria and protecting agricultural crops against pest destruction. For example, researchers could select a single mosquito from the field where a gene-drive test is being conducted and use ICP analysis to determine whether that individual had inherited the genetic construct from its mother or its father, and whether it had inherited a defective element lacking the defining visible markers of that genetic element.
The CRISPR editing system can be more than 90 percent accurate, said Bier, but since it edits over and over again it will eventually make a mistake. The bottom line is that the ICP system can give you a very high-resolution picture of what can go wrong.
In addition to Li and Bier, coauthors included Lang You and Anita Hermann. Prior Bier lab member Kosman also made important intellectual contributions to this project.
Funding for the study was provided primarily by an award from the Bill and Melinda Gates Foundation.
Competing interest disclosure: Bier has equity interest in two companies he co-founded: Agragene Inc. and Synbal Inc., which may potentially benefit from the research results. He also serves on Synbals board of directors and the scientific advisory boards for both companies.
Read this article:
New Genetic Analysis Tool Tracks Risks Tied to CRISPR Edits - University of California San Diego
Developmental progression of DNA double-strand break repair deciphered by a single-allele resolution mutation … – Nature.com
ICP: an integrated pipeline for classifying CRISPR/Cas9 induced mutant alleles
We developed an integrated bioinformatic tool ICP (Integrated Classifier Pipeline), to parse complex DSB repair outcomes induced by CRISPR/Cas9 and automatically call for experimental errors generated during NGS library preparation and sequencing: 1) a Nucleotide Position Classifier (NPClassifier), and 2) a Single Allele-resolution Classifier (SAClassifier). We employed these two complementary sequence analysis modules in tandem to enable in-depth interpretation of deep sequencing data at single allele resolution (Fig.1ac, see Methods section for detailed description of ICP tools). In line with the unique DNA signatures generated by distinct DSB repair pathways, we categorized the repair products into four major categories. Alleles with a deletion only on the PAM-distal side (PAM-proximal side was protected by Cas9 protein after cleavage), a common category, were termed as PEPPR class mutations (PAM-End Proximal Protected Repair, PEPPR)41,42. While single strand cleavage by the Cas9 RuvC domain can also nick the non-complementary strand at locations beyond the canonical site between the 6th and 7th nucleotide upstream of the PAM sequence, we restrict our analysis here to the majority cases wherein Cas9 cleavage generates blunt DSB ends to simplify the robust classification scheme developed in this study43,44,45. Mutant alleles judged to be generated by directly annealing 2bp microhomology sequences spanning the gRNA cleavage site were assigned into MMEJ class (again acknowledging that such alleles can also be generated with 1bp microhomology sequence, which however, are not readily amenable to the semi-automated analysis we developed)46,47,48, while pure deletion alleles not belonging to either the PEPPR or MMEJ categories were classified as DELET class mutations. Remaining alleles that include insertions-only and indels (deletion plus insertion) were categorized as insertion class (INSRT) mutations (Fig.1b).
The process of DSB repair pattern profiling consists of preparing a NGS library (a), classifying the resulting parsed alleles (b) and displaying processed alleles by rank order and class of mutations (c). a NGS library preparation: Genomic DNA from F1 test flies carrying both Cas9 and gRNA expressing cassettes either maternally (dark blue bars) or paternally (red bars, or progeny from other designated crosses) are subjected for targeted PCR amplification with primers containing Illumina compatible adapters at the 5 terminal to detect somatic indels. The gray rectangle represents a short region of genomic DNA containing a Cas9/gRNA target: purple circle depicts Cas9 protein and sky-blue line is gRNA. b Classification: Raw NGS data are subjected to the NPClassifier to parse alleles into specific primary categories required for building allelic dictionaries used by the SAClassifier. Four major indel groups are categorized: PEPPR (PAM-End Proximal Protected Repair, sky-blue), MMEJ (Microhomology Mediated End-Joining, dark pink), DELET (deletion, any deletions do not belong to PEPPR and MMEJ, orange) and INSRT (insertion, including the alleles only with inserted nucleotides or had deletions and insertions, purple). The 24-nt short PEPPR, MMEJ and DELET dictionaries are used for a more accurate classification and error calling by binning together all alleles with the same seed region that match primary allelic entries in the SAClassifier dictionaries. c DSB repair pattern visualization: intuitive rendering of the processed raw sequence data as an output of rank ordered classes of alleles. Allelic classes derived from NGS sequencing of individual flies or mosquitoes are displayed by their ranked frequency (allele landscape) and repair pattern fingerprints (color-coded by categories).
Briefly, raw reads generated from deep sequencing were subjected to a preliminary categorization using the NPClassifier, which recognizes the relative positions of editing start- and end-points flanking Cas9 cleavage site and then generates a collection of priori alleles for each category. These primary outputs (MMEJ and DELET) were used for building full-length standard comprehensive dictionaries listing all observed mutations and derived 24-nt short dictionaries (with the same seed region flanking the Cas9 cleavage site) as inputs of the SAClassifier. In addition, a synthetic PEPPR dictionary was built by iteratively increasing the length of deletions by a single nucleotide distal to the PAM site, excluding alleles belonging to the MMEJ category. By fishing the raw reads with 24-nt dictionaries, we were able to automatically recognize reads that also contained experimentally generated errors (e.g., from PCR amplification), which usually are located outside of the narrow 24-nt short dictionary window, thereby assigning such composite alleles to correctly matched root alleles (Fig.1b). These dual iteratively employed ICP classification tools provide a robust and precise classification of CRISPR/Cas9 induced DSB repair outcomes. Next, we developed an evocative user-friendly interface to visualize processed allelic category information in the form of rank ordered allelic landscape plots and repair pattern fingerprints (color-coded DSB repair categories), both of which are sorted by read frequency (Fig.1c). These intuitively accessible data outputs are far more informative and discriminating than the unprocessed primary DNA sequence reads (e.g., compare the seemingly idiosyncratic raw lesions depicted in Fig.2a to the obviously unique processed and concordant replicate patterns shown Fig.2b, c). The ICP was thus employed to visualize results in all the following experiments.
a Examples of the top five somatic indels from individual flies derived from split-drive crosses in which the Cas9 transgene is inherited either maternally (Maternal-S, left) or paternally (Paternal-S, right), but separately from a cassette carryingthe gRNAtransmittedby the other parent. Purple stars indicate the color codes for mutation categories (dark pink: MMEJ, sky-blue: PEPPR, orange: DELET, purple: INSRT) and dark green star indicates the separate raw sequence color coded for the four nucleotides A, T, G, and C. The red bar indicates Paternal-S crosses while dark blue bar represents Maternal-S crosses. b Landscapes of top 50 alleles ranked by reads ratio. All six sequenced individual flies are plotted together, with dark blue lines plotting the data from Maternal-S crosses and the red lines from Paternal-S crosses. The y-axis presents the fraction of reads for a given allele and the x-axis depicts the top 50 alleles according to rank order by read frequency. c DSB repair fingerprints for three representative sequenced individual flies from each cross. The x-axis is the same as depicted in panel b. Both panels show the top 50 ranked alleles. d. Bar plots of Class Fraction for top 50 alleles. Color codes for classes are as in panels a and c. Correlation analysis of two out of three replicates from Maternal-S cross (e) or Paternal-S (f) cross. r2 values and p-values are indicated. Source data for panels b, d, e and f are provided as a Source Data file.
