Archive for July, 2022
GenScript ProBio, DAAN Bio Therapeutics Enter Cell and Gene Therapy Partnership – Contract Pharma
");$(".close-btn").click(function() { $(this).parent().fadeOut(800);});setTimeout(showpanel1, 5000);function showpanel1() { $(".close-btn").css("bottom","79px");}'); } }); } var menu = new cbpTooltipMenu(document.getElementById('cbp-tm-menu')); $(document).ready(function () { if ($(".ad-box").length) { $(".pushhead").addClass("right-space"); } });");$(".close-btn").click(function() { $(this).parent().fadeOut(800);});setTimeout(showpanel1, 5000);function showpanel1() { $(".close-btn").css("bottom","79px");}
Breaking News
Sign MOU for the discovery and development of novel drugs.
07.14.22
Through this agreement, both companies will cooperate in the overall development process, such as discovery, manufacturing and clinical trials of antibody and cell treatments, and related research and service projects.
DAAN Bio Therapeutics has conducted single cell transcriptomic and proteomic biomarker analysis through its own analysis platform using tissues secured from solid cancer patients along with DAAN Cancer Research Institute and Yonsei New Il Han Institute for Integrative Cancer Research.
Accordingly, DAAN Bio Therapeutics signed a contract manufacturing organization (CMO) service through GenScript ProBio to develop antibodies that specifically bind to the discovered target material, and established its own bispecific antibody production pipeline using antibodies derived through GMP production.
I hope this strategic partnership with DAAN Bio Therapeutics will be of great support as a global partner in accelerating the development of DAAN's antibody and cell therapy through the GenScript ProBio's one-stop CDMO service platform, said Brian Min, CEO, GenScript ProBio.
Byoung Chul Cho, co-founder and CEO, DAAN Bio Therapeutics, said, This strategic cooperation will be an opportunity to revitalize the development of antibody and cell therapy that control unique cancer treatment targets secured by DAAN Bio Therapeutics using GenScript ProBio's qualified and competitive technologies.
Through this partnership, both GenScript ProBio and DAAN Bio Therapeutics will continue their cooperation more closely with each other to develop subsequent pipelines of DAAN Bio Therapeutics, such as antibody drug and cell therapy.
See the original post:
GenScript ProBio, DAAN Bio Therapeutics Enter Cell and Gene Therapy Partnership - Contract Pharma
BioMarin Presents Findings from Studies of Valoctocogene Roxaparvovec, Investigational Gene Therapy, at the International Society on Thrombosis and…
BioMarin Presents Findings from Studies of Valoctocogene Roxaparvovec, Investigational Gene Therapy, at the International Society on Thrombosis and Haemostasis (ISTH) 2022 Congress July 9-12, Including 4 Oral and 2 Poster Presentations
Commitment to Advancing Care for People with Hemophilia A Demonstrated with Largest and Longest, OngoingClinical Development Program for any Gene Therapy in Hemophilia A
European Commission Approval for Valoctocogene Roxaparvovec Expected Q3 2022
SAN RAFAEL, Calif., July 11, 2022 /PRNewswire/ -- BioMarin Pharmaceutical Inc. (NASDAQ: BMRN) today announced that it presented four oral presentations and two poster presentations on valoctocogene roxaparvovec, an investigational gene therapy for the treatment of adults with severe hemophilia A, at the International Society on Thrombosis and Haemostasis (ISTH) 2022 World Congress from July 9-12 in London.
"With each passing year, the breadth of data supporting valoctocogene roxaparvovec increasingly demonstrate the positive impact gene therapy treatment may provide people with severe hemophilia A. These presentations at ISTH offer supportive evidence of long-term hemostatic efficacy, consistent safety results in clinical studies, efficacy from our pivotal study that is consistent with propensity scoring, the clearance of the vector, and on health-related quality of life over six years," said Hank Fuchs, M.D., President of Worldwide Research and Development at BioMarin. "We look forward to an anticipated approval of valoctocogene roxaparvovec in Europe and providing a therapy that could represent an important and valuable treatment choice for patients with severe Hemophilia A by offering the potential to reduce both the burden of the disease as well as the burden of treatment."
"BioMarin continues to increase and share important data about investigational valoctocogene roxaparvovec that may be useful for patients and physicians to evaluate therapeutic options based on an individual's unique circumstances," said one of the presenters Professor Johnny Mahlangu, a study investigator and Professor in Haematology and Head of School of Pathology in the Faculty of Health Sciences of the University of the Witwatersrand in Johannesburg, South Africa.
Presentation of these data at ISTH follows the Committee for Medicinal Products for Human Use (CHMP) adopting a positive opinion recommending conditional marketing authorization (CMA) for valoctocogene roxaparvovec for adults with severe hemophilia A. Valoctocogene roxaparvovec is the first gene therapy to be recommended for approval in Europe for hemophilia A. A final approval decision, typically consistent with the CHMP recommendation, is expected from the European Commission in Q3 2022.
BioMarin's presentations at ISTH include:
Oral Presentations
Comparative effectiveness of valoctocogene roxaparvovec and prophylactic factor VIII replacement estimated through propensity scoring
Anthony J. Hatswell, PhD, Director and Analyst, Delta Hat Limited, Nottingham, UK
Sunday July 10, 2022, 3:45 PM - 4:00 PM BST
Relationship between transgene-produced FVIII and bleeding rates 2 years after gene transfer with valoctocogene roxaparvovec: Results from GENEr8-1
Professor Johnny Mahlangu, Professor of Haematology and Head of School of Pathology in the Faculty of Health Sciences of the University of the Witwatersrand in Johannesburg, South Africa.
Sunday July 10, 2022, 3:15 PM - 3:30 PM BST
Hemostatic results for up to 6 years following treatment with valoctocogene roxaparvovec, an AAV5-hFVIII-SQ gene therapy for severe hemophilia A
Professor Michael Laffan, faculty of Medicine, Department of Immunology and Inflammation at Imperial College London, Director of the Hammersmith Hospital Haemophilia Centre
Sunday July 10, 2022, 3:00 PM - 3:15 PM BST
Innate and Adaptive Immune Responses to Adeno-associated viral Gene Therapy in the Severe Hemophilia A Dog Model
Paul Batty, MBBS, PhD, Associate Professor at University College London and an Honorary Consultant in Haemostasis and Thrombosis at the Katharine Dormandy Haemophilia and Thrombosis Centre (Royal Free Hospital, London, UK)
Saturday, July 9, 2022, 2:00 PM 2:15 PM BST
Posters
Comparability of bleeding outcomes by prophylactic FVIII replacement intensity: A post hoc analysis of a noninterventional study of men with severe hemophilia A
Charlotte Camp, MSc, Associate Director, Health Economics and Outcomes Research, BioMarin
Monday July 11, 2022, 6:30 PM - 7:30 PM BST
Blood Biodistribution and Vector Shedding of Valoctocogene Roxaparvovec in People with Severe Hemophilia A: Results from the Phase 3 GENEr8-1 Trial
Suresh Agarwal, PhD, MS, RPh, Director, Clinical Pharmacology, BioMarin
Sunday July 10, 2022, 6:30 PM - 7:30 PM
About Hemophilia A
People living with hemophilia A lack sufficient functioning Factor VIII protein to help their blood clot and are at risk for painful and/or potentially life-threatening bleeds from even modest injuries. Additionally, people with the most severe form of hemophilia A (FVIII levels <1%) often experience painful, spontaneous bleeds into their muscles or joints. Individuals with the most severe form of hemophilia A make up approximately 50 percent of the hemophilia A population. People with hemophilia A with moderate (FVIII 1-5%) or mild (FVIII 5-40%) disease show a much-reduced propensity to bleed. The standard of care for individuals with severe hemophilia A is a prophylactic regimen of replacement Factor VIII infusions administered intravenously up to two to three times per week or 100 to 150 infusions per year. Despite these regimens, many people continue to experience breakthrough bleeds, resulting in progressive and debilitating joint damage, which can have a major impact on their quality of life.
Hemophilia A, also called Factor VIII deficiency or classic hemophilia, is an X-linked genetic disorder caused by missing or defective Factor VIII, a clotting protein. Although it is passed down from parents to children, about 1/3 of cases are caused by a spontaneous mutation, a new mutation that was not inherited. Approximately 1 in 10,000 people have Hemophilia A.
About BioMarin
BioMarin is a global biotechnology company that develops and commercializes innovative therapies for people with serious and life-threatening rare diseases and medical conditions. The Company selects product candidates for diseases and conditions that represent a significant unmet medical need, have well-understood biology and provide an opportunity to be first-to-market or offer a significant benefit over existing products. The Company's portfolio consists of seven commercial products and multiple clinical and preclinical product candidates for the treatment of various diseases. For additional information, please visitwww.biomarin.com.
Forward-Looking Statements
This press release contains forward-looking statements about the business prospects of BioMarin Pharmaceutical Inc., including without limitation, statements about: the data presented at ISTH, including the four oral and two poster presentations, the development of BioMarin's valoctocogene roxaparvovec program generally, the impact of valoctocogene roxaparvovec gene therapy for treating patients with severe hemophilia A, a final approval decision for valoctocogene roxaparvovec, typically consistent with the CHMP recommendation, expected from the European Commission in Q3 2022 and the potential to transform the lives of these patients and the ongoing clinical programs generally. These forward-looking statements are predictions and involve risks and uncertainties such that actual results may differ materially from these statements. These risks and uncertainties include, among others: results and timing of current and planned preclinical studies and clinical trials of valoctocogene roxaparvovec, including final analysis of the data from these trials and the entire development program, including further assessment of safety events, any potential adverse events observed in the continuing monitoring of the patients in the clinical trials; the content and timing of decisions by the FDA, the EMA and other regulatory authorities; the content and timing of decisions by local and central ethics committees regarding the clinical trials; our ability to successfully manufacture valoctocogene roxaparvovec; and those factors detailed in BioMarin's filings with the Securities and Exchange Commission (SEC), including, without limitation, the factors contained under the caption "Risk Factors" in BioMarin's Quarterly Report on Form 10-Q for the quarter ended March 31, 2022 as such factors may be updated by any subsequent reports. Stockholders are urged not to place undue reliance on forward-looking statements, which speak only as of the date hereof. BioMarin is under no obligation, and expressly disclaims any obligation to update or alter any forward-looking statement, whether as a result of new information, future events or otherwise.
BioMarin is a registered trademark of BioMarin Pharmaceutical Inc.
Contacts:
Investors
Media
Traci McCarty
Debra Charlesworth
BioMarin Pharmaceutical Inc.
BioMarin Pharmaceutical Inc.
(415) 455-7558
(415) 455-7451
SOURCE BioMarin Pharmaceutical Inc.
Follow this link:
BioMarin Presents Findings from Studies of Valoctocogene Roxaparvovec, Investigational Gene Therapy, at the International Society on Thrombosis and...
Automating the Genomic Medicines of the Future – Bio-IT World
Contributed Commentary by Per Hammer, Cytiva
July 15, 2022 | Historically, the heavily regulated biopharma industry has been slow to adopt new technologies. However, a shift toward automation is vital to ensure that next-generation solutionssuch as cell and gene therapiesare produced at scale.
Less than one in five senior pharma executives strongly believe that frontier technologies, such as artificial intelligence, are widely adopted to support automation and increase the speed of specific processes. With cell therapies approved by global regulatory bodies, it is time to accelerate smart technologies and cell and gene therapy manufacturing.
Todays cell therapy treatments are often made on a small-scale, include manual preparation steps, and are produced for a clinical trial setting. Researchers spend days processing cellular material, monitoring its growth during the expansion phase, and preparing for re-administration to the patient. This process is demonstrated in administering autologous treatments so that every patient receives a unique living drug.
Though the current process is complex, it offers inspiring outcomes. For example, on April 1, 2022, the Food and Drug Administration (FDA) approved Kite Pharmas Yescarta, a chimeric antigen receptor (CAR) T-cell therapy for adult patients with large B-cell lymphoma. This kind of cancer is usually resistant to initial treatment and relapses within one year. With FDA approval, Yescarta (axicabtagene ciloleucel) is now the second-line treatment, a first for an autologous CAR T-cell therapy.
Cell Therapy Enters Mainstream
The exceptional results emerging from cell therapy clinical trials suggest we are entering a new phase of medical treatmentone where we can expect far more from our healthcare interventions than we ever imagined. Following the regulatory approval of autologous CAR T-cell therapies, the global cancer treatment landscape is changing, and the future is bright.
The success of COVID-19 vaccines signaled the arrival of the genomic medicines ageone where we hope to see cell and gene therapies deliver long-term remission and even cures for patients with some of the most complex diseases. According to the Alliance for Regenerative Medicine 2021 Annual Report, nearly 60% of the ongoing regenerative medicine clinical trials studied prevalent diseases by the end of the calendar year. But to get these powerful treatments to those who need them, we must have an automated manufacturing infrastructure that can generate cell therapies to meet increased demand in the coming years.
Saving Time Through Automation
Time is of the utmost importance, as biopharma manufacturing involves patient cells that have limited viability. Manual approaches to cell therapy production are time-consuming, and tasks such as checking cells at regular intervals during expansion are laborious. Another time-draining factor is the workflow and cleaning routines involved in maintaining a safe lab environment.
Automated solutions reduce or remove many of these challenges. After setting up a process, an operator can focus on other things while critical parameters such as temperature, pH level, gas transfer, and flow rates are monitored and controlled without human intervention.
Reducing Risks for Better Results
Manual cell processing solutions are complex, with many checkpoints across isolation, expansion, harvesting, and preservation stages. Unfortunately, each of these steps increases the risk potential. Despite the research teams expertise, there is still a chance that materials could be inadvertently contaminated during numerous open stages.
Additionally, limited process control can lead to difficulties in achieving high reproducibility. An automated modular solution minimizes these risks by bringing multiple steps within a closed, highly regulated, and controlled system.
Improving Manufacturing Efficiency
Changing a manufacturing process requires multiple manual routines and adjustments that must be checked and documented. However, documentation and protocols are less helpful when a customized process is used because they only apply to that specific setup.
Standardization would effectively improve manufacturing efficiency. This approach would ensure that what is learned in one project can be referenced in future work, with data and documentation applicable across different technology applications. A modular chain of connected systems allows for process variation with instruments running in customized configurations. Additionally, having control of an individual instrument leads to the straightforward use of built-in software and sensors.
Automated Manufacturing: The Way Forward for Cell and Gene Therapy
By using automated manufacturing to minimize human interaction, time, and resource requirements, it is possible to increase production speed and lower some risks and costs associated with commercialization.
The industry is ever-changing and adjusting its complex, yet exciting challenges will take some time. However, automation can create a significant advantage over competitors, providing the tools needed to produce cell therapies with the highest levels of safety and efficacy for patients.
Per Hammer has two decades of experience in the biopharma industry, mainly supporting customers in academics through process development and manufacturing. Per joined Cytiva in 2001, taking on several distinct roles in the company. Most recently, he progressed from Product Manager Leader for the Bioprocess Automation and Digital Team to Senior Global Product Manager for the Cell & Gene Therapy Automation and Digital Solutions. He can be reached at per.hammer@cytiva.com.
Read the original:
Automating the Genomic Medicines of the Future - Bio-IT World
Gene Editing Market is Expected to Reach USD 13.77 Billion With CAGR of 18% By Forecast 2027 Says Maximize Market Research (MMR) – Digital Journal
Gene Editing Market Is Expected To Reach USD 13.77 Billion By 2027 At A CAGR Of 18 percent.
Maximize Market Research has published a report on theGene Editing Marketthat provides a detailed analysis for the forecast period of 2022 to 2027.
Gene Editing Market Scope:
The report provides comprehensive market insights for industry stakeholders, including an explanation of complicated market data in simple language, the industrys history and present situation, as well as expected market size and trends. The research investigates all industry categories, with an emphasis on key companies such as market leaders, followers, and new entrants. The paper includes a full PESTLE analysis for each country. A thorough picture of the competitive landscape of major competitors in the Gene Editing market by goods and services, revenue, financial situation, portfolio, growth plans, and geographical presence makes the study an investors guide.
Request Free Sample:@https://www.maximizemarketresearch.com/request-sample/2748
Gene Editing Market Overview:
The prospect of treating genetic abnormalities, infectious illnesses, and cancer via gene editing is promising. Gene editing is a form of genetic modification in which, with the use of a designed nuclease or molecular scissor, DNA is added to, removed from, or replaced in an organisms genome in order to treat a specific condition. These nucleases damage DNA at specified sites in the genome to produce double-strand breaks. Targeted mutations result from the repair of the generated double-stranded breaks by non-homologous end joining or homologous recombination (edits).
Gene Editing Market Dynamics:
Gene-editing technologies ongoing technological breakthroughs are a key element fueling the markets growth. Additionally, government financing is readily available, there is more genomics research underway, and cancer and other genetic illnesses are becoming more common, all of which contribute to the markets growth. The rise of the genome editing market is also aided by the creation of breakthrough diagnostic tools based on CRISPR that help to lessen the negative effects of the COVID-19 pandemic.
However, there are several constraints that limit the markets growth to some extent, including the high cost of genomic equipment and rising worries about the dangers and moral dilemmas related to genome editing. However, the presence of major players in developing nations and applications in various stages of the drug development process are a few variables that soon open up profitable potential for the genome editing industry.
The gene editing market appears to be fragmented because there are numerous major and minor significant players. These market participants look to gain a competitive edge through strategic actions like partnerships, acquisitions, growths, collaborations, and the introduction of new products and technologies. Growing investments in genomics R&D, the prevalence of hereditary diseases and chronic disorders, and rapid advancements in genetic engineering are key factors supporting the market share for gene editing.
The market for genome alteration is hampered by certain problems. It is expected that ethical issues with genetic editing, such as safety and the high cost of gene therapies, may somewhat restrain market growth over the predicted years. Market limitations also are brought about by rigorous regulatory rules and unfavourable public opinions of genetic research.
The leading companies in the gene editing industry may face difficulties due to a number of market-related worries. This includes the price of the available genetic editing tools. The markets potential growth may be constrained by expensive maintenance and treatment expenses for genome alteration therapies and associated treatments, as well as by a lack of infrastructure in medium- and low-income countries.
Gene Editing MarketRegional Insights:
During the forecast period, North America is expected to hold a sizable portion of the worldwide genome editing market. The market in the region is expected to expand in the coming years due to the development of gene therapy in the United States, an increase in the consumption of genetically modified crops, an increase in the prevalence of infectious diseases and cancer, and the accessibility of research grants and funding.
Gene Editing MarketSegmentation:
By Technology:
By Application:
By End User:
Gene Editing Market Key Competitors:
To Get A Copy Of The Sample of the Gene Editing Market, Click Here:@https://www.maximizemarketresearch.com/market-report/gene-editing-market/2748/
About Maximize Market Research:
Maximize Market Research is a multifaceted market research and consulting company with professionals from several industries. Some of the industries we cover include medical devices, pharmaceutical manufacturers, science and engineering, electronic components, industrial equipment, technology and communication, cars and automobiles, chemical products and substances, general merchandise, beverages, personal care, and automated systems. To mention a few, we provide market-verified industry estimations, technical trend analysis, crucial market research, strategic advice, competition analysis, production and demand analysis, and client impact studies.