Since DSB repair outcomes have been found to vary considerably as a function of Cas9 or gRNA source and level49,50, we employed the ICP platform to parse somatic indels generated by co-expressing Cas9 and gRNAs in somatic cells of fruit flies (Drosophila melanogaster) and mosquitoes (Anopheles stephensi) in various configurations associated with gene-drive systems. We first applied ICP analysis to a split gene-drive system inserted into the Drosophila pale (ple)gene that is designed to detect copying of a gene cassette in somatic cells. This element, referred to as a CopyCatcher (pleCC), carries a gRNA targeting the first intron of Drosophila ple locus49. In this current study, we make use of low-level ectopic somatic Cas9 expression (which is substantial and broad for vasa-Cas9) to analyze DSB repair patterns across diverse cell types in F1 progeny carrying both Cas9 and gRNAs51,52,53. Because cells actively undergoing meiosis make up only a small fraction of dividing cells in an adult fly, the mutational effects of Cas9/gRNA cleavage in such F1 individuals largely reflect the somatic action of these nuclease complexes. We thus conducted several alternative crossingschemes to assess the somatic mutagenic activity of vasa-Cas9 and gRNA components when transmitted to F1 individuals in various configurations from their F0 parents: 1) Maternal Split (Maternal-S, females carrying vasa-Cas9 crossed with males carrying pleCC); 2) Paternal Split (Paternal-S, males carrying vasa-Cas9 crossed with females carrying pleCC); and 3) Maternal Full (Maternal-F, females carrying both the pleCC and vasa-Cas9 transgenes); or Paternal Full (Paternal-F, males carrying both the pleCC and vasa-Cas9 transgenes)49. Comparative ICP analysis revealed several striking and consistent differences between the prevalent somatic mutations generated in individual progeny in each of these different crossing schemes. In the case of Paternal-S crosses, the resulting mutations were dominated by PEPPR alleles (4 out of top 5 alleles in Fig.2a, Fig. S1a, and 70% of the top 50 alleles as rendered in rank ordered allelic landscapes and color coded DSB repair fingerprints in Fig.2c). In contrast, Maternal-S crosses primarily generated MMEJ and INSRT indels (4 out of top 5 alleles were MMEJ, and at least 50% of the top 50 alleles were INSRT mutations, Fig.2a, c, Supplementary Fig. S1a). These differences were also evident in the steeper allelic landscape curves that were generated from the Maternal-S versus Paternal-S crosses (Fig.2b) as characterized by the initial portion of the curve depicting the 5 most frequent alleles (i.e., the dark blue lines in Fig.2b are all above the red lines for the 5 most frequent alleles). We further quantified differences in allelic profiles between crosses by bar plots displaying the summed proportions of the different allelic classes (summing the percentages of all alleles from each category) which we termed as Class Fraction (Fig.2d). This analysis revealed that INSRT alleles were generated at a significantly higher frequency in Maternal-S crosses, while the PEPPR class dominated among the top 50 alleles in the reciprocal Paternal-S crosses (Fig.2d).
A striking feature of the highly divergent DSB repair signatures generated from maternally versus paternally inherited Cas9 sources was the remarkable reproducibility of their DSB repair fingerprints observed across three individual replicates from each cross (Fig.2e, f). We performed a correlation analysis within replicates by extracting 23 common alleles across all six sequenced flies and plotted the resulting allelic profiles together relative to an arbitrarily chosen Paternal-S replicate as reference (bold red line, Supplementary Fig. S1b). We observed that the frequency distributions of these 23 common alleles were much more similar to each other within intra-cross comparisons than between inter-crosses (Supplementary Fig. S1b). This trend was also revealed by higher correlation coefficients for intra-cross comparisons than for inter-cross comparisons based on allelic read ratios (Supplementary Fig. S1cg). Conspicuous defining differences between the Maternal-S and Paternal-S fingerprints were also evident based on the Class Fraction index (Fig.2d). In summary, a variety of differing statistical measurements all underscore the robust consistent similarities shared among allele profiles generated from individual replicates of same cross and clearly distinctive DSB repair pattern fingerprints generated by maternal versus paternal Cas9 inheritance.
We extended our ICP analysis of mutant allele profiles generated in the ple locus to the more extreme Maternal-F (dark blue lines) and Paternal-F (red lines) cross schemes to assess the role of inheritance patterns when both the source of vasa-Cas9 and gRNA originated from a single parent49. Again, we observed highly dominant alleles in the Maternal-F crosses, clearly evident in allelic landscapes, that deviated markedly from those produced by the Paternal-F crosses, which produced more evenly distributed spectra of alleles spread across a broad range of allelic frequencies (Fig.3a, b). As expected based on these large differences, the repair pattern fingerprints generated from different crosses produced clearly distinguishable patterns of mutation classes, which was particularly evident when considering the Class Fraction (Fig.3e). Cumulatively, these data suggest that the developmental timing and/or levels of Cas9 expression (maternal, early zygotic, or late zygotic) are likely to play a key role in determining which particular DSB repair pathway or sub-pathway is engaged in resolving DSBs.
ad Unique DSB repair signatures obtained using different Cas9 sources are displayed with the top 20 alleles (landscapes and DSB repair pattern fingerprints). NGS sequencing was performed on pools of 20 adults. a vasa-Cas9 inserted in the X chromosome and the pleCC element carrying the gRNA were both carried by either female or male parents, mimicking a full-drive configuration (Maternal-F and Paternal-F crosses with vasa-Cas9). b vasa-Cas9 split crosses wherein the Cas9 transgene was transmitted either maternally (Maternal-S) or paternally (Paternal-S) and the pleCC gRNA bearing cassette was carried by the other parent. Same Maternal-S versus Paternal-S crosses as in panel b, but using either actin-Cas9 (c) or nanos-Cas9 (d) sources. e Class Fraction Index for crosses in panels ad. Bars are shaded according to allelic class color codes. f UMAP embedding for visualizing a common set of 59 alleles shared between the four split crosses with actin-Cas9 and vasa-Cas9. Dots represent single alleles, and the colors indicate the allelic category. g Distribution of top 20 alleles generated from single flies derived from across between parents carrying theSpo11 gRNA and vasa-Cas9elements (Paternal-S cross: red lines and Maternal-S cross: dark blue lines). The top plot shows the allelic landscape for the top 20 alleles from all six sequenced single flies and the bottom shows three examples of the classification fingerprints (with all allelic classes condensed into single rows) color coded for the allele categories. h Class Fraction Index for Spo11 gRNA crosses. i, j Correlation analysis between two replicates from each cross. Dark blue is Maternal-S and red is for Paternal-S. r2 values and p-values are indicated. Source data are provided as a Source Data file.
Previous studies have shown that the relative frequencies of NHEJ versus HDR events depend on the source of Cas9 both in terms of timing and level of expression49,50,54. We thus wondered whether ICP analysis would similarly reveal distinct DSB repair outcomes for two additional Cas9 sources (actin-Cas9 and nanos-Cas9, expressing level of Cas9: actin-Cas9>vasa-Cas9>nanos-Cas9) inserted at the same locus with vasa-Cas9 (Fig.3c, d)49.
As was observed for the vasa-Cas9 source, the actin-Cas9 and nanos-Cas9 sources both generated differing allelic landscapes and repair pattern fingerprints when transmitted maternally versus paternally, which also were readily distinguishable from each other (Fig.3bd). Mirroring results with the vasa-Cas9 source, significant differences between the proportions of PEPPR versus MMEJ class among the top 20 alleles were observed in Maternal-S versus Paternal-S crosses for actin-Cas9. For the nanos-Cas9 source, both the MMEJ and INSRT categories were particularly reduced in Paternal-S crosses, although this latter sex-based difference was not as dramatic as for the other Cas9 sources (presumably due to its more germline restricted expression, Fig.3d)55,56. Overall, the general trend once again indicated that maternally inherited Cas9 sources biased somatic DSB repair outcomes in favor of MMEJ and INSRT classes over PEPPR alleles, while paternal transmission of Cas9 generated mutant alleles dominated by PEPPR class alleles (Fig.3e).
Based on the overall similarities of the DSB repair outcomes observed for actin-Cas9 and vasa-Cas9 crosses, we extracted a set of 59 shared alleles that appeared in all sequenced samples and performed UMAP (Uniform Manifold Approximation and Projection) analysis to cluster these common alleles, condensing them into 5 distinct clouds (Fig.3f). Clouds 1, 2, 3, and 4 were dominated by alternative subsets of PEPPR alleles distinguished primarily by the length of deletion (the average deletion sizes were 24bp, 40bp, 31bp for PEPPR Mini, Midi-I and Midi-II cluster, and it was longer than 55bp for PEPPR Maxi cluster), while cloud 5 was predominantly comprised of MMEJ alleles. We reviewed raw sequences for the few trans-cloud assigned alleles and discovered that some of these alleles could be interpreted as having been generated from a second round of repair using one of the core alleles from the same cloud as a repair template. For example, we inferred that allele 58 was actually a PEPPR deletion with several nucleotides potentially having been back-filled. This result is consistent with the previous report that alleles with insertions or complex repair outcomes would be generated from several rounds of synthesis following the generation of a primary deletion event57,58. Assessing the impact of such potential complexities, which we ignore here for simplicity, will require additional future scrutiny. The remainder of these alleles, such as allele 44, could be accounted for variability in the exact Cas9 cleavage site (between the 6th and 7th nucleotidescounting from the PAMside), with an extra nucleotide being deleted on the PAM-proximal side of the gRNA cleavage site (Fig.3f)43,59,60. Since both of these outcomes were rare, we hypothesized second-order origins for such outlier alleles further validate the robust nature of our ICP platform in recognizing core primary categories of DNA repair outcomes. We also analyzed the common 59 alleles by plotting their read frequencies and observed that the differences between the allelic landscapes for the two reciprocal crosses per each Cas9 source mirrored the trend in Fig.3ad described above (Supplementary Fig. S2a, b). Cumulatively, these concordant findings support a key role for theparental origin of Cas9 servingas a major determinant of the DSB repair outcome.
Another obvious determinant of DSB repair outcome is the local genomic DNA context. We assessed the general applicability of theICP by employing it to classify alleles generated by gRNAs targeting four other loci: prosalpha2 (pros2), Rab11, Spo11 and Rab5 using the vasa-Cas9 source61. Paralleling our findings from the ple locus, we observed divergent allelic profiles between Paternal-S and Maternal-S crosses with distinct dominant mutation categories based on the specific target site. For example, the predominant allelic classes generated at the Spo11, pros2 and Rab11 loci were PEPPR and INSRT alleles, while PEPPR and MMEJ alleles were most prevalent for the Rab5 targets (Fig.3g, h, Supplementary Figs. S36). Among these four targets, Spo11 displayed the greatest divergence in the prevalence of top alleles generated from Maternal-S and Paternal-S crosses (reminiscent of the fine distinctions parsed for the ple locus, Fig.3g). We nonetheless still observed high correlation coefficients between two replicates within the same cross and significantly lower correlation coefficients associated with inter-cross comparisons between maternal versus paternal Cas9 inheritance (averaged r2=0.33, Fig.3i, j, Supplementary Fig. S3). We also observed distinctive sex-specific DSB repair patterns for Cas9 transmission at the pros2 and Rab11 gRNAs targeting sites (Supplementary Figs. S4 and S5), although these differences were less pronounced than for ple and Spo11 gRNAs, while for Rab5, the allelic patterns were similar for both maternal and paternal crosses (Supplementary Fig. S6, see Supplementary Discussion Section). In summary, these data support the broad utility of the ICP pipeline to deliver unique discernable locus-specific fingerprints associated with distinct parental inheritance patterns of Cas9 that generalize to other genomic targets.
Given the strong Cas9 inheritance-dependent distinctions observed for allelic profiles resulting from maternal versus paternal Cas9/gRNA-induced DSBs in Drosophila, we wondered whether similar DSB repair pattern fingerprints could be discerned in mosquitoes carrying a linked full gene-drive in which the Cas9 and gRNA transgenes are carried together in a single cassette62,63,64,65. We examined this possibility using the transgenic An. stephensi Reckh drive,which is inserted into the kynurenine hydroxylase (kh) locus63. Because of the Cas9 and gRNA linkage, the Reckh drive behaves as the Maternal-F and Paternal-F cross configurations described above in which all CRISPR components are carried by a single parental sex63.
Consistent with our observations in flies, the Reckh Maternal-F crosses generated a high proportion of indels that were dominated to a remarkable extent by single mutant alleles with read percentages exceeding 85% for each of the three single mosquitoes sequenced, followed by a long distributed tail of lower frequency alleles. The highly biased nature of the replicate allelic distributions is readily revealed by a virtual step-function in their rank-ordered allelic landscapes (Fig.4a). In striking contrast, over 50% alleles recovered from the Paternal-F crosses were wild-type (WT), which presumably reflects alleles that either remained uncut or DSB ends that were rejoined accurately without further editing. The highly predominant WT allele was followed by a very shallow tail distribution of low frequency mutant alleles in the paternal rank-ordered allelic landscapes (Fig.4a). This dramatic difference in allelic profiles between Maternal-F versus Paternal-F crosses was also clearly displayed by the class-tally bars color coded for the different fractions of each class (black = WT) located beneath each landscape (Fig.4a). Here, the Class Fraction Index measure indicated that Maternal-F crosses generated a greater proportion of INSRT alleles in the first two samples, while Paternal-F crosses produced a high frequency of PEPPR alleles (Fig.4b). As in the case of allelic profiles recovered at the ple and Spo11 loci in flies, common sets of highly correlated mutant DSB repair fingerprints were observed across all three replicates of the Paternal-F Reckh crosses (Supplementary Fig. S7). A similar comparison of allelic distributions in the maternal crosses was precluded by virtue of the single highly dominant alleles and corresponding paucity of lower frequency events, the nature of which varied greatly between replicates. We conclude that the high-resolution performance of the ICP platform in Drosophila can be generalized to other insects such as An. stephensi to robustly discern sex-dependent CRISPR transmission patterns resulting in distinct DSB repair outcomes.
a Rank-ordered landscapes of the top 50 alleles generated from NGS analysis of single mosquitoes. Colored bars with red dots indicate mutated alleles, and black bars with black dots indicate an unmutated WT allele. Middle panels: allelic class fingerprints color coded as in previous figures. Bottom bars: fraction of each allelic class, including WT (black), PEPPR (sky-blue), MMEJ (deep pink), DELET (orange) and INSRT (purple). Numbers indicate the percentage of the corresponding class. b Class Fraction Index for single mosquito sequencing data in panel a. c Developmental time-points for sample collections. d Kinetics of Cas9 mutagenesis generated by the Reckh gRNA. Lines represent the summed fraction of mutant alleles at each time-point. Dark-blue lines indicate maternal (Maternal-F) crosses and red lines paternal (Paternal-F) crosses. e DSB repair fingerprints at different timepoints. Samples were collected at the time points shown in panel c and 20 eggs, larvae, pupae or adults were pooled together for genomic DNA extraction and deep sequencing. The far left and far right panels indicate the Class percentages including WT alleles (black), displaying the proportion of each class at single time-points. Source data are provided as a Source Data file.
Given the dramatic differences we observed in the frequency and nature of somatic alleles generated in maternal versus paternal-sourced Cas9 in both flies and mosquitoes, we wondered whether the developmental timing of Cas9/gRNA expression (maternal=early? and paternal=late?) was the key determinant for these highly reproducible DSB repair fingerprints. We tested this hypothesis by assessing whether DSB repair fingerprints varied as a function of developmental progression using a series of narrowly timed sample collections of F1 mosquitoes produced from crosses of Reckh parents to WT and assayed DSB repair spectra using the ICP pipeline at 12 different developmental stages (Fig.4c. Note: as homozygous Reckh transgenic mosquitoes were crossed to WT, all F1 progeny carried one Reckh allele and one WT receiver allele, the latter of which was amplified for DSB repair analysis). We tracked a diminishing proportion of WT (presumably uncut) alleles and a corresponding increase in mutant alleles of various classes at each of the time points (Fig.4d). Strikingly, nearly half of the target alleles were edited in embryos by 30minutes post-oviposition for both the Maternal-F and Paternal-F Reckh crosses, which corresponds to early pre-blastoderm stages prior to the maternal-to-zygotic transition, suggesting a very early activity of Cas9 in mosquito embryos driven either by maternally inherited Cas9/gRNA complexes or potentially by very early zygotic expression of the Cas9 and gRNA components (Fig.4d)66. We also observed similarly frequent indels being generated as early as 30min in flies expressing Cas9 (either maternally or paternally) with a gRNA targeting the pros2 locus, although the dynamics of Cas9 production are distinct in these two organisms (Supplementary Fig. S8a). Following this initial surge in target cleavage, we observed divergent trajectories in the accumulation of mutant alleles between maternal versus paternal lineages. As an overall trend, mutant alleles accumulated progressively in the Maternal-F lineage until virtually no WT alleles remained, while in Paternal-F lineage, even at the endpoint of adulthood, approximately 60% of WT alleles persisted, in line with our single time point experiments (Fig.4a, d, Supplementary Fig. S8b). As observed in the final distributions of adult alleles, progeny from Maternal-F crosses tended to be enriched for INSRT alleles over the entire developmental time course, while PEPPR alleles were more common in Paternal-F crosses with pronounced accumulation of such alleles during later stages (Fig.4e). A finer scale analysis of the categories of mutant alleles generated over time revealed dynamic patterns of prevalent alleles during mosquito developmental stages (Fig.4e). For example, the proportion of MMEJ alleles peaked at the 2-hour and 4-hour time points (Fig.4e). Similarly, a split-drive expressing a gRNA targeting the Drosophila pros2 locus generated distinct temporal profiles of cleavage patterns in crosses from female versus male parents carrying the drive element (Supplementary Fig. S9).