Contact Maximize Market Research:
3rd Floor, Navale IT Park, Phase 2
Pune Banglore Highway, Narhe,
Pune, Maharashtra 411041, India
[emailprotected]
View original post here:
Gene Editing Market is Expected to Reach USD 13.77 Billion With CAGR of 18% By Forecast 2027 Says Maximize Market Research (MMR) - Digital Journal
Adverum Biotechnologies Presents Best-Corrected Visual Acuity and Central Subfield Thickness Analyses After a Single IVT Injection of ADVM-022…
- Study participants had an 81%-98% reduction in annualized anti-VEGF injections and demonstrated continuous aflibercept expression levels through three years
- Mean best-corrected visual acuity and central subfield thickness were maintained or improved in subjects treated with ADVM-022
-The Phase 2 LUNA trial is expected to dose the first subject in the third quarter of 2022 and preliminary data anticipated throughout 2023
REDWOOD CITY, Calif., July 15, 2022 (GLOBE NEWSWIRE) -- Adverum Biotechnologies Inc. (Nasdaq: ADVM), a clinical-stage company that aims to establish gene therapy as a new standard of care for highly prevalent ocular diseases, today announced new data from the OPTIC study treating wet age-related macular degeneration (wet AMD) during the American Society of Retina Specialists (ASRS) 2022 Annual Meeting. New data presented are as of February 24, 2022 and include best-corrected visual acuity (BCVA) and central subfield thickness (CST) maintenance, as well as reduction in CST fluctuation after a single, in-office intravitreal (IVT) injection of ADVM-022, ixoberogene soroparvovec (Ixo-vec), in subjects requiring frequent anti-VEGF injections for their wet AMD.
We are pleased to present our findings on BCVA and CST from the OPTIC trial, establishing that maintenance in both BCVA and CST, as well as a reduction in CST fluctuations, were sustained through at least two years, suggesting the long-term durability of Ixo-vec after a single IVT injection, stated Richard Beckman, M.D., chief medical officer at Adverum Biotechnologies. As several publications have recently highlighted, retinal CST fluctuations over time are associated with poor long-term visual outcomes for patients. The combination of durable maintenance of BCVA and reduced CST fluctuations in subjects who previously required frequent IVT injections further support our belief that Ixo-vec can provide better long-term benefit for wet AMD patients. We are excited by the possibility of extending the treatment benefit for this lifelong disease from the order of months to the order of years.
Data Highlights as of February 24, 2022
We are excited to present these encouraging data, showing continuous and stable aflibercept expression for over three years in our OPTIC trial in subjects with wet AMD, commented Laurent Fischer, M.D., president and chief executive officer at Adverum Biotechnologies. As we recently announced, we completed our IND amendment with the U.S. Food and Drug Administration, received European Medicines Agency PRIME designation, and are preparing to initiate the Phase 2 LUNA trial of Ixo-vec in wet AMD. The LUNA trial was designed after a detailed data review from all 55 participants treated to date with a single ADVM-022 injection. Four new enhanced prophylactic steroid regimens will be evaluated in LUNA with the aim of providing steroid coverage during the period of peak immunogenicity. Our goal is to enhance the safety profile of ADVM-022 while building upon the impressive efficacy profile we continue to see in the OPTIC trial. We plan to dose the first subjects in the third quarter of 2022 and anticipate preliminary data from LUNA throughout 2023 and look forward to providing more detail on the expected timeline once we can assess the pace of enrollment.
The LUNA trial is a multicenter, double-masked, randomized, parallel-group Phase 2 trial evaluating two doses of Ixo-vec, including 2E11 and a new, lower 6x10^10 vg/eye (6E10) dose, in up to 72 patients with wet AMD. The LUNA trial will assess four new enhanced prophylactic steroid regimens, including local steroids and combinations of local and systemic steroids to test the relative contribution of local versus systemic AAV exposure on ocular inflammation. Specific regimens include topical difluprednate (Durezol), IVT Ozurdex, or a combination of either topical Durezol or IVT Ozurdex with oral prednisone.
The trial will randomize the participants equally between the 2E11 and 6E10 Ixo-vec doses across four prophylactic steroid regimens and will be conducted at approximately 40 sites in the U.S. and Europe. The primary endpoints will be similar to the OPTIC trial and focus on mean change in BCVA and CST from baseline to one year, and incidence and severity of adverse events. Other data points will include protein expression of aflibercept starting at 10 weeks and an interim analysis at 26 weeks. The study will also evaluate the effectiveness and tolerability of the prophylactic steroid regimens.
As an investigator in OPTIC, I have observed the potential of ADVM-022 to significantly reduce the treatment burden for my patients with neovascular age-relatedmacular degeneration. In the latest data from the OPTIC trial, we have seen a manageable safety profile, robust aflibercept expression, and sustained anatomical improvements after two years following a single 2E11 dose of ADVM-022, said Dante Pieramici, M.D., partner, California Retina Consultants, and presenter of the data at ASRS. I look forward to participating as a LUNA investigator and building on the efficacy and safety profile in OPTIC with a new, lower 6E10 dose and to determine an optimal prophylactic steroid regimen for patients.
About Wet Age-Related Macular Degeneration
Wet AMD, also known as neovascular AMD or nAMD, is an advanced form of AMD, affecting approximately 10% of patients living with AMD. Wet AMD is a leading cause of blindness in patients over 65 years of age, with a prevalence of approximately 20 million individuals worldwide living with this condition. The incidence of new cases of wet AMD is expected to grow significantly worldwide as populations age. AMD is expected to impact 288 million people worldwide by 2040, with wet AMD accounting for approximately 10% of those cases.
About OPTIC Trial of ADVM-022 in Wet AMD
ADVM-022 is Adverums clinical-stage gene therapy product candidate being developed for the treatment of wet AMD. ADVM-022 utilizes a propriety vector capsid, AAV.7m8, carrying an aflibercept coding sequence under the control of a proprietary expression cassette. Unlike other ophthalmic gene therapies that require a surgery to administer the gene therapy under the retina (sub-retinal approach), ADVM-022 has the advantage of being administered as a one-time IVT injection in the office and is designed to deliver long-term efficacy and reduce the burden of frequent anti-VEGF injections, optimize patient compliance, and improve vision outcomes for patients with wet AMD.
The OPTIC trial is designed as a multi-center, open-label, dose-ranging, safety and efficacy trial of ADVM-022 in patients with wet AMD who have demonstrated responsiveness to anti-VEGF treatment. Patients in OPTIC are treatment-experienced, and previously required frequent anti-VEGF injections to manage their wet AMD and to maintain functional vision.
About Adverum Biotechnologies
Adverum Biotechnologies (NASDAQ: ADVM) is a clinical-stage company that aims to establish gene therapy as a new standard of care for a number of highly prevalent ocular diseases with the aspiration of developing functional cures for these diseases to restore vision and prevent blindness. Leveraging the research capabilities of its proprietary, intravitreal (IVT) platform, Adverum is developing durable, single-administration therapies, designed to be delivered in physicians offices, to eliminate the need for frequent ocular injections to treat these diseases. Adverum is evaluating its novel gene therapy candidate, ADVM-022, ixoberogene soroparvovec (Ixo-vec), as a one-time, IVT injection for patients with neovascular or wet age-related macular degeneration. By overcoming the challenges associated with current treatment paradigms for these debilitating ocular diseases, Adverum aspires to transform the standard of care, preserve vision, and create a profound societal impact around the globe. For more information, please visit http://www.adverum.com.
Forward-looking Statements
Statements contained in this press release regarding events or results that may occur in the future are forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. Such statements include but are not limited to statements regarding Adverums plans to initiate a Phase 2 study in wet AMD to investigate the 2x10^11 vg/eye dose and a lower 6x10^10 vg/eye dose of ADVM-022, as well as new enhanced prophylactic steroid regimens, including local steroids and a combination of local and systemic steroids, planned for the third quarter of 2022, as well as the benefits Adverum expects from this trial, and the timing of preliminary data from the LUNA trial. Actual results could differ materially from those anticipated in such forward-looking statements as a result of various risks and uncertainties, including risks inherent to, without limitation: Adverums novel technology, which makes it difficult to predict the timing of commencement and completion of clinical trials; regulatory uncertainties; enrollment uncertainties the results of early clinical trials not always being predictive of future clinical trials and results; and the potential for future complications or side effects in connection with use of ADVM-022. Additional risks and uncertainties facing Adverum are set forth under the caption Risk Factors and elsewhere in Adverums Securities and Exchange Commission (SEC) filings and reports, including Adverums Quarterly Report on Form 10-Q for the quarter ended March 31, 2022 filed with the SEC on May 12, 2022. All forward-looking statements contained in this press release speak only as of the date on which they were made. Adverum undertakes no obligation to update such statements to reflect events that occur or circumstances that exist after the date on which they were made.
Corporate & Investor Inquiries
Anand ReddiVice President, Head of Corporate Strategy and External Affairs & EngagementAdverum Biotechnologies, Inc.T: 650-649-1358E: areddi@adverum.com
Media
Megan TalonAssociate Director, Corporate CommunicationsAdverum Biotechnologies, Inc.T: 650-649-1006E: mtalon@adverum.com
Global Osteoarthritis Gene Therapy Market 2022 Industry Growth and Product Scope 2028 Top Players as Medipost, Mundipharma Travel Adventure Cinema -…
According to the latest report by MarketandResearch.biz, titled Global Osteoarthritis Gene Therapy Market from 2022 to 2028, covers reliable and updated information, quantitative and qualitative assessments of industry analysts and key competitors across the industry value chain. The report contains a lot of features of the global Osteoarthritis Gene Therapy industry which includes general market conditions, trends, inclinations, key players, opportunities, and geographical analysis.
This research helps the clients with understanding the global Osteoarthritis Gene Therapy market in terms of its definition, division, market potential, compelling patterns, and the difficulties that the market is facing. The report deeply tracks factors such as growth, limitations, and the planned characteristics of each point related to this market.
DOWNLOAD FREE SAMPLE REPORT: https://www.marketandresearch.biz/sample-request/224119
The report presents decisive clarity towards highlighting the most effective segment that enables heavy revenue flow. Relevant details about other market segments are also discussed in the report to show logical conclusions about the most prominent segments in the global Osteoarthritis Gene Therapy market. The report is divided into various segments such as by-products, applications, and regions which will give a universal view of the market growth.
The well-established players in the global Osteoarthritis Gene Therapy market are:
In market segmentation by types, the report covers:
In market segmentation by applications, the report covers the following uses:
Major regions discussed in the research report of the market include:
ACCESS FULL REPORT: https://www.marketandresearch.biz/report/224119/global-osteoarthritis-gene-therapy-market-growth-status-and-outlook-2021-2027
The pointers covered in the market dynamics are the drivers, restraints, and opportunities which affect the growth of the global Osteoarthritis Gene Therapy market during 2022 to 2028 period. The global regional analysis of the market was conducted and is mentioned in the report. Moreover, all the key pointers are explained briefly on a regional basis. The report also includes Porters Five Forces model to give the competitive scenario of the global Osteoarthritis Gene Therapy market.
The report covers expected revenue growth, potential lucrative opportunities, product ranges, pricing factors, and parameters to confer the emerging and new entrants in the industry with structured market data. The report caters to know the dynamics of the global Osteoarthritis Gene Therapy market opportunities and anticipate change.
Customization of the Report:
This report can be customized to meet the clients requirements. Please connect with our sales team ([emailprotected]), who will ensure that you get a report that suits your needs. You can also get in touch with our executives on +1-201-465-4211 to share your research requirements.
Contact UsMark StoneHead of Business DevelopmentPhone: +1-201-465-4211Email: [emailprotected]
Other Related Reports:
Read the original here:
Global Osteoarthritis Gene Therapy Market 2022 Industry Growth and Product Scope 2028 Top Players as Medipost, Mundipharma Travel Adventure Cinema -...
Gene Synthesis Market Registered Substantial CAGR Growth Of 27.0% Forecast to 2029 and Market Is Analyzed By Size, Trends, Analysis, Future Scope,…
Gene Synthesis Market report has a lot of features to offer for Gene Synthesis industry which includes general market conditions, trends, inclinations, key players, opportunities, and geographical analysis. This report emphasizes on changing dynamics, growth-driving factors, restraints, and limitations. It includes a detailed analysis of the Gene Synthesis market in customer requirements, customer preferences, and the competitive landscape of the overall market. This report employs SWOT analysis technique for the assessment of the development of the most remarkable market players. An influential Gene Synthesis market report offers broader perspective of the market place with its comprehensive market insights and analysis.
Gene Synthesis business report makes available an overview of the Gene Synthesis industry which is gaining momentum in the last few years. The market report uses a range of steps for collecting, recording, analysing and interpreting market data to make this report all-inclusive. It also offers an outline of the industry that might promote interest among prospective investors, large corporations and everyday users who could participate in the next big opportunity or make their lives just a little easier. The world class Gene Synthesis report comprises of the list of leading competitors, strategic industry analysis and the insights of key factors influencing the Gene Synthesis industry.
Download Sample [emailprotected] https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-gene-synthesis-market
Data Bridge Market Research analyses that the market is growing with a CAGR of 27.0% in the forecast period and is expected to reach USD 21,156.93 million by 2028. Rising prevalence of infectious diseases demands the novel and advanced gene therapy products, vaccines, personalized medicines among others which can be achieved by using gene sequences, thus acts as driver for the gene synthesis market growth.
Gene synthesisis technique of synthetic biology which is employed for the production or creation of artificial gene under laboratory conditions. Gene synthesis technique is used for creating fusion proteins, molecular cloning or in order to achieve high level of protein expression. Traditionally, molecular cloning techniques used which consumes a lot of time and requires a lot of money investment.
Rise in adoption of gene therapy has enhanced the requirement of rapid gene synthesis products which provides with error free gene sequences in less interval of time and hence acts as driver for the gene synthesis market. The ethical issues associated with genetic engineering lowers the demand of gene constructs having the potential to interfere with organisms genomic composition which is restraining the gene synthesis market growth. Increasing demand of personalized medicines has paved the way for genomic which demands the error free gene sequences in at low cost in less span of time, thus acts as an opportunity for the gene synthesis market. Long approval time for gene synthesizer and products synthesized through these products restrict the product manufacturers to earn potential benefit in the market and impacts the overall market size, hence acts as challenge for the gene synthesis market growth.
Market Players Covered:
Eurofins Genomics, ATG:biosynthetics GmbH, Merck KGaA, Aldevron, Synbio Technologies, Thermo Fisher Scientific Inc, Genscript, General Biosystems, Twist Bioscience, Evonetix, Bio-synthesis Inc, LGC Limited, Eurofins Genomics Blue Heron LLC, Macrogen,Inc, Science Exchange, Inc, Integrated DNA Technologies, Inc, Origene Technologies, INC., Proteo Genix, Biocat GMBH among other domestic players. DBMR analysts understand competitive strengths and provide competitive analysis for each competitor separately.
Browse Full Report Along With Facts and Figures @https://www.databridgemarketresearch.com/reports/global-gene-synthesis-market
The gene synthesis market is analysed and market size information is provided by the country, product & services, gene type, product type, application, method, end user and distribution channel as referenced above.
The countries covered in the gene synthesis market report are the U.S., Canada and Mexico, U.K., Germany, France, Spain, Italy, Netherlands, Switzerland, Russia, Turkey, Austria, Ireland, and Rest of Europe, China, South Korea, Japan, India, Australia, Singapore, Malaysia, Indonesia, Thailand, Philippines and rest of Asia-Pacific, South Africa, Saudi Arabia, U.A.E., Israel, Egypt and rest of Middle East and Africa, Brazil, Argentina, and rest of South America.
Software and services segment.in North American region is expected to grow with the highest growth rate in the forecast period of 2021 to 2028 because of increasing gene therapy based medications. The software and services segment in Germany is dominating the European market owing to increasing research and development for the gene synthesis used in vaccine preparation. China is leading the growth of the Asia-Pacific market and Software and services segment is dominating in this country due to presence of highest number of gene synthesis providers.
The country section of the report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as new sales, replacement sales, country demographics, regulatory acts and import-export tariffs are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of sales channels are considered while providing forecast analysis of the country data.
Highlights of TOC:
Chapter 1: Market overview
Chapter 2: Global Gene Synthesis Market
Chapter 3: Regional analysis of the Global Gene Synthesis Market industry
Chapter 4: Gene Synthesis Market segmentation based on types and applications
Chapter 5: Revenue analysis based on types and applications
Chapter 6: Market share
Chapter 7: Competitive Landscape
Chapter 8: Drivers, Restraints, Challenges, and Opportunities
Chapter 9: Gross Margin and Price Analysis
Check Complete Table of Contents with List of Table and Figures @ https://www.databridgemarketresearch.com/toc/?dbmr=global-gene-synthesis-market
Highlights of Following Key Factors of Global Gene Synthesis Market
A detailed description of the companys operations and business divisions
Analysts summarization of the companys business strategy
Progression of key events associated with the company
A list of major products, services and brands of the company
A list of key competitors to the company
A list and contact details of key locations and subsidiaries of the company
The latest financial ratios derived from the annual financial statements published by the company with 5 years history.
Browse Related Reports:
About Data Bridge Market Research:
Data Bridge set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavors to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process.
Contact us:
Data Bridge Market Research
US: +1 888 387 2818
UK: +44 208 089 1725
Hong Kong: +852 8192 7475
Email:[emailprotected]
Will 100 Million Die From the COVID Vax by 2028? – The Epoch Times
Via this genetic engineering experiment, theyve literally injected seeds of demise into everyday people like a cockroach spray. Based on a 2011 estimate, he believes an extra 700 million will be killed from this bioweapon and theyve known about the risks since 2005.
In this revealing interview with Greg Hunter of USAWatchdog.com, David Martin, Ph.D., presents evidence that COVID-19 injections are not vaccines but bioweapons that are being used as a form of genocide across the global population.1
In March 2022, Martin filed a federal lawsuit against President Biden, the Department of Health and Human Services and the Centers for Medicare and Medicaid Services alleging that COVID-19 shots turn the body into a biological weapons factory, manufacturing spike protein. Not only is the term vaccination misleading when referring to COVID-19 shots, its inaccurate since they are actually a form of gene therapy.2
And we are not only not going to be sued for, you know, any libel or misinformation, we are actually holding people criminally accountable for their domestic terrorism, their crimes against humanity and the story of the coronavirus weaponization that goes back to 1998, Martin says.3
Martin has been in the business of tracking patent applications and approvals since 1998. His company, M-Cam International Innovation Risk Management, is the worlds largest underwriter of intangible assets used in finance in 168 countries. M-Cam has also monitored biological and chemical weapons treaty violations on behalf of the U.S. government, following the anthrax scare in September 2001.4
According to Martin, there are more than 4,000 patents relating to the SARS coronavirus. His company has also done a comprehensive review of the financing of research involving the manipulation of coronaviruses that gave rise to SARS as a subclade of the beta coronavirus family.
Much of the research was funded by the National Institutes of Allergy and Infectious Diseases (NIAID) under the direction of Dr. Anthony Fauci.5Martin explained:6
I think its important for your listeners and viewers to remember that it was 1999 when Anthony Fauci and Ralph Baric at the University of North Carolina Chapel Hill decided to start weaponizing coronavirus they patented in 2002 and you heard that date correctly, thats a year before the SARS outbreak in China.
You know, they knew it was a bioweapon since 2005. They knew it was effective at harming populations, intimidating and coercing populations
According to Martin, the spike protein that the COVID-19 shots manufacture is a computer simulation of a chimera of the spike protein of coronavirus. It is, in fact, not a coronavirus vaccine. It is a spike protein instruction to make the human body produce a toxin, and that toxin has been scheduled as a known biologic agent of concern with respect to biological weapons for the last now decade and a half, he said.7
Rather than being a public health measure as they were widely campaigned to be, COVID-19 shots are an act of bioweapons and bioterrorism. Martin shared that in 2015, Dr. Peter Daszak, head of the EcoHealth Alliance that funneled research dollars from the NIAID to the Wuhan Institute of Virology for coronavirus research, stated:8
We need to increase public understanding of the need for medical countermeasures such as a pan-coronavirus vaccine. A key driver is the media and the economics will follow the hype. We need to use that hype to our advantage, to get to the real issues. Investors will respond if they see profit at the end of the process.
Daszak, who Martin refers to as the money launderer in chief, actually stated that this entire exercise was a campaign of domestic terror to get the public to accept the universal vaccine platform using a known biological weapon. And that is their own words, not my interpretation, Martin said.9
Both Pfizer and Modernas COVID-19 shots contain nucleic acid sequences that are not part of nature and have not been previously introduced to the human body. This amounts to a genetic engineering experiment that did not go through animal studies or clinical trials.
However, already people are dying from the shots and, Martin states, many more will due to issues such as blood clots, damage to the cardiovascular system and problems with liver, kidney and pulmonary function.10
An onslaught of reproductive and cancer cases related to the shots are also anticipated. The fact of the matter is an enormous number of people who are injected are already carrying the seeds of their own demise, Martin said.11As for how many may die, Martin believes the numbers may have been revealed back in 2011, when the World Health Organization announced their decade of vaccination:12
Based on their own 2011 estimate, and this is a chilling estimate, but we just have to put it out there When the Bill and Melinda Gates Foundation, the Chinese CDC, the Jeremy Farrar Wellcome Trust and others published The Decade of Vaccination for the World Health Organization back in 2011 their stated objective was a population reduction of 15% of the worlds population.
Put that in perspective, thats about 700 million people dead and that would put the U.S. participation in that certainly as a pro rata of injected population somewhere between 75 and 100 million people.
When asked what timeframe these people may die in, Martin suggested theres a lot of economic reasons why people hope that its between now and 2028.13This is because of a tiny little glitch on the horizon the projected illiquidity of the Social Security, Medicare and Medicaid programs by 2028.
So the fewer people who are recipients of Social Security, Medicare and Medicaid, the better, Martin said. Not surprisingly, its probably one of the motivations that led to the recommendation that people over the age of 65 were the first ones getting injected.14Other populations at risk are caregivers, including health care providers, and others in the workforce who were forced to be injected, such as pilots.
Why is it that were suddenly having 700 flights a day being canceled because, allegedly, airlines dont have pilots? the dirty secret is there a lot of pilots who are having microvascular problems and clotting problems, and that keeps them out of the cockpit, which is a good place to not have them if theyre going to throw a clot for a stroke or a heart attack,Martin said.
But the problem is were going to start seeing that exact same phenomenon in the health care industry and at a much larger scale, which means we now have, in addition to the problem of the actual morbidity and mortality, meaning people getting sick and people dying.
We actually have that targeting the health care industry writ large, which means we are going to have doctors and nurses who are going to be among the sick and the dead. And that means that the sick and the dying also do not get care.15
Its been stressed by the media and public health officials that COVID-19 shots do not alter DNA. However, Martin brings attention to a little-known grant from the National Science Foundation, known as Darwinian chemical systems,16which involved research to incorporate mRNA into targeted genomes. According to Martin:17
Moderna was started on the back of a 10-year National Science Foundation grant. And that grant was called Darwinian chemical systems the project that gave rise to the Moderna company itself was a project where they were specifically figuring out how to get mRNA to write itself into the genome of whatever target they were going after.
That could be a single-celled organism, it could be a multi-celled organism or it could be a human. And the fact of the matter is Moderna was started on the back of having proven that mRNA can be transfected and write itself into the human genome.
It is completely unknown what the short- or long-term effects of the spike protein analog thats inside people who received COVID-19 injections will be. But with respect to alteration of the genome, Martin states that data show mRNA has the capacity to write into the DNA of humans, and as such, the long-term effects are not going to merely be symptomatic. The long-term effects are going to be the human genome of injected individuals is going to be altered.18
The 2001 anthrax attack, which came out of medical and defense research, led to the passage of the PREP Act, which removed liability for manufacturers of emergency medical countermeasures.
This means that as long as the U.S. is under a state of emergency, things like COVID-19 vaccines are allowed under emergency use authorization. And as long as the emergency use authorization is in effect, the makers of these experimental gene therapies are not financially liable for any harm that comes from their use.
That is, provided theyre vaccines. If these injections are NOT vaccines, then the liability shield falls away, because there is no liability shield for a medical emergency countermeasure that is gene therapy. Further, lawsuits that can prove the companies engaged in fraud will also negate the liability shield. Martin states:19
One of the convenient things about the PREP Act is the immunity shield from liability actually is only as good as the absence of fraud. Because if there was fraud in the promulgation of the events, leading to an emergency use authorization, then all of the immunity shield gets wiped out.
So the reason why it is so important for conversations like the one were having to actually be promoted and be advanced is because the pharmaceutical companies and this includes Pfizer and Moderna and J&J know they are perpetuating a fraud. The great thing about this is when that fraud is established, 100% of the liability flows back to them.
when a fraud was the basis for a fraud, then we actually have a number of other legal remedies that allow you to pierce that veil. So in the end, theres no question and its quite evident based on the current mortality and morbidity data that given the fact that when it comes to biological weapons and bioterror each count comes with $100 million penalty. Thats what the federal statute gives us.
The penalty for corporate domestic terrorism, when you have per count $100 million a pop liabilities that is an existential threat that takes a company like Pfizer or takes a company like Moderna out of existence. And that is what were working for every day.
If youd like to follow the progress of the ongoing legal cases seeking to expose the truth that a criminal organization is seeking to obtain control over the global population via the creation of patented bioweapons marketed as novel viruses and injections you can find all the details at ProsecuteNow.io, a website compiled by Martin and colleagues.20
Originally publishedJuly 16, 2022 on Mercola.com
Views expressed in this article are the opinions of the author and do not necessarily reflect the views of The Epoch Times. Epoch Health welcomes professional discussion and friendly debate. To submit an opinion piece, please follow these guidelines and submit through our form here.
See original here:
Will 100 Million Die From the COVID Vax by 2028? - The Epoch Times
Comparing 4D Molecular Therapeutics (FDMT) and Its Rivals – Defense World
4D Molecular Therapeutics (NASDAQ:FDMT Get Rating) is one of 264 public companies in the Biological products, except diagnostic industry, but how does it weigh in compared to its peers? We will compare 4D Molecular Therapeutics to similar companies based on the strength of its institutional ownership, analyst recommendations, earnings, valuation, profitability, risk and dividends.
This table compares 4D Molecular Therapeutics and its peers net margins, return on equity and return on assets.
76.6% of 4D Molecular Therapeutics shares are owned by institutional investors. Comparatively, 53.5% of shares of all Biological products, except diagnostic companies are owned by institutional investors. 11.2% of 4D Molecular Therapeutics shares are owned by company insiders. Comparatively, 16.4% of shares of all Biological products, except diagnostic companies are owned by company insiders. Strong institutional ownership is an indication that large money managers, endowments and hedge funds believe a stock will outperform the market over the long term.
4D Molecular Therapeutics peers have higher revenue and earnings than 4D Molecular Therapeutics. 4D Molecular Therapeutics is trading at a lower price-to-earnings ratio than its peers, indicating that it is currently more affordable than other companies in its industry.
This is a summary of current ratings and price targets for 4D Molecular Therapeutics and its peers, as provided by MarketBeat.
4D Molecular Therapeutics presently has a consensus target price of $26.00, suggesting a potential upside of 157.94%. As a group, Biological products, except diagnostic companies have a potential upside of 92.79%. Given 4D Molecular Therapeutics stronger consensus rating and higher possible upside, analysts clearly believe 4D Molecular Therapeutics is more favorable than its peers.
4D Molecular Therapeutics has a beta of 1.26, meaning that its stock price is 26% more volatile than the S&P 500. Comparatively, 4D Molecular Therapeutics peers have a beta of 0.75, meaning that their average stock price is 25% less volatile than the S&P 500.
4D Molecular Therapeutics beats its peers on 8 of the 13 factors compared.
(Get Rating)
4D Molecular Therapeutics, Inc., a clinical-stage gene therapy company, develops product candidates using its adeno-associated viruses vectors. It develops a portfolio of gene therapy product candidates focuses in three therapeutic areas: ophthalmology, cardiology, and pulmonology. The company has three product candidates that are in clinical trials: 4D-125 that is in a Phase 1/2 clinical trial for the treatment of X-linked retinitis pigmentosa; 4D-110 that is in a Phase 1/2 clinical trial for the treatment of choroideremia; and 4D-310, which is in a Phase 1/2 clinical trial for the treatment of Fabry disease. Its two IND candidates are 4D-150 for the treatment of wet age-related macular degeneration and 4D-710 for the treatment of cystic fibrosis lung disease. 4D Molecular Therapeutics, Inc. has research and collaboration arrangements with uniQure; CRF; Roche; and CFF. The company was founded in 2013 and is headquartered in Emeryville, California.4D Molecular Therapeutics, Inc., a clinical-stage gene therapy company, develops product candidates using its adeno-associated viruses vectors. It develops a portfolio of gene therapy product candidates focuses in three therapeutic areas: ophthalmology, cardiology, and pulmonology. The company has three product candidates that are in clinical trials: 4D-125 that is in a Phase 1/2 clinical trial for the treatment of X-linked retinitis pigmentosa; 4D-110 that is in a Phase 1/2 clinical trial for the treatment of choroideremia; and 4D-310, which is in a Phase 1/2 clinical trial for the treatment of Fabry disease. Its two IND candidates are 4D-150 for the treatment of wet age-related macular degeneration and 4D-710 for the treatment of cystic fibrosis lung disease. 4D Molecular Therapeutics, Inc. has research and collaboration arrangements with uniQure; CRF; Roche; and CFF. The company was founded in 2013 and is headquartered in Emeryville, California.
Receive News & Ratings for 4D Molecular Therapeutics Daily - Enter your email address below to receive a concise daily summary of the latest news and analysts' ratings for 4D Molecular Therapeutics and related companies with MarketBeat.com's FREE daily email newsletter.
Link:
Comparing 4D Molecular Therapeutics (FDMT) and Its Rivals - Defense World
Boyle Heights Selected as Host Site for Artificial Intelligence Bootcamp APPLICATIONS NOW OPEN! – GlobeNewswire
BOYLE HEIGHTS, Calif., July 14, 2022 (GLOBE NEWSWIRE) -- Global biotherapeutics leader CSL Behring will host a Mark Cuban Foundation Artificial Intelligence (AI) Bootcamp for high school students in the Fall of 2022 in conjunction with the i.am/Angel Foundation. The No Cost AI Bootcamp in Boyle Heights will be targeted at high school students and will introduce underserved students in grades 9 through 12 to basic AI concepts and skills.
CSL Behring is one of 20+ host companies selected to host 30 camps across the US in Fall 2022.
The CSL Behring Bootcamp will be held over four consecutive Saturdays starting on October 22nd and ending on November 12th.
The student and parent application are now open at markcubanai.org/application. Students do not need any prior experience with computer science, programming, or robotics to apply and attend.
Throughout the AI Bootcamp, students will learn what artificial intelligence is and is not, where they already interact with AI in their own lives, and the ethical implications of AI systems including but not limited to TikTok recommendations, smart home assistants, facial recognition, and self-driving cars to name a few.
Students will benefit from volunteer mentor instructors who are knowledgeable about data science and able to help students quickly understand material normally taught at a collegiate level. As part of the 5-hour curriculum, students also get to work in Microsoft Azure, Microsoft's cloud computing platform, each day to build their own AI applications related to Chatbots, Computer Vision, Machine Learning, and Natural Language Processing.
The Mark Cuban Foundation provides the bootcamps curriculum materials, trains volunteer mentors, and recruits and selects local students to attend camp. In addition, the Mark Cuban Foundation and CSL Behring work together to provide food, transportation, and access to laptops for students at no cost throughout the duration of Bootcamp.
"This bootcamp was a great experience and opened my eyes to the multitude of ways that AI can be used. Would definitely recommend it!" - Nhaomi L., CSL Behring 2021
Founded by Mark Cuban in 2019, the AI Bootcamp initiative has hosted free AI bootcamps for students across several US cities, including Dallas, Pasadena, Chicago, Pittsburgh, Detroit, and Atlantic City to name a few. The Mark Cuban Foundation has impacted 450+ students to date and has a goal to have 1,000 students graduate from AI Bootcamps Program in 2023.
CSL Behring develops and delivers innovative therapies for people living with rare and serious conditions. The companys global cell & gene therapy research hub is located in nearby Pasadena.
Students interested in applying to the Mark Cuban Foundation AI Bootcamp should do so before Thursday, September 1st, 2022 at markcubanai.org/application. To see our 2022 camp locations and to learn more about the Mark Cuban Foundation AI Bootcamps, please visit markcubanai.org/faq.
Contact: Carli Lidiak, Mark Cuban FoundationPhone: 309-840-0348Email: carli.lidiak@markcubanai.org
See more here:
Boyle Heights Selected as Host Site for Artificial Intelligence Bootcamp APPLICATIONS NOW OPEN! - GlobeNewswire
Genome-wide analyses of 200,453 individuals yield new insights into the causes and consequences of clonal hematopoiesis – Nature.com
Zhang, L. & Vijg, J. Somatic mutagenesis in mammals and its implications for human disease and aging. Annu. Rev. Genet. 52, 397419 (2018).
CAS PubMed PubMed Central Article Google Scholar
Martincorena, I. & Campbell, P. J. Somatic mutation in cancer and normal cells. Science 349, 14831489 (2015).
CAS PubMed Article Google Scholar
Kakiuchi, N. & Ogawa, S. Clonal expansion in non-cancer tissues. Nat. Rev. Cancer 21, 239256 (2021).
CAS PubMed Article Google Scholar
Genovese, G. et al. Clonal hematopoiesis and blood-cancer risk inferred from blood DNA sequence. N. Engl. J. Med. 371, 24772487 (2014).
PubMed PubMed Central Article CAS Google Scholar
Jaiswal, S. et al. Age-related clonal hematopoiesis associated with adverse outcomes. N. Engl. J. Med. 371, 24882498 (2014).
PubMed PubMed Central Article CAS Google Scholar
McKerrell, T. et al. Leukemia-associated somatic mutations drive distinct patterns of age-related clonal hemopoiesis. Cell Rep. 10, 12391245 (2015).
CAS PubMed PubMed Central Article Google Scholar
Xie, M. et al. Age-related mutations associated with clonal hematopoietic expansion and malignancies. Nat. Med. 20, 14721478 (2014).
CAS PubMed PubMed Central Article Google Scholar
Abelson, S. et al. Prediction of acute myeloid leukaemia risk in healthy individuals. Nature 559, 400404 (2018).
CAS PubMed PubMed Central Article Google Scholar
Desai, P. et al. Somatic mutations precede acute myeloid leukemia years before diagnosis. Nat. Med. 24, 10151023 (2018).
CAS PubMed PubMed Central Article Google Scholar
Jaiswal, S. et al. Clonal hematopoiesis and risk of atherosclerotic cardiovascular disease. N. Engl. J. Med. 377, 111121 (2017).
PubMed PubMed Central Article Google Scholar
Dorsheimer, L. et al. Association of mutations contributing to clonal hematopoiesis with prognosis in chronic ischemic heart failure. JAMA Cardiol. 4, 2533 (2019).
PubMed Article Google Scholar
Jaiswal, S. & Ebert, B. L. Clonal hematopoiesis in human aging and disease. Science 366, eaan4673 (2019).
CAS PubMed PubMed Central Article Google Scholar
Coombs, C. C. et al. Therapy-related clonal hematopoiesis in patients with non-hematologic cancers is common and associated with adverse clinical outcomes. Cell Stem Cell 21, 374382.e4 (2017).
CAS PubMed PubMed Central Article Google Scholar
Gibson, C. J. et al. Clonal hematopoiesis associated with adverse outcomes after autologous stem-cell transplantation for lymphoma. J. Clin. Oncol. 35, 15981605 (2017).
CAS PubMed PubMed Central Article Google Scholar
Meisel, M. et al. Microbial signals drive pre-leukaemic myeloproliferation in a Tet2-deficient host. Nature 557, 580584 (2018).
CAS PubMed PubMed Central Article Google Scholar
Yoshizato, T. et al. Somatic mutations and clonal hematopoiesis in aplastic anemia. N. Engl. J. Med. 373, 3547 (2015).
CAS PubMed PubMed Central Article Google Scholar
Bick, A. G. et al. Inherited causes of clonal haematopoiesis in 97,691 whole genomes. Nature 586, 763768 (2020).
CAS PubMed PubMed Central Article Google Scholar
Hinds, D. A. et al. Germ line variants predispose to both JAK2 V617F clonal hematopoiesis and myeloproliferative neoplasms. Blood 128, 11211128 (2016).
CAS PubMed PubMed Central Article Google Scholar
Szustakowski, J. D. et al. Advancing human genetics research and drug discovery through exome sequencing of the UK Biobank. Nat. Genet. 53, 942948 (2021).
CAS PubMed Article Google Scholar
Fabre, M. A. et al. The longitudinal dynamics and natural history of clonal haematopoiesis. Nature 606, 335342 (2022).
CAS PubMed PubMed Central Article Google Scholar
De-Morgan, A., Meggendorfer, M., Haferlach, C. & Shlush, L. Male predominance in AML is associated with specific preleukemic mutations. Leukemia 35, 867870 (2021).
PubMed Article Google Scholar
Bick, A. G. et al. Genetic interleukin 6 signaling deficiency attenuates cardiovascular risk in clonal hematopoiesis. Circulation 141, 124131 (2020).
CAS PubMed Article Google Scholar
Bulik-Sullivan, B. K. et al. LD score regression distinguishes confounding from polygenicity in genome-wide association studies. Nat. Genet. 47, 291295 (2015).
CAS PubMed PubMed Central Article Google Scholar
Finucane, H. K. et al. Partitioning heritability by functional annotation using genome-wide association summary statistics. Nat. Genet. 47, 12281235 (2015).
CAS PubMed PubMed Central Article Google Scholar
Corces, M. R. et al. Lineage-specific and single-cell chromatin accessibility charts human hematopoiesis and leukemia evolution. Nat. Genet. 48, 11931203 (2016).
CAS PubMed PubMed Central Article Google Scholar
Finucane, H. K. et al. Heritability enrichment of specifically expressed genes identifies disease-relevant tissues and cell types. Nat. Genet. 50, 621629 (2018).
CAS PubMed PubMed Central Article Google Scholar
Yang, J. et al. Conditional and joint multiple-SNP analysis of GWAS summary statistics identifies additional variants influencing complex traits. Nat. Genet. 44, 369375 (2012) .
CAS PubMed PubMed Central Article Google Scholar
Walsh, T. G. et al. Loss of the exocyst complex component EXOC3 promotes hemostasis and accelerates arterial thrombosis. Blood Adv. 5, 674686 (2021).
CAS PubMed PubMed Central Article Google Scholar
Astle, W. J. et al. The allelic landscape of human blood cell trait variation and links to common complex disease. Cell 167, 14151429.e19 (2016).
CAS PubMed PubMed Central Article Google Scholar
Ning, Z., Pawitan, Y. & Shen, X. High-definition likelihood inference of genetic correlations across human complex traits. Nat. Genet. 52, 859864 (2020).
CAS PubMed Article Google Scholar
Zekavat, S. M. et al. Hematopoietic mosaic chromosomal alterations increase the risk for diverse types of infection. Nat. Med. 27, 10121024 (2021).
CAS PubMed PubMed Central Article Google Scholar
Niroula, A. et al. Distinction of lymphoid and myeloid clonal hematopoiesis. Nat. Med. 27, 19211927 (2021).
CAS PubMed PubMed Central Article Google Scholar
Kamat, M. A. et al. PhenoScanner V2: an expanded tool for searching human genotype-phenotype associations. Bioinformatics 35, 48514853 (2019).
CAS PubMed PubMed Central Article Google Scholar
Staley, J. R. et al. PhenoScanner: a database of human genotype-phenotype associations. Bioinformatics 32, 32073209 (2016).
CAS PubMed PubMed Central Article Google Scholar
Vsa, U. et al. Large-scale cis- and trans-eQTL analyses identify thousands of genetic loci and polygenic scores that regulate blood gene expression. Nat. Genet. 53, 13001310 (2021).
PubMed PubMed Central Article CAS Google Scholar
Zhu, Z. et al. Integration of summary data from GWAS and eQTL studies predicts complex trait gene targets. Nat. Genet. 48, 481487 (2016).
CAS PubMed Article Google Scholar
Ragu, C. et al. The transcription factor Srf regulates hematopoietic stem cell adhesion. Blood 116, 44644473 (2010).
CAS PubMed Article Google Scholar
Zink, F. et al. Clonal hematopoiesis, with and without candidate driver mutations, is common in the elderly. Blood 130, 742752 (2017).