One unexpected feature of the developmental variations in allelic composition we observed was that the proportion of WT alleles increased at certain time points (e.g., 1-hour in maternal cross and 12-hour - day 1=24h in paternal cross). These temporal fluctuations were also observed in flies expressing Cas9 and a pros2 gRNA at two hours after oviposition (Supplementary Figs. S8a and S9), revealing that this phenomenon might reflect a generally relevant form of clonal selection for WT cells during pre-blastoderm stages. The latter clonal selection might arise if mutant cells experienced negative selection at certain development stages. In the case of paternal transmission, one strong line of evidence supporting this WT clonal selection hypothesis is that in adults, the Reckh element is transmitted to over 99% of F1 progeny, indicating that nearly all target alleles in the germline must be WT. This high frequency of paternal germline transmission is also consistent with the high prevalence of WT alleles tallied at 12h in embryos derived from the paternal crosses (Fig.4e, see Supplementary Discussion Section for more in-depth consideration of this point). We analyzed the developmental distributions of 21 common alleles that were generated at all time-points (Supplementary Fig. S10ae). Most of these common alleles belonged to the PEPPR class, while only five were INSRT alleles, despite the INSRT class overall being the most prevalent for both crosses, again suggesting that INSRT alleles have a higher diversity than other mutation categories (Supplementary Fig. S10a). Overall, this analysis is in line with our previous observation that Maternal-F crosses produced more INSRT alleles while Paternal-F crosses generated a preponderance of PEPPR alleles (Supplementary Fig. S10b).
Given the strong influence of maternal versus paternal origin of Cas9 on the resulting distributions of alleles characterized above by ICP analysis, we wondered whether such allelic signatures could be exploited for lineage tracing in randomly mating multi-generational population cages. We first examined ICP outputs from a controlled crossing scheme carried out over three generations with pleCC and Reckh gRNAs to derive allelic fingerprints distinguishing parents of origin by identifying both somatic alleles in the F1 generation as well as assessment of which of those alleles might be transmitted through the germline to non-fluorescent progeny (i.e., those not inheriting the pleCC or Reckh element) at the F2 generation (Fig.5ad, Supplementary Fig. S11). As anticipated, in both pleCC and Reckh Maternal-F crosses, single dominant somatic alleles were observed in the F1 generation, with the top single allele representing more than 50% of all alleles (Fig.5a, c). Furthermore, all such predominant somatic mutant alleles, which precluded gene-cassette copying of the pleCC or Reckh drive elements in those F1 individuals, were transmitted faithfully through the germline to non-fluorescent F2 progeny with approximately 50% frequency. Furthermore, we observed marked differences in the other half of total reads in F2 progeny depending on the origin of Cas9/gRNA complexes. Thus, a distribution of multiple diverse low frequency mutations were generated when crossing F1 pleCC+ or Reckh+ females with WT males (presumably derived from F1 drive females having deposited Cas9/gRNA complexes maternally that then acted on the paternally sourced WT allele somatically in F2 individuals). In the reciprocal male cross, however, approximately 50% of all alleles remained WT (Fig.5b, d, Supplementary Fig. S12af). These findings support the hypothesis that the top somatic indels derived from maternal Cas9 sources were generated at very early developmental stages (possibly at the point of fertilization or shortly thereafter during the first somatic cell division), resulting in a single mutant allele being initially produced and then transmitted to every descendent cell including all germline progenitor cells49. With the paternal-sourced Cas9 and gRNA, arrays of variable somatic mutations were recovered with the most prominent alleles accounting for fewer than 10% of the total alleles in F1 progeny (Fig.5b). Accordingly, paternally generated F1 somatic alleles were more randomly transmitted via the germline of individuals that failed to copy the gene cassette for either the pleCC or Reckh elements. As a result of this diversity of somatic F1 alleles, only occasionally were the most prevalent alleles also transmitted through germline (e.g., individuals 1, 4 and 5 in Fig.5b, Supplementary Fig. S12gl).
Primary DNA sequences of top single alleles and their percentages of the total alleles from six individual sequenced flies derived from ple gRNA Maternal-F (a) and Paternal-F (b) crosses. Gray bars indicate the location of the gRNA protospacer and red arrowheads are the associated PAM sites. The first row depicts the reference sequence covering the expected DSB cleavage site. Colored squares in the right column indicate the class to which a given allele belongs to. The tables shown on the right of each allele show its frequency among all reads. Left columns of the table indicate frequencies of the somatic allele, and the right columns are the top germline mutant allele frequency obtained by sequencing F2 non-fluorescence progeny derived from same F1 individuals whose top somatic allele is displayed in the left column (excluding WT alleles). Colored dots indicate different alleles with the same color shared between two columns indicating that the same allele appeared as both top 1 somatic and germline indels from the same F0 founders. c, d Allele profiles generated by Reckh parents and progeny generated with the same crossing scheme as for the pleCC. c Tabulation of the Maternal-F cross. d Tabulation of the Paternal-F cross. e Crossing scheme forthe Reckh cage trials. Three individual cages were seeded with 10 homozygous Reckh females, 90 WT females and 100 WT males for the maternally initiated lineage, while the paternally initiated cages were seeded with 10 homozygous Reckh males, 90 WT males and 100 WT females. At each of the following three generations, 10 Reckh+ females and 10 Reckh+ males were randomly collected for single mosquito deep sequencing. f Biased inheritance of Reckh was observed in the maternally seeded cages at generations 2 and 3, but not for the paternally seeded cages. Pink bars denote the fraction of sequenced individual mosquitoes inheriting Reckh from female parents, and cyan colored bars represent Reckh inheritance from the males. Source data are provided as a Source Data file.
The Reckh element in mosquitoes performed similarly to the fly pleCC, however, Reckh F1 individuals displayed less frequent zygotic cleavage and a corresponding reduction in the diversity of resulting somatically generated mutations (>50% WT alleles remained, Paternal-F cross). Consistent with this limited number and array of somatic mutations in the F1 generation from Paternal-F cross, NHEJ mutations were only rarely transmitted to the F2 generation, probably due to more germline-restricted expression of vasa-Cas9 in mosquitoes as compared to flies (Fig.5c, d). These results again suggest that cleavage and repair events were generated later during development in paternal crosses resulting in a stochastic transmission of F1 somatic alleles to the germline, which were largely uncorrelated with the most prevalent allele present somatically in the F1 parent49. Taken together, these highly divergent sex-dependent DSB repair signatures suggested that such genetic fingerprints could be used to track parental history in the context of randomly mating multi-generation population cages.
Based on the highly dominant mutant indels (Maternal-F) versus WT (Paternal-F) alleles generated by Reckh genetic element described above, we evaluated inheritance patterns of indels in multi-generational cages initiated by a 5% introduction of Reckh into WT populations either through maternal or paternal lineages in the F0 generation (Fig.5e). We randomly selected at least 20 fluorescence marker-positive mosquitoes (10 females and 10 males) for NGS analysis at generations 2 and 3, when the Reckh allele was still present at relatively low frequencies in the population and random mating was more likely to have taken place between Reckh/+ heterozygous and WT mosquitoes. Thus, we envisioned that the source of Reckh allele could be tracked back to a male versus female parent of origin by examining whether a dominant WT allele was present (inherited paternally) or not (inherited maternally) (Fig.5e, f). Following this reasoning, we inferred a strong bias for progeny inheriting the Reckh element from a Reckh+ males mating with WT females during generations 2 and 3 than the reverse (i.e., female transmission of Reckh alleles) in the maternally seeded lineage. Indeed, in one maternally seeded replicate (cage 2, generation 3), 100% of the progeny had inherited the Reckh element from their fathers (Fig.5f). In contrast to the striking sex-specific transmission bias observed in maternally seeded cages, progeny from paternally seeded cages displayed more evenly distributed stochastic parental inheritance patterns (Fig.5f). These highly reproducible parent of origin signatures demonstrate the utility of ICP in allelic lineage tracking, which could be of great potential utility in evaluating alternative initial release strategies for gene-drive mosquitoes as well as post-release surveillance of gene-drives as they spread through wild target populations (see Discussion).