CAS PubMed PubMed Central Article Google Scholar
Zhou, G. et al. NetworkAnalyst 3.0: a visual analytics platform for comprehensive gene expression profiling and meta-analysis. Nucleic Acids Res. 47, W234W241 (2019).
CAS PubMed PubMed Central Article Google Scholar
Cowen, L., Ideker, T., Raphael, B. J. & Sharan, R. Network propagation: a universal amplifier of genetic associations. Nat. Rev. Genet. 18, 551562 (2017).
CAS PubMed Article Google Scholar
Fernndez-Tajes, J. et al. Developing a network view of type 2 diabetes risk pathways through integration of genetic, genomic and functional data. Genome Med. 11, 19 (2019).
PubMed PubMed Central Article Google Scholar
Tischkowitz, M. et al. Bi-allelic silencing of the Fanconi anaemia gene FANCF in acute myeloid leukaemia. Br. J. Haematol. 123, 469471 (2003).
CAS PubMed Article Google Scholar
Lim, Y. et al. Integration of Hedgehog and mutant FLT3 signaling in myeloid leukemia. Sci. Transl. Med. 7, 291ra96 (2015).
PubMed PubMed Central Article CAS Google Scholar
Ostrander, E. L. et al. The GNASR201C mutation associated with clonal hematopoiesis supports transplantable hematopoietic stem cell activity. Exp. Hematol. 57, 1420 (2018).
CAS PubMed Article Google Scholar
Ghoussaini, M. et al. Open Targets Genetics: systematic identification of trait-associated genes using large-scale genetics and functional genomics. Nucleic Acids Res. 49, D1311D1320 (2021).
CAS PubMed Article Google Scholar
Taylor, K. E., Ansel, K. M., Marson, A., Criswell, L. A. & Farh, K. K.-H. PICS2: next-generation fine mapping via probabilistic identification of causal SNPs. Bioinformatics 37, 30043007 (2021).
CAS PubMed Central Article Google Scholar
Farh, K. K.-H. et al. Genetic and epigenetic fine mapping of causal autoimmune disease variants. Nature 518, 337343 (2015).
CAS PubMed Article Google Scholar
Bao, E. L. et al. Inherited myeloproliferative neoplasm risk affects haematopoietic stem cells. Nature 586, 769775 (2020).
CAS PubMed PubMed Central Article Google Scholar
Buenrostro, J. D. et al. Integrated single-cell analysis maps the continuous regulatory landscape of human hematopoietic differentiation. Cell 173, 15351548.e16 (2018).
CAS PubMed PubMed Central Article Google Scholar
Ulirsch, J. C. et al. Interrogation of human hematopoiesis at single-cell and single-variant resolution. Nat. Genet. 51, 683693 (2019).
CAS PubMed PubMed Central Article Google Scholar
Go here to read the rest:
Genome-wide analyses of 200,453 individuals yield new insights into the causes and consequences of clonal hematopoiesis - Nature.com
How Parents ‘Guarantee’ Baby’s Gender’ Using the Babydust Conception Hack – Newsweek
Discovering the sex of your baby can be one of the most exciting parts of your pregnancy. But what if someone said you could determine your baby's sex when you're trying to conceive?
Kathryn Taylor, author of The Babydust Method: A Guide to Conceiving a Girl or a Boy, has suggested that the timing and frequency of intercourse in relation to ovulation can be used as a sex selection method.
[There is no blah blah] To find out more, Newsweek has spoken to Taylor, fertility and gynecology experts, and parents who have tried the method.
Taylor told Newsweek that the Babydust method relies on factors that may affect whether an X chromosome or Y chromosome sperm fertilizes an egg. The three key components are timing, frequency and, most importantly, monitoring your luteinizing hormone (LH) levels, she added.
"I was my own first test subject," Taylor said. "I had a son first and a daughter second, just as I had planned. Then I tested it on family and friends and was nearly 100% successful."
Taylor recommends that women monitor their LH levels using basic test strips at least twice a dayideally once in the morning and once in the eveningfor three menstrual cycles before they try to conceive. At major online retailers, a pack of 100 basic LH test strips costs around $35.
She said taking these tests would help determine when your LH levels are surging, which typically occurs approximately 24 hours prior to ovulation. By testing from the fifth day of your cycle until you record a "positive" LH surge for three consecutive months, you will have a better chance of predicting your next ovulation.
The Babydust method, having sexual intercourse once two-to-three days prior to ovulation will likely result in conceiving a baby girl. Alternatively, having sex twice - once on the day of your ovulation and the second time approximately 24 hours after - will likely result in a baby boy.
The difference between frequency is based on studies that Taylor references in the book that revealed that "two acts of intercourse 24 hours apart will alter the uterine environment in favor of Y sperm."
According to Taylor, based on the reported "sways" shared by real couples, "the success rate has been consistently at 87% for both girl and boy sways over the past 5 years."
"Every result that is reported is evaluated to make sure the couple followed the method perfectly," she reassured .
Taylor believes that "some couples have said that this method has actually helped them conceive faster." She explained that by regularly monitoring their LH levels, couples are aware of the woman's most fertile days, which helps them time intercourse accordingly and "focus their efforts on the right days."
With that in mind, Taylor emphasized that "this method is not a guarantee," advising couples "to go into this with a positive attitude." "If they keep in mind that the Babydust method is a way to increase your chances, then it lessens the possible disappointment," she suggested.
Antoine Abu Musa, chief medical officer at online IVF clinic NOW-fertility, shared that although the timing and frequency of intercourse have been widely considered as key factors of sex selection, "there is no scientific objective evidence that it works."
Interestingly, Abu Musa suggested that maternal hormonal levels on the day of fertilization can play a role in determining the sex of the embryo. "More females at birth have been associated with various forms of stressful events and circumstances during or prior to pregnancy," he told Newsweek. "Unfortunately, the research in this field is limited and sometimes contradictory," he added.
Abu Masa also believes that ovulation days differ each month and that monitoring ovulation for three months before applying the Babydust method might not be helpful in predicting your future ovulation. He also shared that even after tracking LH levels for three cycles, timing and limiting the intercourse to a certain day of the cycle "might lead to missing the window of fertilization" altogether.
According to Abu Masa, the only reliable and accurate method of sex selection is the PGT-A, a genetic test performed on embryos fertilized through invitro fertilization (IVF). Dr. Zev Williams of Columbia University Fertility Center suggested that this approach has a 99 percent chance of conceiving a baby of a desired sex. However, it comes with a steep price according to AdvancedFertility, the average cost of one IVF round with a PGT test costs approximately $15,500.
According to U.K. law, however, testing an embryo for the purposes of sex selection was made illegal by the Human Fertilisation and Embryology Act 2008. As such, the only legal way parents can use a PGT-A test and IVF to select the sex of a baby in the U.K. is by proving that there are significant genetic anomalies associated with the parents having a child of a certain sex.
Dr Evangelia Elenis, chief medical advisor at Tilly and chief physician in obstetrics and gynecology, believes that "the reasoning behind the [Babydust] method makes sense from a theoretical perspective, but not in a practical reality."
"As far as I know, there is no conclusive scientific proof for the Babydust method," she told Newsweek.
Elenis encourages couples to remember that menstrual cycles "are not perfectly regular and calculating averages may not work." Still, she explains that tracking LH levels and predicting ovulation can certainly help in conceiving. However, Elenis warns that so far, "there is no scientific proof that you can control whether a sperm that carries an X or a Y chromosome will fertilize the egg."
Newsweek also spoke to a few members of The Babydust Method Facebook group about their experiences regarding whether or not they were successful and how long and strictly they followed the method.
Earlier this year, Kayla George welcomed a baby boy as a result of a "successful sway" based on the Babydust Method. "We are so thankful for this method," the mother shared.
She described that the "method looked to be the most reliable and cost efficient" compared to other sex selection techniques and methods commonly discussed on the internet. George shared that she and her partner followed the instructions attentively and that it took her two cycles to get a positive test result. As per Taylor's guidance, George tracked her LH levels twice a day for three months prior to trying to conceive.
"We have five wonderful daughters, and we were just hoping to be lucky enough to add a little boy to our family. If we didn't fall pregnant, or if it was another little girl we would have been okay," she shared.
Meanwhile, one woman shared her experience of a "boy sway fail," which happened despite her strictly following all the instructions, tracking her LH levels and even consulting with the author of the book.
Liana Averbeck is currently 18 weeks pregnant with twin girls, after having tried for three months to conceive a baby boy using the Babydust method.
"All details were discussed with the author and she deemed the sway a perfect boy sway," she shared.
According to Averbeck, she even tracked her body basal temperature (BBT) so as to ensure an accurate prediction of her ovulation in addition to charting her LH levels twice a day.
Regardless, although at first she felt "a little bit of a loss and sadness for not getting one boy," the woman has no regrets: "Using this method, I felt I was learning more about my body and was more confident in conceiving," she told Newsweek. Now, Averbeck described that she feels "blessed" to be pregnant with her baby girl twins.
The woman suspected that the genetics on her husband's side might have played a role as she shared that he "mostly has girls on both sides of the family."
Averbeck also said that she discourages the method "if you cannot bear a 'gender sway fail' and would not want another baby of the same gender."
Originally posted here:
How Parents 'Guarantee' Baby's Gender' Using the Babydust Conception Hack - Newsweek
The conservative ‘What is a woman?’ talking point, explained – The Week
In the wake of the Supreme Court overturning Roe v. Wade, the 1973 decision that established a constitutional right to abortion, a parallel debate has erupted over the use of inclusive pregnancy language. Critics say "omitting the word 'women' to make room for the relatively tiny number of transgender men and people identifying as nonbinary who retain aspects of female biological function and can conceive, give birth, or breastfeed" effectively "erases" women, while supporters of inclusive language call that argument "transphobic" and argue that using such terms "costs us nothing and makes the movement stronger."
Nevertheless, conservatives have weaponized "gotcha"questions like "What is a woman?" or "Can men get pregnant?" Here's everything you need to know:
In a Senate Judiciary Committee hearing this week,University of California, Berkeley law professor Khiara Bridges went viral after Sen. Josh Hawley (R-Mo.) asked her to clarify if her use of the term "people with the capacity for pregnancy" meant "women." "Many women cis women have the capacity for pregnancy, many cis women do not have the capacity for pregnancy," Bridges answered. "There are also trans men who are capable of pregnancy as well as non-binary people who are capable of pregnancy." She went on claim that Hawley's "line of questioning" was "transphobic" and "opens up trans people to violence."
Hawley's question did not come out of a vacuum, however. Right-wingers like conservative podcast host Matt Walsh and theconservative Christian YouTube channel What Would You Sayhave been using the "gotcha" question "what is a woman?" for a few years now, both to troll liberals but also in higher stakes encounters.Sen. Marsha Blackburn (R-Tenn.), for example, asked then-Supreme Court nominee Ketanji Brown Jackson to "provide a definition for the word 'woman'" during her Senate confirmation hearing earlier this year (Jackson ultimately responded that she could not because she is "not a biologist").
Questioning gender is as old as civilization itself. Letters from the 18th century B.C. discovered in Mari, Syria, describe a type of prophet known as an assinn or "man-woman." Historian Edward Gibbon wrote that the teenage Roman Emperor Elagabalus "cop[ied] the manners and dress of the female sex." Court documents from the late 1300s record the interrogation of London prostitute Eleanor Rykener, who confessed to having previously lived as a man under the name "John." More recently, gender critics have argued that while we tend to think of our definition of "woman" as beingthe objective definition, it isn't; it's culturally constructed.
But the question of defining "women" has become particularly seized upon by Republicans since the Roe v. Wadedecision. "Turning their ire on inclusive language is a conscious strategy," argues Vox. "It allows Republicans to misrepresent and minimize the effects of laws like abortion bans, by omitting groups that they affect. Engaging in transphobia also plays well withsome members of the Republican base."
The opposite of a "constructionist" definition of gender would be an "essentialist" definition, one rooted in female biology: "Previously a commonly understood term for half the world's population, the word had a specific meaning tied to genetics, biology, history, politics, and culture," wrote New York Times columnist Pamela Paul in a recent op-ed. "No longer. In its place are unwieldy terms like 'pregnant people,' 'menstruators,' and 'bodies with vaginas.'" Or assoon-to-be-former Rep. Madison Cawthorn (R-N.C.) put it a "woman" is "XX chromosomes, no tallywhacker."
Before they ever reached into congressional hearings and cable news, the debate between these two definitions of womanhood played out in the left-leaning milieus of academia and feminist activism, with "gender critical" feminists labeled "trans-exclusionary radical feminists" or TERFs by their detractors arguing in favor of essentialism. Now the issue has become front and center, as stoked by the "remarkable bad faith" questioning of conservatives, Philip Bump wrote for The Washington Post.
Others, though, argue the whole debate has become a distraction."The truth is, you can be kind. You can be inclusive. You can also be accurate," writer andphilosopher Kate Manne wrote in a recent Substack post pushing back on the circular debate. "You may just have to make a small but necessary moral effort. And, if you are not prepared to do that, you should be corrected when applicable and subject to due criticism. That is not cancellation, to anticipate. It is basic accountability."
Read more:
The conservative 'What is a woman?' talking point, explained - The Week
Beard Growth: Tips to Speed Up the Process – Medical News Today
Although exercising and eating a nutritious diet may speed up beard growth, the main factors that determine how fully a persons beard will grow are hormones and genetics.
Males start to grow facial hair during puberty. Many of them will notice that their facial hair first begins to grow on the upper lip.
Other areas people may notice early facial hair growth include the chin or the sides of the face near the ears, which people refer to as sideburns.
Facial hair grows differently for everyone. Some individuals may be able to grow a full beard during late stage or even middle stage adolescence. Others may continue to have sparse areas of growth until their late 20s, while some may never experience significant facial hair growth.
This article will explore what factors influence a persons beard growth and whether it is possible for someone to make their beard grow faster.
Genetics and hormones are the main factors that determine how quickly and fully a persons beard will grow. Their lifestyle and habits may also affect how their beard grows.
Testosterone is a hormone that affects the growth of facial hair, and its levels can vary. Males between 19 and 38 typically have a range of 264 to 916 nanograms per deciliter. This represents the 2.5th to 97.5th percentile for testosterone.
Low testosterone can adversely affect beard growth. For males with low testosterone, taking supplements under a doctors supervision may help increase beard growth.
If a persons testosterone levels fall within typical ranges, taking supplements will most likely not affect their beard growth.
Genetics also affect the way a persons beard grows. Some genes make them more prone to growing a fuller beard, while others may only ever be able to grow a sparse or patchy beard or other facial hair.
The health and well-being of a person affect how their whole body functions, including how their beard grows. Even though it is not possible to alter someones genes, lifestyle habits they can adopt may help them achieve a fuller beard.
Exercise improves blood flow, which helps stimulate hair follicle growth. Exercises, such as weightlifting and strength training, may also help boost a persons testosterone levels.
During the day, testosterone levels naturally fluctuate in young males, with a higher level in the morning and a lower level in the afternoon.
Good nutrition from eating a balanced diet may help in growing a beard and staying healthy.
According to a 2015 study, obesity and low testosterone have a bidirectional relationship, meaning that low testosterone can lead to obesity and obesity can lead to low testosterone.
Nutrients, such as zinc, may also be beneficial for testosterone levels. A nutritious diet will not override genetics, but it may help the existing hair grow healthier and fuller. Some foods that can help include:
Some supplements can contribute toward maintaining a persons health in a way that is conducive to growing their beard as fully as their genetic makeup will allow.
A person may wish to take a multivitamin containing iron and zinc if their diet does not provide them with sufficient amounts of these nutrients.
However, there are no supplements that will enable a person to grow a beard if they do not have the genes to do so.
Maintaining a healthy skin care routine, including keeping the beard clean, can positively affect how a persons beard will grow and look.
Exfoliating the face can help remove dead skin cells and debris from around each hair follicle, allowing the hair to grow through the skin unimpeded. Exfoliating can also reduce ingrown hairs under the beard.
Leave-in conditioners for beards can nourish the hair and keep it moisturized. This helps reduce and prevent beard dandruff and makes the beard look fuller. It is best to perform a patch test to find out which products work best for the beard.
As well as being necessary for overall health, sleep can also aid beard growth.
The testosterone levels in males generally increase when they are asleep. A 2015 study found that reducing the amount of daily sleep lowered testosterone levels in healthy young males.
Keeping a beard clean and moisturized can help it appear thicker. However, there is no certain routine with scientific backing that can thicken a growing beard.
However, some anecdotal evidence suggests that olive oil and avocado oil could thicken beards.
It is possible that these may work the way leave-in conditioners do by keeping the beard nourished and moisturized.
Growing a beard depends mostly on a persons genetics.
However, testosterone plays some role in determining how fast and well someones beard will grow.
Making sure to keep testosterone levels within a stable, healthy range by regularly exercising, eating well, getting sufficient, restful sleep, and exfoliating can help a persons beard grow as thick and full as it is naturally able.
Go here to see the original:
Beard Growth: Tips to Speed Up the Process - Medical News Today
The canine behavior of the LGBTQ cabal – Washington Times
OPINION:
This past week, The New York Times published an opinion piece finally admitting that todays LGBTQ cabal of rainbow activists is little more than a misogynistic cult that reduces women to just a mix of body parts and gender stereotypes.
Writing for the Times, columnist Pamela Paul described what she called the fringe lefts misogynist agenda.
The word women, said Ms. Paul, which has, for millennia, been commonly understood by all rational thinking people to denote genetics, physiology, biology and the basic reality of human existence, is now verboten. In place of this word, we now have nonsensical terms that reduce females to their biological functions; words like pregnant people, birthing persons, menstruators and bodies with vaginas.
This logically strained nomenclature has been force-fed to the American public, bemoaned Ms. Paul, as she cited President Bidens cultural lunacy of removing biological sex from the federal register and replacing words such as mothers and women with birthing people and breastfeeders instead.
Women didnt fight this long and this hard only to be told we couldnt call ourselves women anymore. This isnt just a semantic issue; its also a question of moral harm, an affront to our very sense of ourselves, she concluded.
Amen! Welcome to the side of sanity, Ms. Paul.
I have said from the very first days of the LGBTQ movement that this broken worldview could only have one logical end: the complete degradation of what it means to be a human being and that women would be the first to suffer at the hands of this grand lie.
You cant dumb down human identity to nothing but the sum total of human inclinations and retain any modicum of human dignity. If we define ourselves by our subjective desires and not by Gods objective design, our ontology the reality of who we are becomes meaningless, and being a woman means absolutely nothing.
Think about it.
Today our schools teach our youngest girls that women arent real. Our Congress tells women they have no right to their own restrooms, sports or showers. Our corporations proudly defend the cultural appropriation of women by dysphoric men who want to act like something they are not. And todays feminists now pretend a female is a fabrication rather than a biological fact.
The question we should all be asking is this: What could possibly be more degrading than publicly supporting the blackfacing of women in a manner that is just as cartoonish and insulting as it is when white people dress up in literal blackface to mimic and mock people of color?
This is misogynistic. It diminishes the woman to little more than a delusion. It disregards who she truly is. It elevates feelings over facts. It supersedes the rational by supplanting it with the emotional. Moreover, it replaces the reality of the female with the fantasy of those who seek to use her for political gain.
All of this is little more than a placard for a culture a cult of deception and deceit. Its a snapshot of a people who have literally lost their minds.
When your definition of the person becomes little more than the cumulative effect of his or her sexual urges, you are admitting you think those with a given appetite are actually defined by that desire. With a not-so-thinly disguised bigotry, you are saying you think thats just who they are and that their personal identity is nothing more than the totality of their libidinous inclinations. Is this not the ultimate insult to your fellow man? Is this not the grandest slur of what it means to be a woman?
The biblical model is the opposite. It elevates men and women to the highest status of all worldviews. Genesis, as well as all the rest of scripture, tells us we are the imago Dei, not the imago dog. We are made in the image of God, not the image of the animal. We are not defined by our cravings but by our creator. Ultimate meaning comes from our Lord, not our libido. We have objective identity, dignity and worth. Gods reality always trumps human emotions and passions; mine, yours, and the governments.
This is the good news of the Gospel. Christ, himself makes it clear that, on this issue, Ms. Paul is right. No one is just a mix of body parts and gender stereotypes. Women are made in the image of God, and that image cannot be manipulated, coopted or changed by a bunch of delusional sexual activists bent on denying reality and acting like dogs.
Everett Piper (dreverettpiper.com, @dreverettpiper), a columnist for The Washington Times, is a former university president and radio host. He is the author of Not a Daycare: The Devastating Consequences of Abandoning Truth (Regnery).
Read the original:
The canine behavior of the LGBTQ cabal - Washington Times
Why Are We All So Obsessed With Celebrity Plastic Surgery? – HuffPost UK
Youre on TikTok scrolling, as you do and have been for the past 45 minutes. Youve watched a dozen make-up tutorials, Love Island recaps and videos of cats doing very cat things when you stumble on a video of Kendall Jenner.
But its not a clip from Keeping Up With The Kardashians or even Kendall modelling on a runway. Its of her face being analysed by a surgeon. You watch as a doctor tells you what surgery she has or hasnt had. Theyll tell you that shes got fillers in her lips, botox and a secret rhinoplasty (aka nose job).
Click through to the doctors page and suddenly youve entered a world of celebrity plastic surgery videos. Theres been a surge of these videos emerging on my for you page in the past couple of months. The hashtag #plasticsurgery have 13.3 billion views, while the hashtag #celebrityface has 1.6 billion views.
When I typed, Has Kendall Jenner had plastic surgery? into my search bar, hundreds of videos came up. Some from cosmetic professionals, others from regular users, all picking apart her face. Its no surprise these videos mainly analyse women. Celebs such as Ariana Grande, Selena Gomez, Khloe Kardashian and Zendaya are also being facially examined on the daily.
Even teenagers like Stranger Things Millie Bobby Brown, 18, are scrutinised on TikTok though one in-depth blog about her face allows the changes that people are nitpicking on might be just her growing up and better makeup.
So, why are these clips so popular? It could be that celebrities dont often disclose what work theyve had done leaving their fans to guesswork.
When supermodel Bella Hadid, 25, shared that she had got a nose job at 14, few were surprised. Wed seen the before and after pictures, knew she had the money to pay for surgery, so people werent shocked to hear it confirmed.
However, speculation around a celebs face is often just that: speculation.
Earlier this year, the pop star Doja Cat publicly called out YouTuber Lorry Hillmade for making a video claiming the singer had got a nose job. Hillmade has plastic surgery herself and uses her page to dissect celebritiess faces to spot if theyve also had work done.
But Doja Cat wasnt happy about it and went on Instagram Live to say so. Im upset because theres lies about me, the singer said.
Dr Tunc Tiryaki, a consultant plastic surgeon at the Cadogan Clinic in London, doesnt think the videos are the root of the issue. Instead, he points the finger at those in the public eye who arent honest about the work theyve had done.
Id say the problem is more with celebrities who get liposuction, for example, but claim to get these results with diets, he says. Or celebrities who have had a face lift but say they had a thread lift [which is] similar to a face-lift but less invasive and cheaper.
By doing this, he says, celebrities are creating a huge false expectation, one that can make their followers compare themselves to someone with much greater means whose face is the result of thousands of pounds worth of surgery rather than more affordable tweakments, good makeup or basic genetics.
Secondly, these videos undermine the accurate results of surgery, especially surgical interventions, he says. People are coming to me expecting huge results because a celebrity has lied about what procedure theyve had.
This is dangerous, Dr Tiryaki, says, especially when it comes to filler and botox, as there isnt an age restrictions on these non-surgical procedures, nor is the industry properly regulated.
The rate of complications of fillers are rocketing, he says. This is partially because its easy to do and fillers can be done not only by dermatologists and plastic surgeons but anybody.
Group4 Studio via Getty Images
Many of these videos are made my cosmetic doctors, but even a surgeon wont be able to tell you if a celeb has had work done unless the professional did it themselves, says Dr Tiryaki, who warns against trusting these opinions. I think deep research is needed as its hard to fight against false information, he says.
And while there is an audience for these videos, people will continue churning them out. So, why do the general public enjoy these videos so much?
Many comments under the line highlight the relief some people feel when they discover their favourite celebs has had a bit of filler. So Im not ugly, Im just poor, one user writes. Given the online world and its facade of perfection, perhaps these pages do serve a purpose by highlighting why we shouldnt be comparing ourselves to celebrities.
Federica Rosso, a clinical psychologist at the mental health organisation Therapethical, believes the content is popular, because it can make people feel better about themselves even if that effect is short-lived.
People might start thinking that perfection per se does not exist. Even if they see themselves as not perfect in the mirror, they realise that one attractive celebrity did [the same] at some point and went through surgery, she says.
It creates an escape option from their awful feeling that is, in fact, a coping mechanism.
However, it can also encourage people to get work done that may not be in the best interests of their health or their finances. The problem with these videos is that theyre reinforcing a narrative that says we could achieve similar results if only we were willing to go under the knife ourselves. says Rosso.
We might start to wonder if our faces are ugly or unattractive or if there are parts of our bodies that need fixing. This can lead us down a dangerous path of body dysmorphia and eating disorders, both of which lead people down an unhealthy path toward self-harm and suicide.
These videos can be triggering for the celebrities they feature, too and, whether or not they have had any surgery, make them very self-critical of their looks.
Seeing themselves on these types of sites can be like a slap in the face, says Rosso. Theyre constantly reminded of their flaws and failures, even if theyre not real.
And this is nothing new. Dirty Dancing star Jennifer Grey, 62, has spoken openly about the nose job she had in the wake of that movies success, which not only ruined her career, but became the dominant narrative of her life.
Meanwhile, in 2016, Rene Zellwegger responded to claims shed had surgery on her eyes with an open letter in HuffPost, headlined We Can Do Better.
Its no secret a womans worth has historically been measured by her appearance, Zellwegger, now 52, wrote. The double standard used to diminish our contributions remains, and is perpetuated by the negative conversation which enters our consciousness every day as snark entertainment.
She added: The resulting message is problematic for younger generations and impressionable minds, and undoubtably triggers myriad subsequent issues regarding conformity, prejudice, equality, self acceptance, bullying and health.
So, should we continue to click on these videos? The answer surely lies in being honest with yourself about why youre watching them. Yes, they can serve as a reminder that the tweaked and filtered faces we see online every day arent real.
However, lets all remember that the people behind them very much are.
Read the original post:
Why Are We All So Obsessed With Celebrity Plastic Surgery? - HuffPost UK
Can Biobanking Save the World’s Rarest Wildlife? – MeatEater
Late last year, the U.S. Fish and Wildlife Service proposed removing 23 species from the Endangered Species List, but not for the reason you might hope.
All 23 species of birds, fish, and mussels have gone extinct, according to the USFWS, and are no longer eligible for listing under the Endangered Species Act.
Many of these species have been on the decline for decades. Some, like the Hawaiian Kauai nukupuu bird, havent been spotted since the 19th century. As the USFWS explained in its press release, ESA protections came too late to conserve habitat and protect these animals from invasive species and disease.
Some believe biobanking can save other animal populations from the same fate. Wooly mammoths probably arent on that list, but biobanking advocates say animal cells frozen in cold storage could be used to beef up the genetic diversity of captive populations and restore some species from the brink of extinction.
What is Biobanking?
Biobanking refers to the collection and storage of biological materials. There are many kinds of biobanks designed for different purposes, but conservationists are particularly interested in biobanks like San Diego Zoos Frozen Zoo.
As its name suggests, the Frozen Zoo stores living animal cells by super-freezing (the technical term) those cells at -196 degrees Celsius. Virtually all cell activity stops at this temperature, which allows scientists to store samples until they want to use them. These cells can come from anywhere on an animals body and often include reproductive cells like sperm and eggs.
The Frozen Zoo launched in 1975 and has since been able to store 1,100 species of vertebrate animals and cells from over 10,000 individual animals, according to Dr. Oliver Ryder. Dr. Ryder is the Frozen Zoos Director of Conservation Genetics, and he spoke to MeatEater about the importance of banking the cells of endangered animals.
Were seeing species decline in numbers, populations disappear from within their range due to habitat loss and fragmentation. For some species, more of their gene pool is in these freezers than is in the wild, Dr. Ryder told MeatEater.
Most of the Frozen Zoos samples come from animals at the San Diego Zoo, where biologists can collect cells during an animals regular checkups or postmortem examinations. The Frozen Zoo tries to bank a diverse collection of animals, but time and space constraints force them to select vulnerable species over less vulnerable ones.
The Frozen Zoo isnt alone. Among other biobanks related to animal conservation, the Rare Breed Survival Trust in the United Kingdom houses a gene bank of native livestock breeds, the National Oceanic and Atmospheric Administration houses the National Marine Mammal Tissue Bank (NMMTB), and Japans National BioResource Project houses animal and plant materials to advance scientific research.
Current Successes
Freezing biological specimens might sound like something out of Mel Gibsons 1992 movie, Forever Young, but the reality is less science fiction and more science class.
Frozen zoos can help researchers investigate parentage, genetic lineage, evolutionary history, and disease susceptibility of individuals or species. However, a biobanks greatest conservation potential is its ability to beef up the genetic diversity of captive breeding programs.
Captive breeding programs are expensive, but the biggest hurdle is maintaining healthy genetic diversity. This issue is especially concerning for species that do not exist in the wild. A small captive population will eventually die out without new individuals to introduce genetic diversity.
This almost happened to the black-footed ferret. The black-footed ferret is the only ferret native to North America, but the population was so small by the late 20th century that the species was thought to be extinct.
Conservationists found the last remaining wild population in 1981, but only seven of those 18 ferrets produced kits. The captive breeding program for the black-footed ferret has successfully produced thousands of ferrets, but the entire population descended from those seven individuals.
Fortunately, biologists in the 1980s preserved a tissue sample from one of the non-breeding female ferrets and sent that sample to the San Diego Frozen Zoo. Those cells were preserved until 2020, when a group of scientists created a ferret embryo from that tissue, which was born later that year.
This cloned ferret, dubbed Elizabeth Ann, is not related to any black-footed ferret currently in existence and could provide some much-needed genetic variation to the population. She is the first clone of a native endangered species in North America.
It was like discovering a new ferret, Dr. Ryder said.
Its unclear whether Elizabeth Ann is necessary to the black-footed ferrets continued success. The Smithsonians National Zoo & Conservation Biology Institute has released thousands of black-footed ferrets in partnership with the USFWS, and they dont report a lack of genetic diversity as one of the populations primary threats.
But in a press release announcing Elizabeth Anns birth, the USFWS pointed out that the ferrets must overcome unique genetic challenges and could eventually become more susceptible to disease, infertility, and genetic abnormalities.
In any case, if Elizabeth Ann proves to be fertile (researchers will know later this year), the project will provide powerful proof of concept for how biobanking can save threatened species.
Researchers at the Australian Frozen Zoo are also offering a less dramatic way biobanking could theoretically introduce genetic diversity into captive breeding populations. Biobanked sperm, researchers argue, can allow captive programs to operate with fewer animals while maintaining the diversity needed for a healthy population.
Using frozen zoos could provide a 25-fold increase in the number of species that could be conserved. This would be a staggering conservation achievement, and we think it can be done, said Dr. Simon Clulow of Macquarie University in Sydney.
Clulow and his colleagues published a paper in 2020 arguing that introducing biobanked frozen sperm to an Oregon spotted frog breeding program could significantly reduce the cost of the program. They suggest that backcrossingcrossing a hybrid with one of its parents or a creature genetically similar to its parentwith frozen sperm every generation would lead to much lower costs than with traditional captive breeding.
Reducing the cost of captive breeding programs will free up resources to conserve species other than the so-called charismatic megafauna that generate the most funding and attention.
Moral Hazard
Not all conservationists are quite as excited about using biobanked material in these ways. Dr. Stuart Pimm is the Doris Duke Professor of Conservation Ecology at Duke University, and he worries that de-extinction techniques (which are still largely theoretical) can give moral cover to people and organizations that want to destroy habitat.
If you think its OK to drive species to extinction because you think we can keep their DNA going, it creates an awful moral hazard, Dr. Pimm told MeatEater.
Resurrecting ancient species like the wooly mammoth gets a lot of play in the news (not to mention Hollywood), but when asked about mammoths, Dr. Ryder sounded skeptical. Both he and Dr. Pimm argued that mammoth resurrection isnt practical. Dr. Ryder noted that no viable mammoth DNA exists with which to make a clone, and Dr. Pimm wondered how scientists would reconstruct mammoth habitat and ecosystems.
But while Dr. Ryder is still interested in using genetic technology to save declining species, Dr. Pimm has personal experience that keeps him wary of anything that rhymes with de-extinction. When he testified before Congress in the mid-1990s about the reauthorization of the Endangered Species Act, members of Congress expressed unconcern with habitat destruction because endangered species could be resurrected a la Jurassic Park.
There are people who would like to push environmental destruction to the limit, so the moral hazard of de-extinction is a real danger, Pimm said.
Instead of using time and resources to pursue the kind of genetic strategies made possible by biobanks, Dr. Pimm would like to see conservationists focus on what works: habitat restoration, legislative protections, and public education.
The amount of time people are wasting on these de-extinctions, they could get off their arses and do something useful for conservation, he said. I think theyre doing a considerable amount of harm in giving people false solutions. Thats not how were going to save biodiversity.
When asked about Dr. Pimms moral hazard, Dr. Ryder agreed that its a legitimate concern and acknowledged that solutions like Elizabeth Ann are still highly experimental. We cant bank all our conservation efforts on their success, he said.
He took issue, however, with the contention that the two approaches represent a zero-sum game.
That argument would presume that focusing effort on banking cells would detract from efforts to save species. All the evidence is to the contrary. The effort to save species is as strong as ever and is supported by international treaties and national legislation and regulation, he pointed out.
For his part, Dr. Pimm was careful to distinguish between de-extinction technologies and biobanking more generally. He does not support the former, but the latter he described as essential to conservation efforts. Storing genetic material is not a problem; what matters is how we use it.
Moving Forward
Both scientists agreed that conserving threatened and endangered species requires a collaborative, multi-pronged approach. Dr. Ryder stressed that habitat conservation should always be a top priority, and Dr. Pimm said he could support promoting genetic diversity via biobanked material if those techniques proved to be effective.
Ultimately, Dr. Ryder believes conservationists should pursue the kinds of solutions hes spearheading at the Frozen Zoo in the hopes that they wont have to use them.
My hope is that we wont need to do these kinds of things because we wont have species that are so depleted in their genetic variation or on the brink of extinction that we have to evoke these heroics, he said.
But given that were seeing a number of species in decline, it would be prudent, thoughtful, and helpful to bank cells now so that we have that option in the future, he continued. I would like to see a greatly expanded effort to do banking so that we wouldnt need to be looking at a future where were inevitably seeing the genetic diversity of wild species erode.
Continue reading here:
Can Biobanking Save the World's Rarest Wildlife? - MeatEater
Adrenal Fatigue and Narcolepsy: Comparing the Conditions and Theories – Healthline
Narcolepsy is a neurological condition that affects your bodys sleeping and waking cycles.
Its estimated that between 135,000 and 200,000 people in the United States have narcolepsy. If you have it, youll often feel very tired during the day and may also unexpectedly fall asleep in the middle of activities. Its also possible to experience cataplexy, which is when muscle weakness comes on suddenly.
Adrenal insufficiency is a health condition where your adrenal glands dont make enough of certain hormones. This can lead to symptoms that are similar to those of narcolepsy, such as chronic fatigue and muscle weakness.
Another related term you may have heard of is adrenal fatigue, which is used to describe a mild type of adrenal insufficiency thats supposedly brought on by chronic stress. However, adrenal fatigue isnt a proven medical condition.
Below, well explore the ins and outs of narcolepsy, adrenal insufficiency, and adrenal fatigue. Keep reading to learn more.
Adrenal fatigue is a theory that chronic stress can impact the function of the adrenal glands. The adrenal glands are found above your kidneys and make hormones like cortisol, which is important for how you respond to stress.
Supporters of the theory of adrenal fatigue believe that the buildup of stress becomes too much for your adrenal glands. Due to this, they cannot produce enough cortisol to meet the bodys demands, causing symptoms like:
While some symptoms of adrenal fatigue are similar to those of narcolepsy, it really isnt possible to compare the two. This is because adrenal fatigue isnt recognized as a legitimate medical condition.
In a 2016 article, a group of endocrinologists reviewed 58 studies mentioning adrenal fatigue. Based on their review of the studies and how they were conducted, they could find no credible evidence that adrenal fatigue is an actual medical condition.
The reported symptoms of adrenal fatigue are general and could be caused by any actual health condition that needs to be treated. According to the Endocrine Society, these may include conditions like:
Adrenal insufficiency is a medical condition in which your adrenal glands dont make enough of the hormone cortisol and, in some cases, aldosterone. There are several types of adrenal insufficiency.
Some types have to do with decreased production of hormones in the brain. These hormones eventually promote cortisol production in the adrenal glands, so when theyre in short supply, cortisol levels are lower.
Some types of narcolepsy also have to do with decreased hormone production in the brain. In this case, its the hormone hypocretin, also called orexin, which regulates sleeping and waking.
Its also possible for people with narcolepsy to have other health conditions involving hormones, such as adrenal insufficiency and hypothyroidism.
Older research has also found that low levels of hypocretin in people with narcolepsy may impact other hormone pathways, such as those involved in adrenal insufficiency.
Lastly, theres overlap in the symptoms of adrenal insufficiency and narcolepsy, such as excessive tiredness or fatigue and muscle weakness.
However, there are many important differences between adrenal insufficiency and narcolepsy as well. Lets go over the different aspects these two conditions now.
The symptoms of adrenal insufficiency typically come on slowly and can include things like:
The symptoms of narcolepsy can include:
There are different types of adrenal insufficiency and each type as its own cause:
Similar to adrenal sufficiency, there are different types of narcolepsy. What causes each type is a little different.
People with type 1 narcolepsy, or narcolepsy with cataplexy, almost always have low levels of a hormone called hypocretin in the brain. This hormone is involved in regulating aspects of sleeping and waking.
Those with type 2 narcolepsy, or narcolepsy without cataplexy, have normal levels of hypocretin. The cause of this type of narcolepsy remains unclear.
Factors that may contribute to the development of narcolepsy in general include:
The risk factors for adrenal insufficiency can include:
You may be at an increased risk for narcolepsy if someone in your family has it. About 10% of people with type 1 narcolepsy have a close relative who reports similar symptoms.
An adrenal crisis is the most serious complication of adrenal insufficiency and is life threatening. It can happen when your body needs more cortisol than it can make, typically in response to intense physical stress caused by things like:
Its also possible for adrenal insufficiency to lead to electrolyte imbalances like too little sodium or too much potassium.
The nature of its symptoms can mean that narcolepsy can have a large impact on a persons quality of life. People with narcolepsy can experience significant disruptions in their daily life, including:
Additionally, sleep attacks and cataplexy can happen suddenly. This can be dangerous if youre driving or working in a job that involves operating heavy machinery.
In addition to taking your medical history and doing a physical exam, a doctor can use the following tests to diagnose adrenal insufficiency:
After taking your medical history, performing a physical exam, and evaluating your sleep log, your doctor can use the following tests to help diagnose narcolepsy:
The treatment for adrenal insufficiency involves replacement of the hormone cortisol. This can be done through drugs like hydrocortisone, dexamethasone, or prednisone.
Taking a drug called fludrocortisone can help maintain electrolyte balance in people who also dont make enough aldosterone.
There isnt a cure for narcolepsy. Instead, symptoms are managed using a combination of medications and lifestyle changes.
Medications for narcolepsy can include:
Lifestyle changes are also important, including setting up a regular sleep schedule, taking shorter naps during the day, and relaxing before bedtime.