Another important challenge for deciphering DSB repair outcomes is to track both NHEJ and gene-cassette mediated HDRevents within the same sample. Such a comprehensive genetic detection tool could have broad impactful applications (see Discussion). For example, one important and non-trivial application is to follow the progress of gene-drives in a marker free fashion as they spread through insect populations. Such dual tracking capability would address the potential concern that mutations eliminating a dominant marker for the gene-drive element could evade phenotype-based assessments of the drive process. Accordingly, we devised a three-step short-amplicon based deep sequencing (200400bp) strategy based on tightly linked colony-specific nucleotide polymorphisms distinguishing donor versus receiver chromosomes to detect copying of two CopyCatcher elements, pleCC and hthCC, from their chromosomes of origin (donor chromosome) to WT homologous (receiver chromosome) targets (Fig.6a)49. Notably, this strategy only amplified the inserted gene cassette on the donor chromosome and or the cassette if it copied onto the receiver chromosome. Thus, the measured allelic frequencies indicate the relative proportions of gene cassettes copied to the receiver chromosome versus those residing on the donor chromosome (Fig.6b displays the inferred somatic HDR frequency quantified from the three-step NGS sequencing protocol as well as Indels quantified by our standard 2-step NGS sequencing protocol - see Methods section for additional details).
a Scheme for tracking gene-drive copying using NGS. Gray bars: genomic DNA, pink oval: Cas9 protein, sky-blue line: gRNA, colored asterisks: polymorphisms. Color coded rectangles represent four nucleotides. Four possible recombinants listed are generated by resolving Holliday junctions at different sites marked with black crosses. b NGS sequencing-based quantification of somatic HDR generated by pleCC in F1 progeny. Areas delineated by dotted lines indicate patches of cells in which somatic HDR copying events have taken place either under bright field (upper) or RFP fluorescent filed (middle). Bottom bars are the summary of the inferred frequency for the somatic HDR (orange), indels (green) and WT alleles (black) derived from the deep sequencing data using the same samples photographed above. More than three flies from each cross were imaged and used for analysis. Scale bars indicate 200 pixels. c Somatic HDR profile with ple gRNA. The red line is for Maternal-F cross and dark blue line for the Paternal-F cross. d Diagram of the hthCC. Black double arrow: recoded hth cDNA, blue rectangles: exon 1, light green rectangles: exons 2-14, and colored lines underneath represent probes used for detection. e In situ images with embryos laid from hthCC-vasa-Cas9 females crossed with WT males. Blue=exon 1, green=WT exons 2-14, red=recoded cDNA for exons 2-14. Insets are magnified single nuclei indicated by colored arrows. This experiment has been repeated at least three times. Scale bars stand for 10m. f Temporal profiles for somatic HDR-mediated copying of the hthCC element assessed by NGS as described for the pleCC in panels c and f. Y-axis tabulates the percentage of HDR at a given time point. Table at the bottom quantifies the HDR fraction at given time points for both the Paternal-F and Maternal-F crosses. Source data are provided as a Source Data file.
In our first set of experiments, we analyzed editing outcomes by examining F1 progeny derived from Maternal-S and Paternal-S pleCC crosses. We compared the rates of somatic HDR measured by NGS analysis to those evaluated by image-based phenotypes associated with copying of the CopyCatcher element. As summarized previously, CopyCatchers such as the pleCC are designed to permit quantification of concordant homozygous mutant clonal phenotypes (e.g., pale patches of thoracic cuticle and embedded sectors ofcolorless bristles), with underlying DsRed+ fluorescent cell phenotypes49. Individual flies in which imaging-based analysis had been conducted were then subject toseparate NGS HDR-fingerprinting and INDELs-fingerprinting resulting in a comprehensive quantification of HDR, NHEJ, and WT alleles within the same sample (Fig.6b, libraries for HDR-fingerprinting and INDELs-fingerprinting were prepared from the same individual fly, but with different DNA preparation and sequencing protocols as detailed description in Methods). For these experiments, F1 flies were genotyped and those carrying both Cas9 and pleCC gRNA were used for NGS analysis (data shown here are the inferred frequencies of somatic HDR, NHEJ events, and WT alleles). This dual integrated analysis revealed that HDR in the Maternal-S crosses resulted in ~15% somatic HDR-mediated cassette copying events on average based on sequencing, and that such cassette copying was yet more frequent in Paternal-S crosses, producing ~25% somatic HDR. The nearly two-fold greater HDR-mediated copying efficiency detected by sequencing in Paternal-S crosses mirrors phenotypic outcomes wherein maternally inherited Cas9 similarly results in a lower frequency of cassette copying detected by fluorescence image analysis in somatic cells than for paternally inherited Cas9 (Fig.6b)49.
Our genetic analysis of stage-dependent differences in DSB repair pathway activity in this study is consistent with a commonly held view in the gene-drive field based on a variety of indirect genetic transmission data that HDR-mediated cassette copying does not occur efficiently during early embryonic stages50,51,63,67,68,69,70. This inference, however, has not yet been verified experimentally. We thus sought to provide direct evidence supporting this key supposition using NGS-based HDR-fingerprinting to track the somatic HDR events across a range of developmental stages in both Maternal-F and Paternal-F crosses in which the Cas9 and gRNA transgenes are transmitted together either maternally or paternally using our validated NGS sequencing protocol. Notably, we collected samples at 9 timepoints and pooled 20 F1 progeny together for pooled sequencing to prime the developmental profile of somatic HDR with pleCC (samples were thus collected without genotyping since it is impractical to genotype individual embryos and young larvae). Because of the limitations imposed by embryo pooling we were unable to use the same samples collected here for also quantifying the generation of somatic NHEJ alleles (i.e., only half of the F1 progeny carried the vasa-Cas9 transgene on the X chromosome and those embryos lacking this transgene were not suitable for generating mutations - note that such an analysis was possible in the case of the viable Reckh drive shown in Fig.4e as well as for a viable split-drive allele inserted into the essential prosalpha2 locus shown in Supplementary Fig. S9). Indeed, NGS analysis detected only very rare examples of somatic HDR events in early embryos derived from both crosses (Fig.6c). Notably, HDR in the Paternal-F cross detected by this sequencing protocol increased substantially to 35.9% during adult stages, a period coinciding with the temporal peak of the pale expression profile (note that in this experiment we employed the actin-Cas9 rather than vasa-Cas9 source, which has higher level of Cas9 expression in somatic cells and generates a correspondingly higher frequency of somatic HDR)49.
We extended our sequencing-based strategy to quantify somatic HDR using a second CopyCatcher element (hthCC) designed specifically to identify even rare copying events in early blastoderm-stage embryos. The hthCC is inserted into the homothorax (hth) gene and was engineered to visualize HDR-mediated copying of the gene cassette by fluorescence in situ hybridization (FISH) using discriminating fluorescent RNA probes complementary to specific endogenous versus recoded cDNA sequences (Fig.6d, e). In this system, copying of the transgene from the donor chromosome to the receiver chromosome would be indicated by the presence of two nuclear dots of red fluorescence detected by the hth recoded cDNA-specific probe (indicating two copies of recoded hth cDNA). In contrast, cells in which no copying occurred should contain only a single nuclear red dot signal (from the donor allele). Such in situ analysis detected no clear case of gene cassette copying in any of the ~5000 blastoderm stage cells examined across ~500 embryos (with the caveat that some mitotic nuclei generate ambiguous signals depending on their orientation). This qualified negative result assessed by in situ analysis was consistent with the very low estimates of HDR frequency during the same early blastoderm-stage developmental window based on NGS analysis in staged time-course experiments, although the latter sequencing method did detect very low levels of somatic HDR at ~3hours after egg laying from the Paternal-F crosses (and no copying until day three of larvae with the maternal cross Fig.6df). The very low levels of somatic HDR observed in early embryos for the hthCC construct either by in situ hybridization or by NGS sequencing parallel the results summarized above for the pleCC element (Fig.6c, f). The maximal somatic HDR frequency observed for the hthCC Maternal-F crosses (0.06% at day 3 after egg laying) was somewhat lower than that for the similar cross for pleCC (0.35% at adult stage), consistent with the predominance of single mutant alleles being generated at very early stages following fertilization in Maternal-F crosses. In contrast to the exceedingly rare copying of the hthCC element detected in early embryos for either the Maternal-F or Paternal-F crosses, the same element frequently copied to the homologous chromosome during later developmental stages in Paternal-F crosses as assessed by NGS sequencing. The hthCC elementagain copied with somewhat lower efficiency than the pleCC element (e.g., 15.2% for hthCC versus 35.9% for pleCC tabulated in adults), presumably reflecting differing genomic cleavage rates or gene conversion efficiencies generated by their respective gRNAs (including total cleavage levels and temporal features). In aggregate, these two examples of quantitative analysis of copying frequencies based on both NGS and in situ analysis demonstrate that ICP and NGS-based quantification of gene conversion events can be successfully integrated for a comprehensive analysis of DSB repair outcomes, including both NHEJ and HDR events as a function of developmental stage. These powerful tools also could be applied for following gene-drive spread through freely mating populations in a marker-free manner as well as for a variety of other applications including gene therapy (see Discussion).