If you have any of the following symptoms, its a good idea to see a doctor:
A doctor can evaluate your symptoms and test to see what may be causing them. After a diagnosis is made, they can develop a treatment plan that can help you to manage your condition.
Narcolepsy is a neurological condition affecting sleeping and waking. It causes symptoms like excessive daytime sleepiness, sleep attacks, and sudden instances of muscle weakness.
While some narcolepsy symptoms like excessive tiredness and muscle weakness overlap with adrenal insufficiency, the two conditions have many other differences in symptoms, causes, diagnosis, and treatment.
You may have also heard narcolepsy symptoms be compared to those associated with something called adrenal fatigue. However, adrenal fatigue is not recognized as an actual medical condition at this time.
Regardless, see a doctor if you have excessive tiredness, muscle weakness, or disrupted sleep that significantly interferes with your daily life. Its possible that your symptoms are due to a medical condition that needs to be treated.
Read more:
Adrenal Fatigue and Narcolepsy: Comparing the Conditions and Theories - Healthline
Overnight News Digest: We humans really are connected to the universe. – Daily Kos
Los Angeles Times
Heres what the James Webb Space Telescope has seen in just a week of looking
A quintet of galaxies. A nursery of infant stars. A weather report for an exoplanet. And a preview of our own suns demise.
After years of delays, a 930,000-mile trip into space and months of speculation over whatthe James Webb Space Telelescopes first pictures might reveal, NASA on Tuesday released the first complete set of images captured by its $10-billion observatory.
They show stars in their infancy and in their final gasps, along with sweeping views of the cosmos and the majestic objects in it.
Every dot of light we see here is an individual star, not unlike our sun. And many of these likely also have planets, NASA astrophysicistAmber Straughnsaid while introducing an image of theCarina Nebula, a multihued landscape of gas and nascent stars.
It just reminds me that our sun and our planets and, ultimately, us were formed out of the same kind of stuff that we see here, she said. We humans really are connected to the universe. Were made of the same stuff in this beautiful landscape.
Webb Images of Jupiter and More Now Available In Commissioning Data
On the heels of Tuesdays release of thefirst imagesfrom NASAs James Webb Space Telescope, data from the telescopes commissioning period isnow being released on the Space Telescope Science Institutes Mikulski Archive for Space Telescopes. The data includes images of Jupiter and images and spectra of several asteroids, captured to test the telescopes instruments before science operations officially began July 12. The data demonstrates Webbs to track solar system targets and produce images and spectra with unprecedented detail.
Fans of Jupiter will recognize some familiar features of our solar systems enormous planet in these images seen through Webbs infrared gaze. A view from the NIRCam instruments short-wavelength filter shows distinct bands that encircle the planet as well as the Great Red Spot, a storm big enough to swallow the Earth. The iconic spot appears white in this image because of the way Webbs infrared image was processed.
In ominous sign for global warming, feedback loop may be accelerating methane emissions
If carbon dioxide is an oven steadily roasting our planet, methane is a blast from the broiler: a more potent but shorter lived greenhouse gas thats responsible forroughly one-thirdof the 1.2C of warming since preindustrial times. Atmospheric methane levels have risen nearly 7% since 2006, and the past 2 years saw thebiggest jumps yet, even though the pandemic slowed oil and gas production, presumably reducing methane leaks. Now, researchers are homing in on the source of the mysterious surge. Two new preprints trace it to microbes in tropical wetlands. Ominously, climate change itself might be fueling the trend by driving increased rain over the regions.
If so, the wetlands emissions could end up being a runaway process beyond human control, although the magnitude of the feedback loop is uncertain. We will have handed over a bit more control of Earths climate to microorganisms, says Paul Palmer, an atmospheric chemist at the University of Edinburgh and co-author of one of the studies,posted late last monthfor review atAtmospheric Chemistry and Physics.
Study: Climate impacts to disproportionately hurt tropical fishers, farmers
Coastal communities in the tropics that rely heavily on both agriculture and fisheries are most vulnerable to the losses caused by high global carbon emissions, a new study says.
It looked at coastal communities in five countries within the Indo-Pacific region and found that most may face significant losses of agricultural and fisheries products two key food sources simultaneously in the event of the worst-case impacts of climate change. These potential losses may be coupled with other drivers of change, such as overfishing or soil erosion, which have already caused a decline in productivity, according to thestudypublished July 5 in the journalNature Communications. When looked at separately, the potential losses for the fisheries sector would be greater than for agriculture, the research showed.
But if carbon emissions can be effectively managed to a minimum, the studys authors said, fewer communities would experience losses in both the agriculture and fisheries sectors.
Pioneering climate change research reveals long-term global carbon cycle impacts
A new study in Nature Geoscience, co-authored byDr Heather Ford , uses a unique research model to illustrate how past geologic periods can help us understand future climate changes. []
In this new paper, Dr Ford used geologic data and a climate model of a time about three million years ago known as the mid-Pliocene warm period, which is often used as an analogue for future climate change, because global temperatures then were around 2.3C warmer than today but CO2 levels were similar.
Whats unique about this study is the climate model was run for 2000 years, allowing conditions in the deep ocean to balance naturally over time, and enabling much deeper insight. Dr Ford explained: Running global climate models for thousands of years is computationally expensive, but critical in thinking about long-term impacts of carbon cycling and climate change.
How climate change could drive an increase in gender-based violence
As extreme weather events occur more frequently something that climate scientists say is inevitable so, too, will violence towards women and people from gender minorities. Thats the conclusion of a review examining events in the aftermath of floods, droughts, cyclones and heatwaves, among other weather disasters, over the past two decades.
The review found that extreme weather events often catalyse episodes of gender-based violence particularly physical, sexual and domestic abuse. It is the most comprehensive and timely analysis of gender-based violence related to extreme weather and climate events that are expected to increase under anthropogenic climate change, according to lead author Kim van Daalen, who studies global public health at the University of Cambridge, UK.
Its Getting Harder for Forests to Recover from Disasters
Forests around the world are losing their resilience and becoming more vulnerable to disturbances as the planet warms. Thats especially true for ecosystems in tropical, temperate and dry parts of the world, according to a new study.
When a forest loses resilience, it means its gradually losing its ability to bounce back after fires, droughts, logging and other disruptive events, said thestudy, published on July 13 inNature. Past a certain point, some forests may approach a kind of tipping point a threshold that launches them into a rapid decline.
And beyond that, some studies suggest, a forest may not be able to fully recover at all. It may instead transform into some other ecosystem entirely, like a grassland or savanna.
Study provides new clues to killer frog disease
A new study aiming to unlock the secrets of a disease devastating frog populations has turned up some unexpected results, which may change how scientists combat the outbreak.James Cook University biologist Dr Donald McKnight said the disease chytridiomycosis has caused declines or extinctions in over 500 species of amphibians worldwide.
But not all amphibian species are susceptible to chytridiomycosis, and some species and populations that underwent initial declines are surviving or increasing, despite the continued presence of the pathogen, said Dr McKnight. []
The reasons for these differences among species and populations are not entirely clear, but variations in microbiomes - the bacteria, fungi, and other microorganisms on the frogs - may play a key role, said Dr McKnight.
Machine learning identifies crater that ejected famous Martian rock
New Curtin-led research has pinpointed the exact home of the oldest and most famous Martian meteorite for the first time ever, offering critical geological clues about the earliest origins of Mars.
Using a multidisciplinary approach involving a machine learning algorithm, the new research published today inNature Communications identified the particular crater on Mars that ejected the so-called Black Beauty meteorite, weighing 320 grams, and paired stones, which were first reported as being found in northern Africa in 2011.
The researchers have named the specific Mars crater after the Pilbara city of Karratha, located more than 1500km north of Perth in Western Australia, which is home to one of the oldest terrestrial rocks.
Zombie fly fungus lures healthy male flies to mate with female corpses
Entomophthora muscaeis a widespread, pathogenic fungus that survives by infecting common houseflies with deadly spores. Now, research shows that the fungus has a unique tactic to ensure for its survival. The fungus 'bewitches' male houseflies and drives them to necrophilia with the fungal-infected corpses of dead females.
After having infected a female fly with its spores, the fungus spreads until its host has slowly been consumed alive from within. After roughly six days, the fungus takes over the behavior of the female fly and forces it to the highest point, whether upon vegetation or a wall, where the fly then dies. When the fungus has killed the zombie female, it begins to release chemical signals known as sesquiterpenes.
"The chemical signals act as pheromones that bewitch male flies and cause an incredible urge for them to mate with lifeless female carcasses," explains Henrik H. De Fine Licht, an associate professor at the University of Copenhagens Department of Environment and Plant Sciences and one of the studys authors.
Social support found to reduce stress levels in orphaned wild elephants
A team of researchers from Colorado State University, the Smithsonian Conservative Biology Institute and the Save the Elephants program in Kenya reports that social support by members of elephant herds in African savanna elephants reduces stress levels of orphaned youngsters. In their paper published in the journalCommunications Biology, the group describes their study of stress levels in orphaned wild elephants and their ability to rebound from a great loss.
Over the past several decades, African savanna elephants, the largest land animals in the world, have seen population declines due to increases in both poaching and droughta situation that has led to many elephants being orphaned. Because of the long maturation process (it takes 20 years for the elephants to reach their full size), the number of orphans has increased overall. Also, elephantcalvesare highly dependent on their mothers for the first decade of their lives. In this new effort, the researchers studied the stress levels of orphans as they adapted to sudden changes in their care.
To learn more aboutorphanstress levels, the researchers followed several herds for over a year, watching carefully when they defecated. They collected the samples and tested them for glucocorticoid metabolite (GCM) levelsa relatively easy way to measurestress levelsin mammals.
A woodpecker's brain takes a big hit with every peck: study
The brain of a woodpecker experiences a seemingly catastrophic impact every time beak meets wood.
"When you see these birds in action, hitting their head against a tree quite violently, then as humans we start wondering how does this bird avoid getting headaches or brain damage," saysSam Van Wassenbergh, a researcher at the University of Antwerp in Belgium.
In the past, scientists havesuggestedthe bird's brain is protected from the impacts, perhaps bya skull that acts as a cushion, or a beak that absorbs some of the force, or a tongue that wraps around the brain.But Van Wassenberg wasn't convinced.
"Nobody has ever explained it very well, in my opinion," he says.
Difficult and costly. Snake dams should be breached, says Biden administration report
Breaching one or more of the lower Snake River dams in Eastern Washington is called for in a National Oceanic and Atmospheric Administration draft report released Tuesday.
The draft report looks at the state of the science on restoring salmon and steelhead populations in the Columbia River Basin and the large scale actions needed to make progress toward healthy and harvestable fish stocks.
It has become overwhelmingly clear that business as usual will not restore the health and abundance of Pacific Northwest salmon, said Brenda Mallory, chairwoman of the White House Council on Environmental Quality, at a news media briefing Monday afternoon. []
The NOAA draft report, Rebuilding Interior Columbia Basin Salmon and Steelhead, said the science calls for acting, and acting now.
Inaction will result in the catastrophic loss of the majority of Columbia River Basin salmon and steelhead stocks, the draft report said.
Knots in the resonator: elegant math in humble physics
At the heart of every resonator be it a cello, a gravitational wave detector, or the antenna in your cell phone there is a beautiful bit of mathematics that has been heretofore unacknowledged. Yale physicists Jack Harris and Nicholas Read know this because they started finding knots in their data.
In a new study in the journal Nature, Harris, Read, and their co-authors describe a previously unknown characteristic of resonators. A resonator is any object that vibrates only at a specific set of frequencies. They are ubiquitous in sensors, electronics, musical instruments, and other devices, where they are used to produce, amplify, or detect vibrations at specific frequencies.
The new characteristic the Yale team found results from equations that any high school algebra student would recognize, but which physicists had not appreciated as a basic principle of resonators.
Bat Virus Studies Raise Questions About Laboratory Tinkering
In mid-2020, a team of scientistscatching bats in Laotian cavesdiscovered coronaviruses that were strikingly similar to the one that had begun wreaking havoc around the world.
In the months since, some of those researchers have been studying one of these mysterious bat viruses in a high-security laboratory in Paris, hoping to discover clues about how its cousin, SARS-CoV-2, went on to become a global threat that has killed anestimated 15 million people.
Their work has been scientifically fruitful. Last year, the scientists discovered thatthe bat virus was capable of latching onto human cells, at least in Petri dishes. Last month, the teamreportedmore reassuring news: that the virus is not particularly harmful to lab animals. The finding suggests that SARS-CoV-2 evolved its abilities to spread quickly and cause deadly disease only after the two lineages branched apart on the viral evolutionary tree.
Mysterious glow of a milky sea caught on camera for first time
Waking at 10pm, a sailor looked out from the deck of the superyacht Ganesha to see that the ocean had turned white. There is no moon, the sea is apparently full of plankton, but the bow wave is black. It gives the impression of sailing on snow, they wrote.
For centuries, mariners have described navigating unearthly night-time waters, lit up by a mysterious glow, but such milky seas have long eluded scientific inquiry owing to their remote, transient and infrequent nature.
Id say theres only a handful of people currently alive who have seen one. Theyre just not very common maybe up to one or two per year globally and theyre not typically close to shore, so you have to be in the right place at the right time, said Steven Miller, a professor of atmospheric science at Colorado State University in Fort Collins.
An Army of Turtles Is Doing Cyclone Reconnaissance
Even with good data, its hard to predict tropical cyclones, which often appear with little warning and wander drunkenly around the worlds oceans. But five years ago, Olivier Bousquet, now the research director for Frances Ministry of Ecology, Sustainable Development and Energy, was tasked with forecasting storms strengths and paths in the cyclone-infested southwest Indian Ocean. The need for better predictions was great. On average, the area gets nine or 10 cyclones a year, and the storms are getting stronger. Tropical Cyclone Idai, in 2019, killed more than 1,000 people in Mozambique, Zimbabwe, and Malawi and 2014s Gafilo killed 363 in Madagascar.
Unlike in some other parts of the oceansuch as the North Atlantic, where the U.S. National Oceanic and Atmospheric Administration flies weather dronesBousquet had almost no data to work with. Sure, there are satellites that spy on the oceans surface, but those are biased around coastlines and blind in clouds, which storms have in spades. Just a handful of floating oceanographic buoys collected temperature, depth, and salinity information where Bousquet needed it. So he set out to find a new source of data.
For the past few decades, scientists have been using satellite-tagged animals to collect ocean data. For instance, in the Southern Ocean off Antarcticaa famously hostile area for humans and shipssouthern elephant seals have gathered much of the basic data we have on the waters temperature and salinity.
Researchers harness algae to grow construction cement
The massive worldwide pouring of concrete as developers densify cities could be transformed, eliminating heat-trapping pollution into the atmosphere, by switching to a new kind of cement created in Colorado cement that is grown by harnessing tiny sea organisms.Urban concrete jungles also would look less gray because the new cement is lighter in color and more reflective.
The U.S. Department of Energy this month embraced University of Colorado research that developed this cement, investing $3.2 million for scaling up cultivation of an algae species called coccolithophores. CUs innovation appealed to the DOEs Advanced Research Projects Agency because cement production causes 7% of the global heat-trapping pollution that accelerates climate warming. Thats a significant share, exceeding emissions from airplane travel.
This is a carbon dioxide removal project, said CU Boulder materials scientist Wil Srubar, leader of the work and director of CUs Living Materials Laboratory, who got got the idea while snorkeling in Thailand on his honeymoon in 2017. He saw magnificent natural limestone structures in coral reefs and wondered whether humans could replicate natural processes to make enough limestone for cement instead of excavating limestone from quarries.
Y chromosome loss through aging can lead to an increased risk of heart failure and death from cardiovascular disease, new research finds
The Y chromosome can be lost through the process of aging, and this can lead to an increased risk of heart failure and cardiovascular disease, according to a recent study my colleaguesand Ipublished in the journalScience.
While most women have two X chromosomes, most men have one X and one Y. And many people with Y chromosomes start to lose them in a fraction of the cells in their body as they age.
While loss of the Y chromosome wasfirst observed in 1963, it was notuntil 2014that researchers found an association between loss of the Y chromosome and shorter life span. Y chromosome loss has since been linked to a number ofage-related diseases, such as cancer and Alzheimers disease. However, it has been unknown whether this loss is just another benign indicator of aging, like gray hair or skin wrinkles, or whether it has a direct role in promoting disease. []
We found that while loss of the Y chromosome did not have immediate effects on the young mice, they ended up aging poorly, dying at an earlier age than mice that still had Y chromosomes. They also had more buildup of scar tissue in the heart, a condition calledfibrosis, as well as a stronger decline in heart function after induced heart failure. Treating the mice with a drug that blocks heart scarring, however, was able to restore lost heart function.
Genetic testing could help match people with the right antidepressant, new VA study finds
Understanding patient genetics could help to minimize the trial-and-error approach to prescribing antidepressants, a national study led by researchers at the Crescenz VA Medical Center in Philadelphia has found.
Finding the right antidepressant can take time. Its not uncommon for patients to try a few before finding an effective medication without too many side effects. Each round can mean losing weeks while waiting for the medication to start working, a frustrating reality for patients who seek relief and prescribers who often have little to guide them toward the optimal prescription.
Often with medications you might start with one, a patient might have side effects for that or it might not work, said David Oslin, a psychiatrist at the Philadelphia-based VA Medical Center. You end up with a second or third trial before finding something thats effective.
The oldest, brightest black holes in the universe were born from violent gas attacks, new study suggests
Twinkling like cosmic lighthouses on a shore 13 billion light-years from Earth, quasars are some of the oldest, brightest relics of the early universe that astronomers can detect today.
Short for "quasi-stellar radio sources," quasars are gargantuanblack holesthat glow as brightly as galaxies and are millions to billions of times as massive asEarth's sun. Today, quasars exist at the centers of many large galaxies. But thanks to their exceptional luminosity, quasars have been tracked far acrossspace-time, with roughly 200 of them identified as forming within the first billion years of our universe's history.
How could such massive objects form so early, when galaxies were sparse and large stars were exceptionally rare? The question has bedeviled researchers for more than two decades, since the first quasars were identified and now, a new study published July 6 in the journalNature
Researchers Have Found The First Example of Another Mammal 'Farming' Its Food
It was thought that humans were unique amongst mammals when it came to farming but depending on how strict we are with definitions, it turns out we might not be alone when comes to tending the land to grow food.
Scientists have discovered thatpocket gophers(Geomys pinetis) also practice a form of agriculture.
Measurements on a field containing burrows built by the little critters suggest they don't just harvest the longleaf pine roots that grow into their homes they cultivate them. []
"Southeastern pocket gophers are the first non-human mammalian farmers,"says biologist Francis Putz, from the University of Florida. "Farming is known among species of ants, beetles, and termites, but not other mammals."
Geologists reveal trends in mineral diversity
By classifying minerals by how they were made, scientists could better study the complex chemistry on other worlds.
Geology reference texts define mineral species based on chemical composition and crystal structure. But mineral samples collected in the field often contain trace elements and structural defects that distinguish most specimens from a textbook example. If youre interested in comparing Earth with other planets, both within our solar system and beyond, then you really need to think beyond those very simple, idealized structures, saysRobert Hazen, a mineralogist and astrobiologist at the Carnegie Institution for Science. So Hazen and his colleagues devised a new way to categorize minerals using the imperfections that tell stories about each minerals geologic past.
Because minerals acquire defects as they form, the isotopic ratios and foreign inclusions trapped within their crystal lattices can help researchers understand the context in which they were made. After combing the literature, Hazen and his team identified approximately 60 processes, such as lightning and oxidation events, that contribute to the formation of the more than 5,000 minerals known on Earth.
If Youre Owned by a Cat, Scientists Want to Hear From You
Scientists in California are asking for U.S. volunteers who live with cats to participate in a new research project. The study will survey owners about their pets behaviours and their knowledge of training methods. The teams larger goal is to help cats especially kittens and humans better form healthy relationships with one another.