Exosomes and Stem Cells Are the Future of Anti-Aging – NewBeauty Magazine
Our skin is a story, told chapter by chapter as we age. But what if we could rewrite it? That seemingly sci-fi future is already here thanks to cutting-edge technologies like exosomes, stem cells and bio-identical hormones. Changing the approach from preservation to regeneration, these new treatments and technologies are changing the narrative around aging.
Thats how New York dermatologistJulie Russak, MDdescribes the shift in her practice since employing these tools. The aging process leaves its mark on our skin, but advancements in regenerative medicine are rewriting the narrative, she says. Exosomes and stem cells, previously confined to the realm of science fiction, are now emerging as powerful tools in my dermatology arsenal.
The next big thing in dermatology, the exosome, is essentially a delivery system. Imagine microscopic envelopes meticulously created by stem cells, packed with genetic
instructions and protein packages, Dr. Russak explains. These are exosomes.
Just like envelopes, whats contained inside is whats really interesting.
Exosomes deliver key signaling molecules, instructing fibroblasts, or skin cells, to ramp up collagen production, Dr. Russak says. This translates to thicker, firmer skin with visibly reduced wrinkles and fine lines.
They offer an answer to sun damage as well.
Sun damage wreaks havoc on our skin, but exosomes offer a cellular-level repair kit, Dr. Russak explains. They promote the regeneration of UV-damaged structures, mitigating the appearance of sunspots and uneven tone. Unlike broad-spectrum approaches, exosomes excel at precision. They hone in on specific skin cells, ensuring their restorative cargo reaches the areas that need it most, maximizing effectiveness and minimizing potential side effects.
Stem cells are the master cells of regeneration, says Dr. Russak. These unique cells possess the remarkable ability to self-renew and differentiate into various specialized cell types, including those crucial for healthy skin.
In dermatology, stem cells are utilized to regenerate tissue and promote collagen production, which makes them perfect for tackling things like age spots, skin firmness and even hair loss. Theyre also employed during in-office treatments like microneedling and laser treatments to expedite recovery and maximize rejuvenation. Because they can be directed to become different kinds of skin cells, stem cells are especially versatile to dermatologists.
We use this versatility in dermatological treatments to replace damaged or aging cells with new, healthy cells, Dr. Russak explains. Both exosomes and stem cell treatments represent a shift towards a more regenerative and holistic approach in dermatology. Rather than merely masking the symptoms of aging skin, these treatments aim to restore the skins natural ability to heal and renew itself.
In the world of anti-aging, the name Dr. David Sinclair is a big one. Australian-American biologist and professor of genetics at Harvard Medical School, Dr. Sinclair has published pivotal work on the science of aging and longevity.
These innovative methods are partly inspired by groundbreaking research in cellular health and aging, including the work of Dr. David Sinclair, Dr. Russak explains. In the field of dermatology, theres a growing trend toward using regenerative medicine to slow aging, with a focus on treatments like exosomes, stem cell therapies and bio-identical hormone replacement therapy (BHRT).
Using exosomes in procedures like microneedling is just the beginning.
We are incorporating topical treatments with peptides and growth factors, as well as injectable therapies like PRP (Platelet-Rich Plasma) and biostimultary molecules like PLLC and CaHa to stimulate the skins natural repair processes, Dr. Russak explains.
Alongside things like diet, lifestyle change and nutraceuticals like NAD+ boosters, dermatologists aim to improve skin, slow down aging and potentially even reverse hair loss.
Unlike many traditional methods of anti-aging, exosomes and stem cells are a natural path to rejuvenation. Rather than masking signs of damage, these treatments are encouraging your body to do the work itself.
Its important to have realistic expectations and understand that multiple treatments may be necessary, Dr. Russak says. Rigorous clinical research is ongoing and long-term data is still needed to definitively establish the safety and efficacy of these treatments. While the future holds immense promise, I remain grounded in evidence-based practice, incorporating these innovations only when robust scientific data supports their benefit.
Due to the newness of these treatments, more long-term studies are needed to fully understand their safety and efficacy. Because the regulatory side of things havent caught up to the technology, practitioners also must consider how to ethically source stem cells and exosomes.
Patients should ensure treatments are performed by qualified professionals and that the products used are compliant with regulatory standards, Dr. Russak explains. As we are just at the very beginning of this exciting field, practitioners and patients need to exercise due diligence when considering these treatments.
Read the rest here:
Exosomes and Stem Cells Are the Future of Anti-Aging - NewBeauty Magazine
RGX-314 Gene Therapy for nAMD Well-Tolerated in Phase 1/2a Study – MD Magazine
Jeffrey S. Heier, MD
Credit: Ophthalmic Consultants of Boston
Subretinal delivery of ABBV-RGX-314, a potential one-time gene therapy, was well-tolerated, with no clinically recognized immune response, in the treatment of neovascular (wet) age-related macular degeneration (nAMD), according to phase 1/2a results published in The Lancet.1
The publication detailed two-year data suggesting the novel approach of RGX-314 for sustained vascular endothelial growth factor (VEGF)-A suppression, with the potential to safely maintain vision and reduce treatment burden in patients with nAMD after a single dose.
Wet AMD is a chronic, life-long disease and real-world evidence shows patients are losing significant vision over time, and the burden of frequent anti-VEGF injections needed to manage their wet AMD is a major reason why, Jeffrey S. Heier, MD, director of the vitreoretinal service and retina research, Ophthalmic Consultants of Boston and the primary study investigator, said in a statement.2 A single treatment of ABBV-RGX-314 that can potentially provide long-lasting treatment outcomes and a strong safety profile would offer a novel approach to treating this serious and blinding disease.
Frequent anti-VEGF-A injections lessen the risk of rapid, severe vision loss among patients with nAMD, but the frequency-related burden could lead to undertreatment, and thus, vision loss over time.3 Sustained suppression of the VEGF-A pathway may provide the maintenance of vision and a reduction in the associated treatment burden.
RGX-314, an adeno-associated virus serotype 8 vector expressing an anti-VEGF-A antigen-binding fragment, is developed to allow continuous VEGF-A suppression after a single administration.2 REGENXBIO is investigating two separate routes of administration of RGX-314 to the eye, including standard subretinal delivery and suprachoroidal delivery.
Current results from the phase 1/2a, open-label, dose-escalation study reported the safety and efficacy of the subretinal delivery of five dose cohorts of RGX-314 for patients with nAMD.1 Between May 2017 and May 2019, investigators screened 110 patients with previously treated nAMD for eligibility criteria. The trials primary outcome was the safety of RGX-314 delivered by subretinal injection up to week 26.
After enrolling 68 individuals into the trial, 42 participants met the required anatomic response to intravitreal ranibizumab and received a single RGX-314 injection (dose range 3x109 to 2.5x1011 genome copies per eye). Participants were observed 1 day and 1 week after administration, then monthly for 2 years.
Analyses revealed 20 serious adverse events in 13 participants, with one event considered potentially related to RGX-314. The event was pigmentary changes in the macular with severe vision reduction 12 months after injection of RGX-314 at a dose of 2.5 x 1011 genome copies per eye.
Heier and colleagues observed asymptomatic pigmentary changes in the inferior retinal periphery months after subretinal RGX-314, primarily at doses of 6x1010 genome copies per eye or higher. In addition, the analysis demonstrated no clinically determined immune responses or inflammation outside of those expected after routine vitrectomy.
Overall, the doses of 6 x 1010 genome copies per eye or higher led to sustained concentrations of RGX-314 protein in the aqueous humor, as well as stable or improved BCVA and central retinal thickness, with little to no supplemental anti-VEGF injections administered in most participants.
Heier and colleagues noted these results inform the pivotal program to assess RGX-314 for the treatment of nAMD further. Two pivotal trials, ATMOSPHERE and ASCENT, are currently evaluating RGX-314 in patients with wet AMD with on-target enrollment.
RegenXBio expects these data to support regulatory submission with the US Food and Drug Administration (FDA) and European Medicines Agency (EMA) in late 2025 through early 2026.2
To have these Phase I/IIa data published in The Lancet highlights the groundbreaking work of our scientists and investigators, and further validates the clinically transformative nature of ABBV-RGX-314 as a potential one-time gene therapy for wet AMD that may help patients maintain or improve their vision, Kenneth T. Mills, president and chief executive officer of REGENXBIO, added in a statement.2
References
Link:
RGX-314 Gene Therapy for nAMD Well-Tolerated in Phase 1/2a Study - MD Magazine
Gene therapy offers hope for giant axonal neuropathy patients – UT Southwestern
Co-author Steven Gray, Ph.D., is Associate Professor of Pediatrics, Molecular Biology, Neurology, and in the Eugene McDermott Center for Human Growth and Development at UTSouthwestern.
DALLAS March27, 2024 A gene therapy developed by researchers at UTSouthwestern Medical Center for a rare disease called giant axonal neuropathy (GAN) was well tolerated in pediatric patients and showed clear benefits, a new study reports. Findings from the phase one clinical trial, published in the New England Journal of Medicine, could offer hope for patients with this rare condition and a host of other neurological diseases.
This trial was the first of its kind, for any disease, using an approach to broadly deliver a therapeutic gene to the brain and spinal cord by an intrathecal injection, said co-author Steven Gray, Ph.D., Associate Professor of Pediatrics, Molecular Biology, Neurology, and in the Eugene McDermott Center for Human Growth and Development at UTSouthwestern. Even with the relatively few patients in the study, there were clear and statistically significant benefits demonstrated in patients that persisted for years.
Dr. Gray developed this gene therapy with co-author Rachel Bailey, Ph.D., Assistant Professor in the Center for Alzheimers and Neurodegenerative Diseases and of Pediatrics at UTSW.Dr. Gray is an Investigator in thePeter ODonnell Jr. Brain Institute.
GAN is extraordinarily rare, affecting only about 75 known families worldwide. The disease is caused by mutations in a gene that codes for a protein called gigaxonin. Without normal gigaxonin, axons the long extensions of nerve cells swell and eventually degenerate, leading to cell death. The disease is progressive, typically starting within the first few years of a childs life with symptoms including clumsiness and muscle weakness. Patients later lose the ability to walk and feel sensations in their arms and legs, and many gradually lose hearing and sight and die by young adulthood.
In the clinical trial conducted at the National Institutes of Health (NIH), Drs. Gray and Bailey worked with colleagues from the National Institute of Neurological Disorders and Stroke (NINDS) to administer the therapy to 14 GAN patients from 6 to 14 years old. Using a technique they developed to package the gene for gigaxonin into a virus called adeno-associated virus 9 (AAV-9), the researchers injected it into the intrathecal space between the spinal cord and the thin, strong membrane that protects it. Tested for the first time for any disease, this approach enabled the virus to infect nerve cells in the spinal cord and brain to produce gigaxonin in nerve cells, allowing them to heal the cells axons, which grow throughout the body.
Amanda Grube, 14, one of the trial's participants, has seen improvement in her diaphragm and other muscles associated with breathing, her mother says. However, many of Amanda's other functions, including her mobility, did not benefit. (Photo credit: McKee family)
After one injection, the researchers followed the patients over a median of nearly six years to determine whether the treatment was safe and effective. Only one serious adverse event was linked to the treatment fever and vomiting that resolved in two days suggesting it was safe. Over time, some patients showed significant recovery on an assessment of motor function. Other measurements revealed that several of the patients improved in how their nerves transmitted electrical signals.
One of the trials participants, 14-year-old Amanda Grube, has experienced improvement in her diaphragm and other muscles associated with breathing, according to her mother, Katherine McKee. However, many of Amandas other functions did not benefit including her mobility.
Thats why I hope theres more to come from the research that can help patients even more,Mrs. McKee said. Amanda has dreams and ambitions. She wants to work with animals, save the homeless, and design clothes for people with disabilities.
Dr. Gray said that in many ways, the study offers a road map to carry out similar types of clinical trials. The findings have broader implications because this study established a general gene therapy treatment approach that is already being applied to dozens more diseases, he said.
Although the phase one results are promising, Dr. Gray said he and other researchers will continue to fine-tune the treatment to improve results in future GAN clinical trials. He is also using this method for delivering gene therapies to treat other neurological diseases at UTSW, where he is Director of the Translational Gene Therapy Core, and at Childrens Health. Work in theGray Labhas already led to clinical trials for diseases including CLN1 Batten disease, CLN5 Batten disease, CLN7 Batten disease, GM2 gangliosidosis, spastic paraplegia type 50, and Rett syndrome.
The GAN study was funded by the National Institute of Neurological Disorders and Stroke (NINDS), Division of Intramural Research, NIH; Hannahs Hope Fund; Taysha Gene Therapies; and Bamboo Therapeutics-Pfizer.
Drs. Bailey and Gray are entitled to royalties from Taysha Gene Therapies. Dr. Gray has also consulted for Taysha and serves as Chief Scientific Adviser.
About UTSouthwestern Medical Center
UTSouthwestern, one of the nations premier academic medical centers, integrates pioneering biomedical research with exceptional clinical care and education. The institutions faculty members have received six Nobel Prizes and include 25 members of the National Academy of Sciences, 21 members of the National Academy of Medicine, and 13 Howard Hughes Medical Institute Investigators. The full-time faculty of more than 3,100 is responsible for groundbreaking medical advances and is committed to translating science-driven research quickly to new clinical treatments. UTSouthwestern physicians provide care in more than 80 specialties to more than 120,000 hospitalized patients, more than 360,000 emergency room cases, and oversee nearly 5 million outpatient visits a year.
Read the original post:
Gene therapy offers hope for giant axonal neuropathy patients - UT Southwestern
Advanced Therapy Medicinal Products CDMO Industry is Rising Rapidly – BioSpace
According to latest study, the global advanced therapy medicinal products CDMO Market size was valued at USD 6.10 billion in 2023 and is projected to reach USD 34.53 billion by 2033, growing at a CAGR of 18.93% from 2024 to 2033.
Key Takeaways:
Request PDF Sample Copy of Report: (Including Full TOC, List of Tables & Figures, Chart)@ https://www.novaoneadvisor.com/report/sample/8439
owing to risingclinical trialsfor advanced therapy medicinal products and the increasing awareness among researchers about the benefits of advanced therapies, driving the advanced therapy medicinal products (ATMP) CDMO market growth. Tissue engineering has greatly benefited in recent years from technological development. The damaged tissues and organ function are replaced or restored using this technique. Similarly, gene and cell therapy are attracting a lot of patients for the treatment of rare diseases, whose incidence is rising globally.
With rising demand for robust disease treatment therapies, key players have focused their efforts to ramp up research and development for effective gene therapies that target the cause of disorder at a genomic level. According to ASGCT, the number of cell and gene therapies in the U.S. pipeline programs (phase I-III trials) increased from 483 in 2021 to 529 in 2022. Furthermore, the FDA delivers constant support for innovations in the gene therapy field via a number of policies with regard to product manufacturing. In January 2020, the agency released six final guidelines on the manufacturing and clinical development of safe & efficient gene therapy products.
Moreover, awareness about ATMP treatment options is being driven by initiatives aimed at informing the public about the benefits of these products, which, in turn, is leading to increased adoption of advanced therapies and fueling market growth for CDMOs. For instance, Alliance for Regenerative Medicine Foundation for Cell and Gene Medicine prioritizes activities for increasing public awareness through educational programs, underlining the clinical & societal benefits of regenerative medicine.
Increasing clinical trial activity along with new product launches generates growth opportunities for the market. As of 2022, there are 1451 ATMPs in preclinical stages and 535 are being studied in Phase 1 to 3 studies. Since August 2020, EMA has approved six of these additional ATMPs, and five more will be approved by 2023. In the UK, there were approximately 168 advanced therapy medicinal product trials underway in 2021, up from the 154 studies reported the year before, which is a 9% increase. 2021 saw a 32% increase in phase 1 trials, indicating a significant shift from experimental medicines to first-in-human studies.
On the other hand, key players are undertaking various strategic initiatives to introduce novel products, which is expected to propel market growth. For instance, in March 2021, CureVac N.V. signed a partnership agreement with Celonic Group, engaged in the manufacture of CVnCoV, CureVacs mRNA-based COVID-19 vaccine candidate. CureVac's COVID-19 vaccine candidate is manufactured at Celonic's commercial manufacturing unit for ATMPs and biologics in Heidelberg, Germany. Under the terms of the commercial supply agreement, the Celonic facility could produce over 100 million doses of CVnCoV.
Immediate Delivery Available, Get Full Access@ https://www.novaoneadvisor.com/report/checkout/8439
Advanced Therapy Medicinal Products CDMO Market Trends
Segments Insights:
Product Insights
The gene therapy segment held the largest share of over 49.11% in 2023. Increase in financial support and rise in number of clinical trials for gene therapies are driving demand for gene therapy segment. In 2020, in the first three quarters, gene therapies attracted financing of over USD 12 billion globally, with around 370 clinical trials underway. Additionally, in mid-2022, approximately 2,000 gene therapies were in development, targeting several therapeutic areas, such as neurological, cancer, cardiovascular, blood, and infectious diseases.