The work is being conducted by scientists from the Animal Welfare Epidemiology Lab at the University of California Davis. Last fall, the teamrecruitedvolunteers who owned exactly two cats to look at cat videos on the internet, as part of a project to study how well owners could read feline body language. They were especially interested in knowing whether owners could tell when cats were about to lash out at their furry roommates.
View original post here:
Overnight News Digest: We humans really are connected to the universe. - Daily Kos
People considering suicide might show signs early on. Here’s what to watch for – CNN
Researchers still haven't nailed down how to better predict who's at risk for attempting suicide, and whether or when vulnerable people will do it, said Justin Baker, clinical director of The Suicide and Trauma Reduction Initiative for Veterans at The Ohio State University Wexner Medical Center.
"That is extremely, extremely difficult," he said. "You can look back in time, when someone's made an attempt or has died, and go, 'Oh, look at all these things that were going on in their life.' The difficulty is that a lot of people handle or experience those types of stressors as well but never go on to (attempt suicide)."
Additionally, there isn't always a long timeframe wherein someone is considering suicide and showing signs -- and there can be as little as 5 to 15 minutes between someone deciding to attempt suicide and doing it, Baker added.
"What we collectively understand is it's an emotional dysregulation and cognitive error that occurs," Baker said. "They can't fix the situation, or they can't think their way through the situation, so suicide becomes a viable option as a way to manage the pain that they're in. So they may take action on it in that really short, brief window."
But there are some situations wherein a person who is suicidal and planning for a longer period of time will show behavioral changes, Baker added.
"If you're noticing that kind of stuff, obviously that's someone who is really close to being imminent risk -- someone who's really close to making that decision to end their life," he said. "But I would argue most people don't get that kind of warning."
Here are some of the most common behavioral, verbal and emotional signs and risk factors you should pay attention to, according to experts.
Behaviors to watch for
Some people might seem like their usual selves in the weeks or days leading up to a suicide attempt, while others might show behavioral changes that don't track with what you know about them, said Michael Roeske, a clinical psychologist and senior director of the Newport Healthcare Center for Research & Innovation.
Other potential behavioral red flags include giving away cherished belongings, sleeping too much or too little, withdrawing or isolating oneself, showing rage or desire to enact revenge, and acting anxious or agitated, according to Roeske, Baker and SAMHSA. Getting really intoxicated one night or driving recklessly could also be signs to watch out for, Roeske said.
Such behavior might be them "testing themselves to see if they can actually do it," Baker said. "A lot of times people need to kind of work up to that actual making an attempt because it's a biologic thing you have to go against, your own survival."
Concerning comments
Talking about wanting to die -- by suicide or otherwise -- is another warning sign that should always be taken seriously, Roeske said. Such comments are sometimes just expressions of discomfort, pain, boredom or desire for closeness rather than a reflection of actually wanting to die, but that doesn't mean you don't monitor the person who's making them, he added.
Some people might say they feel like they have no reason to live. "If someone is struggling to come up with a reason for living, that's a much higher-risk person than someone who's even able to identify one (reason)," Baker said.
Others talk about feeling like a burden on those close to them, Roeske said, or like they don't belong anywhere or with anyone. Such comments might include "You don't need me for this anymore" or "I feel like it'd be better if I just wasn't here." Teenagers considering suicide might not want their guardians to use their money for college, he added.
Mood and other risk factors
What to do
If any of these signs resonate with you, seek professional help and talk with someone you can trust and feel supported by, Baker said. Psychotherapy and certain psychiatric medications, such as antidepressants, can help, Roeske said.
If a loved one is showing signs they might be at risk of suicide, "it's not really your job to be able to predict the future," Baker said. But you can be supportive and intentional about asking them what's going on, Roeske and Baker said.
"You're not going to cause someone to be suicidal by asking directly about suicide," Baker said. "The worst they're going to say is 'no' and not get offended. If they are, still ask them. I'd rather have someone offended at me than dead."
When checking on someone, use what experts call a narrative, person-centered approach, Baker recommended. That might look like an open-ended question: "Hey, I've noticed life's gotten overwhelming these past couple days. Do you want to tell me about it?"
As the person responds, you can, to some extent, listen, express appreciation for them sharing their story and offer to help figure it out together, without offering advice on how to handle it, Baker said. But if your loved one seems more at risk or in the process of attempting suicide, "you no longer have time or the luxury to get their opinion," he added. Get medical care or call 911.
When Roeske first started working as a clinician, he had a young female patient who was a very accomplished equestrian, went to a prestigious school and had a lot of family resources, he said -- but she had been chronically suicidal for 10 to 15 years, since she was a teenager.
"Every time she would go to her mom and tell her that, her mom would (say things like) 'Oh, you're so beautiful. Look at how you are with the horses,'" Roeske said. "And (the patient) said, 'What it felt like was Mom was afraid of what I was saying and needed to distance herself from it.'
She said that therapists would do the same thing -- you know, 'create a positive gratitude list or correct your cognitive distortions.' Finally, there was a psychiatrist that looked at her as she said, 'I think I'm going to kill myself.' And the psychiatrist said, 'I think you might, too.' And she said it was the first time someone was willing to be in there with her."
When talking with someone who's suicidal, you might want to tell them all the wonderful reasons why they should stay alive, Roeske said -- but that can actually make them feel more lonely.
Unfortunately, "we are no better able to predict who will die by suicide than who will be in a car accident," Baker said. "This does not help to alleviate the grief or pain for those who have lost loved ones to suicide, but hopefully it helps remove some of the guilt and responsibility."
CNN's Jacqueline Howard contributed to this story.
Go here to read the rest:
People considering suicide might show signs early on. Here's what to watch for - CNN
PROMISING STEM CELL THERAPY IN THE MANAGEMENT OF HIV & AIDS | BTT – Dove Medical Press
Introduction
Stem cells are highly specialized cell types with an impressive ability to self-renew, able to transform into one or even more specific cell types that play a significant role in the regulation and tissue healing process.17 To self-renew, a stem divides into two identical daughter stem cells and a progenitor cell and the embryonic and adult cells contain stem cells.1,2,8
Curing patients with serious medical conditions has been the focus of all disciplines of medical research for many years. Stem cell treatment has evolved into a highly exciting and progressed field of scientific research. Major advances have recently been introduced in fundamental and translational stem-cell-based treatment studies. As stem cell research progressed, many therapeutic options were investigated. The development of therapeutic procedures has sparked a great deal of interest.1,9 Humanity has known for many years that it is possible to regenerate lost tissue. Recently, the regenerative medicine research has taken hold, defying the tremendous scientific advances in the molecular biology sciences only. Technological advances provide limitless opportunities for transformational and potentially restorative therapies for many of humanitys most illnesses. A variety of human organs have successfully yielded stem cells. Besides this, the cell therapy is rapidly bringing good advancements in the healthcare system, intending to restore and possibly replace injured tissue, as well as organs, and ultimately restore the functional capacity of the body.2,10,11
The stem cells can be obtained from various sources of Adult (Adult body tissues), Embryonic (Embryos), Mesenchyma (Connective tissue or stroma), and Induced pluripotent stem [ips] cells (Skin cells or tissue-specific cells).3,68,1215
Due to various stem cells cellular characteristics, the therapeutic clinical possibilities of stem-cell-based treatment are considered promising. These cells can regrow and restore various types of body tissues, for this reason, they are recognized as precursor cells to all kinds of cells.15 The following are the distinguishing features: 1. Self-renewal- Divide without distinction to generate an infinite supply, 2. Multi-potency- One mature cell may distinguish more than one, 3. Pluripotency- Create all sorts of cells except for embryonic membrane cells, 4. Toti- potency- Produce various sorts of cells, including embryonic stem cells.1,2,6,7,16
Stem cells are essential human cells that really can self-renew and make a distinction into particular mature cell types.3,6 The different types of stem cells are embryonic, induced pluripotent, and adult kind of cell types. They all share the important feature of self-renewal, and the ability to discern themselves. It should be mentioned that, the stem cells are not homogeneous, but instead appear in a progressive order. Totipotent stem cells are the most basic and immature stem cells. The above cells can form a complete embryo and also extra-embryonic tissue. This one-of-a-kind efficiency is only present for a short period, starting with ovum development and completing whenever the embryo achieves the 4 to 8 cell phases. Having followed that, cells that divide until they approach the blastocyst, about which point they end up losing their totipotency and acquire a pluripotent character trait, at which cells can only distinguish through each embryonic germ stack. After a few divisions, the pluripotency character trait starts to fade and the distinguishing ability has become more lineage constrained, where its cells are becoming multipotent, indicating they could only transform into the cells connected to a cell or tissue of origin.10 Many researchers believe that adult stem cells should be used in stem cell therapies.6,17
The stem cells can be transformed into a wide range of specialized functional cell types.3,18 In response to injury or maturation, those same stem cells can propagate in massive quantities.19 Adult, embryonic, and induced pluripotent stem cells are examples of stem cell-based therapies.14,15,1921 The stem cells, due to their capability to distinguish the specific cell types requisite for a diseased tissue regeneration, can provide an effective solution, while tissue and organ transplantation are considered necessary.10 The sophistication of stem cell-based treatment interventions, on the other hand, probably leads researchers to seek stable, credible, and readily available stem cell sources capable of converting into numerous lineages. As an outcome, it is critical to exercise caution when selecting the type of stem cells to be used in therapeutic trials.12,14,22
Only with the explosive growth of basic stem cell research in recent years, the comparatively recent study sector of Translational Research had also grown exponentially, starting to build on major research knowledge and insight to advance new therapies. Once the necessary regulatory clearances have been obtained, the clinical translation process can start. Translational research is important because it acts as a filtration system, ensuring that only safe and effective therapeutic approaches start making it to the clinic.23 Recent research illustrating, the successful application of stem cell transplantation to patient populations suggests that, such restorative approaches have been used to address a wide variety of complicated ailments of future concerns.19,24
Currently, clinical trials are available for a variety of stem cell-based treatments based on adult stem cells. To date, the WHO International Clinical Experiments Registration process has recorded more than 3000 experiments involved based on adult stem cells. Furthermore, preliminary trials involving novel and intriguing pluripotent stem cell therapies have been registered. These studies findings will assist the ability to comprehend and the timeframes required to obtain effective treatments and it will contribute to a better knowledge of the different disorders or abnormalities.10
The role of stem cells in modern medicine is vital, both for their widespread application in basic research and for the opportunities they provide for developing new therapeutic strategies in clinical practice.6,16 In recent times, the number of studies involving stem cells has expanded tremendously. Globally, thousands of studies claiming to use stem cells in experimental therapies have now been in the investigation field. This may give the impression that such treatments have already been shown to be extremely effective in the context of healthcare. Despite some promising results, the vast majority of stem cell-based therapeutic applications are still in the experimental stage itself.6,25
The stem cells are a valuable resource for understanding organogenesis as well as the bodys continual regenerative capacity. These cells have brought up enormous anticipations among doctors, investigators, patients, and the public at large because of their ability to distinguish into a variety of cell types.25 These cells are necessary for living beings for a variety of reasons and can play a distinguishable role. Several stem cells can play all cell types roles, and when stimulated effectively, they can also repair damaged tissue. This capability has the potential to save lives as well as treat human injuries and tissue destruction. Moreover, different kinds of stem cells could be used for several purposes, including tissue formation, cell deficiency therapeutic interventions, and stem cell donation or retrieval.3,6,26
New research demonstrating that the successful application of stem cell treatments to patients has expressed hope that such regenerative strategies might very well one day is being used to address a wide variety of problematic ailments. Furthermore, clinical trials incorporating stem cell-based therapeutics have advanced at an alarming rate in recent years. Some of these studies had a significant impact on a wide range of medical conditions.10 As a regenerative medicine strategy, cell-based treatment is widely regarded as the most fascinating field of study in advanced science and medicine. Such technological innovation paves the way for an infinite number of transformational and potentially curable solutions to some of humanitys most pressing survival issues. Moreover, it is gradually becoming the next major concern in medical services.11
Modern data, which shows that the successful stem cell transplantation in beneficiaries has raised hopes on the certain rejuvenating approaches, will one day be used to treat many different types of challenging chronic conditions.24 Preliminary data from highly innovative investigations have documented that the prospective advancement of stem cells provides a wide range of life-threatening ailments that have so far eluded current medical therapy.2,10,11 Furthermore, clinical trials involving stem cell-based therapies have advanced at an unprecedented rate. Many of these studies had a significant impact on various disorders.19 Despite the increasing significance of articles concerning viable stem cell-based treatments, the vast majority of clinical experiments have still yet to receive full authorization for stem cell treatments confirmation.11,12,27
Even though the first case of AIDS were noted nearly 27 years ago, and the etiologic agent was noticed 25 years ago, still for the effective control of the AIDS pandemic continues to remain elusive.28 The HIV epidemic started in 1981 when a new virus syndrome defined by a weakened immune system was revealed in human populations across the globe. AIDS showed up to have a substantial reduction in CD4+ cell counts and also elevated B-cell multiplication.15,2831
The agent that causes AIDS, later named HIV, is a retroviral disease with a genomic structural system made up of 2 identical single-stranded RNA particles.3234 According to the Centres for Disease Control and Prevention, with over 1.1 million Americans are presently infected with the virus.31 Compromised immune processes in HIV and AIDS, as well as partial immune restoration, barriers are confirmed for HIV disease eradication. Innovative developmental strategies are essential to maximizing virus protection and enabling the host immune response to eliminate the virus.35
The progression of HIV infection in humans is divided into the following stages of acute infection, chronic infection, and AIDS.15,36 During the acute infection phase, the circulation has a high viral replication, is extremely infectious, that may or may not demonstrate flu-like clinical signs. In the chronic stage, the viral load is lesser than in the acute stage, and individuals are still infectious but may be symptomless. The patient has come to the end stage of AIDS whenever the CD4+ cell count begins to fall below 200 cells/mm or even when opportunistic infections are advanced.15,36
There are currently two types of HIV isolated HIV-1 and HIV-2.15,37,38 However, HIV-1 is the most common cause of AIDS throughout the world, while HIV-2 is only found in a few areas of an African country. Although both virions can cause AIDS, HIV-2 infection is much more likely to occur in central nervous system disorder.15 Besides this, HIV-2 seems to be less infectious than HIV-1, and HIV-2 infection induces AIDS to develop more slowly. Even though both HIV-1 and HIV-2 have a comparable genetic structure comprised of group-specific antigen, polymerase, and envelope genes, their genome organizational structures are differed.15,3739
HIV infiltrates immune cell types, CD4+ T cell types, and monocytes, resulting in a drop in T-cell counts below a critical level and the failure of cell-mediated immune function.15,40 The glycoprotein (gp120) observed in the virion envelope comes into contact with the CD4 particle with high affinity, allowing HIV to infect T cells. By interacting with their co-receptors, CXCR4 and CCR5, the virus infiltrates T cells and monocytes. The retrovirus uses reverse transcriptase to convert its RNA into DNA after attaching it to and entering the host cell. These newly replicated DNA copies then exit the host cell and infect other cells.15,40,41
HIV-1 is a retrovirus and belongs to a subset of retroviruses known as lentiviruses.38,42 Infection is the most common global health concern around the world.15 It has destroyed the millions of peoples health and continues to wreak havoc on the individual health of millions more. The pandemic of HIV-1 is the most devastating plague in the history of humans, as well as a significant challenge in the areas of medicine, public health, and biological science of research activities.34,43 Antiretroviral therapy is the only treatment that is commonly used. This is not a curative treatment; it must be used for the rest of ones life.15 Although antiretroviral therapy has reduced significantly HIV intensity and transmission, the virus has not been eradicated, and its continued presence can lead to additional health issues.44
Infection with the human immunodeficiency virus necessitates entry into target cells, such as through adhesion of the viral envelope to CD4 receptor sites.43 Cellular antiviral responses fail to eliminate the virus, resulting in a gradual depletion of CD4+ T cells and, finally, a severely compromised immune functioning system. Unfortunately, there is no cure for the virus that destroys immunity.4447 In advanced HIV infection, memory T-cell depletion primarily affects cellular and adaptive immune responses, with a minor impact on innate immune responses.48 Globally, 37.7 million people were living with HIV in 2020, and with 1.5 million individuals are infected with the virus.49 The advancement of stem cell therapy and the conduct of implemented clinical trials have revealed that stem cell treatment has high hopes for a range of medical conditions and implementations.15
Stem cell treatment has shown impressive outcomes in HIV management and has the potential to have significant implications for HIV treatment and prevention in the future. In HIV patients, stem cell therapy helps to suppress the viral load even while enabling antiretroviral regimens to be tapered. Interestingly, this practice led to a significant improvement in procedure outcomes soon after starting antiretroviral treatment.15 Stem cell transplantation can alleviate a wide variety of diseases that are currently incurable. They could also be used to create a novel anti-infection therapy strategic plan and to enhance the treatment of immunologic conditions such as HIV infection. HIV wreaks havoc on immune system cells.30,50
The virus infects and replicates within T-helper cells (T-cells), which are white immune system cells. T-cells are also referred to as CD4 cells. HIV weakens a persons immune system over time by pulverizing more CD4 cells and multiplying itself. More pertinently, if the individual has been unable to obtain anti-retroviral medicine, he will progressively fail to control the infectious disease and illnesses.3,15,42
Despite 36 years of scientific research, investigators are still trying to cure human HIV and its potential problem, AIDS.3,5153 HIV continues to face unconquerable dangers to human survival. This virus has developed the potential to avoid anti-retroviral therapy and tends to result in victim death.52 Investigators are still looking for effective and all-encompassing treatment for HIV and its complexity, AIDS.54 This massive amount of data revealed potential AIDS treatment targets.55 Thousands of research projects have yielded a great deal of information on the elusive AIDS life cycle to date.5456 These massive amounts of data supplied possible targets for AIDS treatment.33,55,56 In HIV-infected patients, using stem cell therapy can augment the process of keeping the viral load stagnant by permitting antiretroviral regimens to be tapered.15
Overall, stem cell-based strategies for HIV and AIDS treatment have recently emerged and have become a key area of research. Ideally, effective stem cell-based therapeutic approaches might have several benefits.30 Clinical studies encompassing stem cell therapy have shown substantial therapeutic effects in the treatment of various autoimmune, degenerative, and genetic problems.15,25 Substantial progress has been developed in the treatment of HIV infection using stem cell-based techniques.30
Successfully treated, clinical studies have shown that total tissue recovery is feasible.15,57 In the early 1980s, the first stem cell transplants were accomplished on HIV-positive patients who were unsure of their viral disease. Following the above preliminary aspects, many HIV-positive patients with concurrent malignant tumours or other hematologic disorders underwent allogeneic stem cell transplantation around the world.42 After ART became a common treatment option for patients,58,59 the procedures prognosis improved dramatically. In addition, a retrospective study of 111 HIV+ transplant patients demonstrated a mildly lower overall survivorship performance in comparison to an HIV-uninfected comparison group.60
Earlier, the primary problem for people living with HIV and AIDS was immunodeficiency caused by a loss of productive T-cells. Some clinicians intended to replenish lost lymphocytes through adoptive cell transplants in the initial days before efficacious antiretroviral therapy options were available. Immunologically, it is relatively simple in an isogeneic condition, as illustrated on HIV-positive individuals with just a correlating identical twin who received T-lymphocytes and stem cell transfusions to rebuild the weak immune status of the patient.60 Cell therapy transfusion may be used to remove resting virion genomes from CD4+ immune cells and macrophages mostly through genome-editing or cytotoxic anti-viral cells.15,60 Cell technology and stem cell biological reprogramming developments have made a significant contribution to novel strategies that may give confidence to HIV healing process.3 However, human embryonic stem cells can be distinguished into significant HIV target cells, according to several research findings.30,61,62
Initially, stem cell transplantation was believed to influence the clinical significance of HIV infection, but viral regulation was not accomplished in the discipline. Moreover, improvements in stem cell transplants utilizing synthetic or natural resistant cell resources, in combination with novel genetic manipulative tactics or the advancement of cytotoxic anti-HIV effector cells, have significantly accelerated this sector of HIV cell management.60 Multiple techniques are being introduced to overcome HIV, either through protecting cells from infectious disease or by continuing to increase immune responses to the viral infection.30 The various methods are as follows: Bone marrow stem cells Therapies, Autologous stem cell transplantations, Hematopoietic stem cell transplantation, Genetical modifications of Hematopoietic stem cells (HSCT), HSCT and HAART therapeutic approach, Human umbilical cord mesenchymal stem cell transplantation, Mesenchymal stem/stromal cells (MSCs) applications, CCR5 Delta32/Delta32 Stem-Cell Transplantation, CRISPR and stem cell applications, Induced Pluripotent Stem Cells applications.