The cell therapy segment is expected to show lucrative growth over the forecast period. The field of cellular therapeutics is constantly advancing with inclusion of new cell types, which, in turn, provides ample opportunities for companies to enhance their market positions. Furthermore, the market is attracting new entrants due to high unmet demand for cell therapy manufacturing, the recent approval of advanced therapies, and proven effectiveness of these products.
Indication Insights
The oncology segment accounted for the largest revenue share in 2023. The segments dominance is attributed to disease burden, strategic initiatives undertaken by key players, and availability of advanced therapies used for treating various cancer indications. In January 2021, around 18,000 to 19,000 patients and 124,000 patients were estimated to be potential patients for treating cancer using cell & gene therapy products Kymriah (Novartis AG) and Yescarta (Gilead Sciences, Inc.), respectively. Furthermore, a publication on PubMed reports that as of the conclusion of the first quarter of 2023, there have been over 100 distinct gene, cell, and RNA therapies approved globally, along with an additional 3,700-plus in various stages of clinical and preclinical development.
The cardiology segment is estimated to register the fastest CAGR over the forecast period. This is attributed to the increasing prevalence of cardiovascular diseases and research collaboration for development of advanced therapies. For instance, in October 2023, Cleveland Clinic administered a novel gene therapy to the first patient globally as part of a clinical trial, aiming to deliver a functional gene to combat the primary cause of hypertrophic cardiomyopathy (HCM). Similarly, in February 2021, Trizell GmbH entered into partnership with Catalent, Inc. for development of phase 1 cell therapy to treat micro- and macroangiopathy. Trizell's medication is an Advanced Therapy Medicinal Product (ATMP) that employs regulatory macrophagesa platform technology developed in Germany.
Phase Insights
The phase I segment dominated the market in 2023 due to growing R&D activities and increasing number of human trials for advanced therapies. Phase 1 helps ensure the safety levels of a drug at different doses and dosage forms administered to a small number of patients. This phase is mainly conducted to determine the highest dose a patient can take without any adverse effects. Around 70% of drugs in phase 1 move to the next phase.
The phase II segment has been anticipated to show lucrative growth over the forecast period. Phase II clinical studies comprise the largest number of developing ATMPs, due to the high clearance rate of phase I clinical studies. According to data published by Alliance for Regenerative Medicine, as of June 2022, more than 2,093 clinical trials are ongoing globally, out of which 1,117 are under phase II clinical trials accounting for 53%. Thus, the increase in number of products in phase II is driving the segment.
Regional Insights
North America dominated the overall market share of 49.11% in 2023. This can be attributed to increasing outsourcing activities and rising awareness about advanced therapy. North America has consistently been a leader in R&D for advanced treatments, and it is anticipated that it will keep this position during the forecast period. Recent approvals of products such as Kymriah and Yescarta have propelled investments in the regional market. Moreover, in March 2021, the U.S. FDA approved Abecma, the first approval of CAR-T cells to fight against cancer. Similarly, in December 2023, Casgevy and Lyfgenia, the initial cell-based gene therapies for sickle cell disease (SCD) in patients aged 12 and above, received approval from the U.S. Food and Drug Administration, marking a significant milestone.
The U.S. accounted for the largest share of the global market in the North America region in 2023. The U.S. maintains dominance in this sector due to the presence of a robust and highly advanced biopharmaceutical industry with a considerable focus on research and development. Additionally, the continuous presence of numerous pharmaceutical and biotechnology companies, along with academic and research institutions, generates a sustained demand for rigorous safety testing, further reinforcing the country's leadership in the field.
The Asia Pacific region is expected to grow at the fastest CAGR over the forecast period due to the increasing demand for novel ATMPs and rising R&D activities to develop novel therapies. Moreover, the market growth is driven by continuously expanding CDMO Cell Therapy in the country, a number of domestic players have collaborated with biotech companies from other countries involved in mesenchymal stem cell research and therapy development. In addition, in September 2022 Takara Bio, Inc. launched CDMO Cell Therapy for gene therapy products using siTCR technology for its genetically modified T-cell therapy products.
China accounted for the largest share of the global market in the Asia Pacific region in 2023 due to its strategic focus on advancing research and development capabilities, particularly in the pharmaceutical and biotechnology sectors. Additionally, with a rapidly growing biopharmaceutical industry and supportive government initiatives, China has become a key market for advanced therapy medicinal products (CDMO) market.
Recent Developments
Key Companies & Market Share Insights
Some of the key players operating in the market include AGC Biologics,WuXi Advanced Therapies and Celonic
Minaris Regenerative Medicine and BlueReg are some of the emerging market players in the global market.
Key Advanced Therapy Medicinal Products CDMO Companies:
Segments Covered in the Report
This report forecasts revenue growth at country levels and provides an analysis of the latest industry trends in each of the sub-segments from 2021 to 2033. For this study, Nova one advisor, Inc. has segmented the Advanced Therapy Medicinal Products CDMO market.
By Product
By Phase
By Indication
By Region
Immediate Delivery Available | Buy This Premium Research: https://www.novaoneadvisor.com/report/checkout/8439
You can place an order or ask any questions, please feel free to sales@novaoneadvisor.com| USA - +1 9197 992 333
About US
Nova One Advisor is a worldwide market research and consulting organization. We give unmatched nature of offering to our customers present all around the globe across industry verticals. Nova One Advisor has expertise in giving deep-dive market insight along with market intelligence to our customers spread crosswise over various undertakings.
Read more from the original source:
Advanced Therapy Medicinal Products CDMO Industry is Rising Rapidly - BioSpace
Story of boy with ultra-rare UBA5 disorder being studied at UMass Chan goes to the moon – UMass Medical School
Raiden Pham
Parents of children with rare diseases go to endless lengths to raise funds and awareness for research that might lead to a cure. Now, the story of 4-year-old Raiden Pham has been to the moon. He has an ultra-rare neurodegenerative disease known as UBA5 disorder that UMass Chan Medical School researchers are targeting.
The story of Raidens journey and its message of love, hope and strength is included on an indestructible digital time capsule of art, music, film and history, as part of the Lunaprise Moon Museum Mission, which was onboard the Odysseus spacecraft that landed on the moon Feb. 22.
When we think about gene therapy, or any kind of cure or treatment for these rare diseases, its always considered a moonshot, but thats not the case anymore in todays world, said Tommy Pham, Raidens father. Were willing to do whatever it takes to save my son and kids with UBA5 disorder and hopefully inspire the next generation of rare disease parents to go on this fight and have hope.
Since 2021, the Raiden Science Foundation, founded by Tommy and Linda Pham, of Beaverton, Oregon, on behalf of their son, has raised around $1 million of its $4 million goal, which supports research in UMass Chans Translational Institute for Molecular Therapeutics and other partner institutions.
The research on UBA5 is led by Toloo Taghian, PhD, instructor in radiology in the lab of Heather Gray-Edwards, DVM, PhD, assistant professor of radiology in the Horae Gene Therapy Center.
Dr. Taghian has identified the top two viral vector constructs for UBA5 expression in-vivo, which show great promise in successfully delivering UBA5 gene therapy to the targeted cells. Taghian and her team are now testing their efficacy in correcting the protein malfunction and treating the underlying cause of this disease and will soon initiate toxicology studies to assess their safety.
Working with Raiden Science Foundation to develop a gene therapy for UBA5 has been an impactful journey, said Taghian. The dedication of the Pham family in supporting UBA5 research allows the UMass Chan team to work toward unpacking the basic science underlying this ultra-rare disease in parallel with our gene therapy development program.
How Raidens story got to the moon was a journey of persistent efforts to raise awareness and support by the Phams. In October 2022, Raiden Science Foundation held a gaming charity stream, Kombat4Rare, based on the Mortal Kombat franchise. One of the main characters in Mortal Kombat is Raiden, named after the God of Thunder in Japanese mythology.
The response from the gaming and entertainment community was enthusiastic, and a few months later Tommy Pham was invited to be featured at a charity event in Marina del Rey, California. Dallas Santana, founder of Space Blue, the exclusive curator of the Lunaprise Museum, was touched by Tommys message and told him Raidens story should be included on the Lunaprise Moon Museum to inspire people on Earth.
Noting that it has been more than 50 years since the last American space capsule landed on the moon, Tommy said, We dont have to wait another 50 years for gene therapy. It could be done now in the coming years. We need to figure out a way with all the right stakeholders to unlock gene therapy for so many other kids suffering different rare diseases, not just us.
Donations to support UBA5 gene therapy at UMass Chan can be made here.
Go here to see the original:
Story of boy with ultra-rare UBA5 disorder being studied at UMass Chan goes to the moon - UMass Medical School