According to the findings, circulating replicative HIV remains the most significant threat to effective AIDS therapy. As a result, a method for conferring resistance to circulating HIV particles is required. The effective viral burden in the human body would be significantly reduced if it were possible to defeat reproducing HIV particles.43,44 For the treatment of AIDS, a restorative approach that relies on bone marrow stem cells has been suggested.52 The proposed treatment method captures and eventually destroys circulating HIVs using receptor-integrated red blood cells. Red blood cell membranes can be equipped with the CD4 receptor and the C-C chemokine receptor type 5 and C-X-C chemokine receptor type 4 co-receptors, which will selectively bind circulating HIV particles.15,30,32,33,43,44,46,6365
The term autologous pertains to blood-forming stem cells obtained from the patient for use as a source of fresh blood cells followed by high-dose chemotherapeutic agents.66 Lymphoma is still the biggest cause of mortality in HIV patients. Autologous stem cell recovery or transplantation with high-dose treatments has long been supported as a treatment for certain types of cancer in HIV-negative patients, including leukaemia and lymphoma. Individuals over the age of 65, as well as those with health problems such as HIV, were excluded from initial transfusion experiments. Moreover, the treatment regimen mortality of transplantation has also been reduced significantly due to its use of peripheral blood stem cells rather than bone marrow and the use of newer marginal conditioning therapeutic strategies. HIV-infected clients may be able to utilize enough stem cells for an autologous transplant advancement in HIV management. High-dose Autologous stem cell transplant (ASCT) treatments are better than conventional treatment in people with relapsed non-Hodgkin lymphoma, according to randomized trial evidence. Similarly, studies on HIV-negative people with Hodgkin Lymphoma have shown that ASCT would provide patients with repetitive illness with long-term progression-free survival.66,67 Even so, the clinical trial on Allogeneic Hematopoietic Cell Transplant for HIV Patients with Hematologic Malignancies report was explained as, the cell-associated HIV DNA and inducible infectious virus were not detectable in the blood of patients who attained complete chimerism.68
The study on long-term multilineage engraftment of autologous genome-edited hematopoietic stem cells in nonhuman primates report findings was Genome editing in hematopoietic stem and progenitor cells (HSPCs) is a potential innovative approach for the treatment of numerous human disorders. This report shows that genome-edited HSPCs engraft and contribute to multilineage repopulation following autologous transplantation in a clinically relevant large animal model, which is an important step toward developing stem cell-based genome-editing therapeutics for HIV and possibly other illnesses.69
Research on comprehensive virologic and immune interpretation in an HIV-infected participant again just after allogeneic transfusion and analytical interruption of antiretroviral treatment findings are the instance of HIV-1 cure having followed allogeneic stem cell transplantation (allo-SCT), resulting allo-SCTs in HIV-1 positive participants have failed to cure the disease. It describes adjustments in the HIV reservoir in a single chronically HIV-infected client who had undergone allo-SCT for acute lymphoblastic leukaemia treatment and was obtaining suppressive antiretroviral treatment.
To estimate the size of the HIV-1 reservoir and describe viral phylogenetic and phenotypic modifications in immune cells, the investigators just used leukapheresis to obtain peripheral blood mononuclear cells (PBMCs) from a 55-year-old man with chronic HIV infection prior and after allo-SCT. Once HIV-1 was found to be unrecognizable by numerous tests, including the PCR measurement techniques both of overall and fully integrated HIV-1 DNA, recompilation virus precise measurement by significant cell input quantifiable viral outgrowth assay, and in situ hybridization of intestine tissue, the client accepted to an analytic treatment interruption (ATI) with recurrent clinical observing on day 784 post-transplantation. He continued to remain aviremic off ART until ATI day 288, once a reduced virus rebound of 60 HIV-1 copies/mL resulted, which expanded to 1640 HIV-1 copies/mL five days later, urging ART reinitiation. Rebounding serum HIV-1 action sequences were phylogenetically distinguishable from pro-viral HIV-1 DNA discovered in circulating PBMCs before transplantation. It was indicated that allo-SCT tends to result in significant reductions in the magnitude of the HIV-1 reservoir and a >9-month ART-free cessation from HIV-1 multiplication.34
The Impact of HIV Infection on Transplant Outcomes after Autologous Peripheral Blood Stem Cell Transplantation: A Retrospective Study of Japanese Registry Data reported as ASCT is a successful treatment option for HIV-positive patients with non-Hodgkin lymphoma and multiple myeloma (MM). HIV infection was associated with an increased risk of overall mortality and relapse after ASCT for NHL in a study population.70
The procedure of delivering hematopoietic stem cells mostly through intravenous infusion to restore normal haematopoiesis or treat cancer is known as hematopoietic stem cell transplantation.71 There has recently been a rise in the desire to develop strategies for treating HIV/AIDS diseases employing human hematopoietic stem cells,30 along with this Hutter and Zaia were evaluated the background of Haematopoietic stem cell transplantation (HSCT) in HIV-infected individuals.42
Attempts to use HSCT as a technique for immunologic restoration in AIDS patients or as a therapeutic intervention for malignant tumours were initially insufficient. Regretfully, in the absence of sufficient ART, HSCT seemed to have no impact on the evolution of HIV infection, and the majority of the patients ended up dead of rapidly deteriorating immunosuppression or reoccurring lymphoma or leukaemia. A specific instance report described how an un-associated, matched donor supplied allogeneic HSCT to a patient with refractory lymphoma. The virus was unrecognizable by isolating or PCR of peripheral blood mononuclear cells commencing on day 32 after transplantation. Although HIV-1 was unrecognizable by cultural environment or PCR of several tissues examined at mortem, the patient died of recurring lymphoma on day 47. Another client who obtained both allogeneic HSCT and zidovudine had similar results, with HIV-1 becoming unnoticeable in the blood by PCR analysis. In some other particular instances, a 25-year-old woman with AIDS who obtained an allogeneic HSCT from a corresponding, unfamiliar donor after controlling with busulfan and cyclophosphamide and ART with zidovudine and IFN-2 regimen continued to live for 10 months before falling victim to adult respiratory distress. However, PCR testing of autopsy tissues revealed that they were HIV-1 negative.72
Recent research discovered significant progress towards the clinical application of stem cell-based HIV therapeutic interventions, principally illustrating the opportunity to effectively undertake a large-scale phase two HSC-based gene therapy experiment. In this investigation, the research team used autologous adult HSCs that had been transduced to a retroviral vector that usually contains a tat-vpr-specific anti-HIV ribozyme to develop cells that were less vulnerable to productive infection,73 whereas vector-containing cells have been discovered for extended periods (more than 100 weeks in most people) and CD4+ T cell gets counted were significantly high within anti-HIV ribozyme treating people group compared with the placebo group, the impacts on viral loads were minimal. The studys success, even so, is based on the realization that a stem cell-based strategy like this is being used as a more conventional and efficacious therapeutic approach.30 Some other latest clinical studies used a multi-pronged RNA-based strategic plan which included a CCR5-targeted ribozyme, an shRNA targeting tat/rev transcripts, and a TAR segment decoy.74
These crucial research findings are explained on lentiviral-based gene therapy vectors that can genetically manipulate both dividing and non-dividing HSCs and are less likely to cause cellular changes than murine retro-viral-based vectors. Long-term engraftment and multipotential haematopoiesis have been demonstrated in vector-containing and expressing cells, according to the researchers. Whereas the antiviral effectiveness was not reviewed, the results demonstrate the strategys protection, which helps to expand well for the possibility of a lentiviral-based approach in the upcoming years.30
A further approach, with a different emphasis, has been started up in the hopes of trying to direct immune function to target specific HIV to overcome barriers to attempting to clear the virus from the patient's body. These strategies use gene treatment innovations on peripheral blood cells to biologically modify cells so that they assert a receptor or chimeric particle that enables them to especially target a specific viral antigen,75 deception of HIV-infected peoples peripheral blood T cells raises issues to be addressed, such as the effects of ongoing HIV infection and ex vivo modification on the capabilities and lifetime of peripheral blood cells. Further to that, the above genetically manipulated cells would demonstrate their endogenous T cell receptors, and the representation of the newly introduced receptor could outcome in cross-receptor pairing, resulting in self-reactive T cells. Most of these deficiencies could be countered by enabling specific developmental strategies to take place that can start generating huge numbers of HIV-specific cells in a renewable, consistent way that can restore defective natural immune activity against HIV.30
One strategy being recognized is the application of B cells obtained from HSCs to demonstrate anti-HIV neutralizing specific antibodies. While animal studies have shown that neutralizing antibodies could protect against infection, and extensively neutralizing antibodies have been noticed in some HIV-infected persons, safety from a single engineered antibody might be exceptional.76,77 Realizing antibody binding and virus neutralization may assist in the development of chimeric receptors or single-chain therapeutic antibodies with recognition domains for other techniques that identify cellular immunity against HIV-infected cells.78,79 Thereby, genetically modifying HSCs to generate B cells that produce neutralizing anti-HIV specific antibodies, or engineering HSCs to enable multipotential haematopoiesis of cells that express a chimeric cellular receptor usually contains an antibody recognition domain, indicate one arm of an HSC-based engineered immunity process.30
A further technique of using HSCs that were genetically altered with molecularly cloned T-cell receptors or chimeric molecules particular to HIV to yield antigen-specific T cells. The basic difference in this strategy is that the cells produced from HSCs after standard advancement in the bone marrow and thymus are made subject to normal central tolerance modalities and are antigen-specific naive cells, and therefore do not have the ex-vivo manipulation and impaired functioning or exhaustion problems that other external cell modification methods would have. In this context, the latest actual evidence research using a molecularly cloned T cell receptor particular to an HIV-1 Gag epitope in the aspect of HLA-A*0201 revealed that HSC altered in this ability can progress into fully functioning, mature HIV specialized CD8+ T cells in human thymic tissue that conveys the acceptable constrained HLA-A*0201 particles.80 This explores the possibility of genetically engineering HSCs with a molecularly cloned receptor and signifies a step toward a better understanding and application of initiated T cell responses, which would probably result in the eradication of HIV infection from the body, similar to the natural immune function of other virus infections and pathogenic organisms.30
In an allogeneic transplantation, donor stem cells replace the patients cells.66 Allogeneic hematopoietic stem cell transplantation (HSCT) has appeared as one of the most potent treatment possibilities for many people who suffer from hemopoietic system carcinomas and non-malignant ailments.81 Both HIV-cured people have received HSCT utilizing CCR5 132 donor cells.82,83 This implies that HIV eradication necessitates a decrease in the viral reservoir through the myeloablative procedures,8486 Having followed that, immune rebuilding with HIV-resistant cells was carried out to prevent re-infection.45 The possibility of adoptive transfer of ex vivo-grown, virus-specific T-cells to prevent and control infectious diseases (eg, Cytomegalovirus and EBV) in immunocompromised patients helps to make adoptive T-cell treatment a feasible strategy to inhibit HIV rebound having followed HSCT.81,87,88
The Engineered Zinc Finger Protein Targeting 2LTR Inhibits HIV Integration in Hematopoietic Stem and Progenitor Cell-Derived Macrophages: In Vitro Study, the researchers investigated the efficacy and safety of 2LTRZFP in human CD34+ HSPCs. Researchers used a lentiviral vector to transduce 2LTRZFP with the mCherry tag (2LTRZFPmCherry) into human CD34+ HSPCs. The study findings suggest that the anti-HIV-1 integrase scaffold is an enticing antiviral molecule that could be utilised in human CD34+ HSPC-based gene therapy for AIDS patients.89
The fundamental element of HIV management is stem cell genetic modification, which involves genetically enhanced patient-derived stem cells to overcome HIV infection. In this sector, numerous experimental studies, in vitro as well as in vivo examinations, and positive outcomes for AIDS patients have been conducted.65,74 Genetic engineering for HIV-infected individuals can provide a once-only intervention that minimizes viral load, restores the immune system, and minimizes the accumulated toxicities concerned with highly active antiretroviral therapy (HAART).73 HSCs can be genetically altered, permitting for the addition of exogenous components to the progeny that protects them from direct infectious disease and/or enables them to target a specific antigen. Besides that, HSC-based strategies can enhance multilineage hemopoietic advancement by re-establishing several arms of the immune function. Eventually, as HSCs can be produced autologously, immunologic tolerance is typically high, enabling effective engraftment and subsequent distinction into the fully functioning mature hematopoietic cells.30
The utilization of human HSCs to rebuild the immune function in HIV disease is one application that tries to preserve newly formed cells from HIV infection, while another attempts to develop immune cells that attack HIV infected cells. While each initiative has many different aspects at the moment, they represent huge attention to HIV/AIDS therapies that, most likely when integrated with the other therapeutic approaches, would result in the body trying to overcome the obstacles needed for the virus to be effectively cleaned up.30
While HSC transplantation technique and processes are not accurately novel, as they are commonly and effectively used to address a wide variety of haematological diseases and malignant neoplasms,90 trying to combine them with a gene therapeutic strategy represents a unique and possibly potent therapeutic approach for HIV and AIDS-related ailments. As the results of HIV-infected patients who obtained autologous HSCT continued to improve, there was growing interest in genetically altered stem cells that were tolerant to HIV disease. Multiple logistical challenges have impeded the advancement of genetically modified hematopoietic stem cells as a conceivable therapeutic option for HIV/AIDS.72,73
UCLAs Eli and Edythe Broad Center for Restorative Medicine and Stem Cell Studies is one bit closer to constructing an instrument to arm the bodys immune system to attack and defeat HIV. Dr. Kitchen et al are the first ones to disclose the use of a chimeric antigen receptor (CAR), a genetically manipulated molecule, in blood-forming stem cells. In the experiment, the research team introduced a CAR gene into blood-forming stem cells, which were then moved into HIV-infected mice that had been genetically programmed. The scientists found that CAR-carrying blood stem cells efficiently transformed into fully functioning T cells that have the ability to kill HIV-infected cells in mice. The outcome was an 80-to-95 percentage reduction in HIV levels, suggesting that stem-cell-based genetic engineering with a CAR might be a viable and effective approach for treating HIV infection among humans. The CAR initiative, according to Dr. Kitchen, is much more able to adapt and ultimately more efficient, which can conceivably be used by others. If any further experiment showcases keep promising, the scientists expect that a practice based on their strategy will be accessible for clinical development within the next 510 years.91
HSCT and HAART therapeutic approaches in treating HIV/AIDS as the emergence of highly active antiretroviral therapy (HAART) in the 1990s improved survival rates of HIV infection, leading to a major dramatic drop in the occurrence of AIDS and AIDS-related mortalities. As an outcome, there is much less involvement with using HSCT as a therapy for HIV infection.28,33,43,67,86
A randomized clinical trial of human umbilical cord mesenchymal stem cell transplant among HIV/AIDS immunological non responders investigation, the researchers examined the clinical efficacy of transfusion of human umbilical cord mesenchymal stem cells (hUC-MSC) for immunological non-responder clients with long-term HIV disease who have an unmet medical need in the aspect of effective antiretroviral therapy. From May 2013 to March 2016, 72 HIV-infected participants were admitted in this stage of the randomized, double-blind, multi-center, placebo-controlled dose-determination investigation. They were either given a high dose of hUC-MSC of 1.5106/kg body weight as well as small doses of hUC-MSC of 0.5106/kg body weight, or a placebo application. During the 96-week follow-up experiment, interventional and immunological character traits were analysed. They found that hUC-MSC therapy was both safe and efficacious among humans. There was a significant rise in CD4+ T counts after 48 weeks of treatment in both the high-dose (P 0.001) and low-dose (P 0.001) groups, but no changes in the comparison group.92
One interesting invention made by a team of UC Davis investigators is the recognition of a particular form of stem cell that can minimize the quantity of the virus that tends to cause AIDS, thus dramatically increasing the bodys antiviral immune activity. Mesenchymal stem/stromal cells (MSCs) furnish an incredible opportunity for a creative and innovative, multi-pronged HIV cure strategic plan by augmenting prevailing HIV potential treatments. Even while no antivirals have been used, MSCs have been able to increase the hosts antiviral responses. MSC therapeutic approaches require specialized delivery systems and good cell quality regulation. The studys findings lay the proper scientific foundation for future research into MSC in the ongoing treatment of HIV and other contagious diseases in the clinical organization.35
Infection with HIV-1 necessitates the existence of both specific receptors and a chemokine receptor, particularly chemokine receptor 5 (CCR5).46 Resistance to HIV-1 infection is attained by homozygozygozity for a 32-bp removal in the CCR5 allele.93 In this investigation, stem cells were transplanted in a patient with severe myeloid leukaemia and HIV-1 infection from a donor who was homozygous to Chemokine receptor 5 delta 32. The client seemed to have no viral relapses after 20 months of transplantation and attempting to stop antiretroviral medicine. This finding highlights the essential role that CCR5 tries to play in HIV-1 infection maintenance.86
In comparison, additional HIV-1-infected people who have received allogeneic stem cell transplants with cells from CCR5 truly wild donors did not have long-term relapses from HIV-1 rebound, with 2 of these patients trying to report viral reoccurrence 12 as well as 32 weeks after analytic treatment interruption, respectively. Among these 2 patients, allogeneic stem cell transplantation probably reduced but did not eliminate latently HIV-infected cells, enabling persistent viral reservoirs to activate viral rebound. This viewpoint may not rule out the potential that allogeneic hematopoietic stem cell transplantation might result in a much more comprehensive or near-complete elimination of viral reservoirs, enabling long-term drug-free relapse of HIV-1 infection in some contexts.84 As just one report demonstrated a decade earlier, a curative treatment for HIV-1 remained elusive. The Berlin Patient has undergone 2 allogeneic hematopoietic stem cell transplantations to cure his acute myeloid leukaemia utilizing a potential donor with a homozygous genetic mutation in HIV coreceptor CCR5 (CCR532/32).15,34,46,64,65,72,82,84,86,9496 Other similar studies with CCR5 receptor targets are as follows: Automated production of CCR5-negative CD4+-T cells in a GMP compatible, clinical scale for treatment of HIV-positive patients,97 Mechanistic Models Predict Efficacy of CCR5-Deficient Stem Cell Transplants in HIV Patient Populations,98 Conditional suicidal gene with CCR5 knockout.99
Clustered regularly interspaced short palindromic repeats CRISPR/Cas9 is a promising gene editing approach that can edit genes for gain-of-function or loss-of-function mutations in order to address genetic abnormalities. Despite the fact that other gene editing techniques exist, CRISPR/Cas9 is the most reliable and efficient proven method for gene rectification.100103
Genome engineering employing CRISPR/Cas has proven to be a strong method for quickly and accurately changing specific genomic sequences. The rise of innovative haematopoiesis research tools to examine the complexity of hematopoietic stem cell (HSC) biology has been fuelled by considerable advancements in CRISPR technology over the last five years. High-throughput CRISPR screenings using many new flavours of Cas and sequential and/or functional outcomes, in specific, have become more effective and practical.104,105
The power of the CRISPR/Cas system is that it can specifically and efficiently target sequences in the genome with just a single synthetic guide RNA (sgRNA) and a single protein. Cas9 is directed to the specific DNA sequence by the sgRNA, which causes double stranded breaks and activates the cells DNA repair processes. Non-homologous end joining can cause insertiondeletion (indel) substitutions at the target location, whereas homology-directed repair can use a template DNA to insert new genetic material.104,106
The possibility for CRISPR/Cas9 to be used in the hematopoietic system was emphasised as pretty shortly after it was initiated as a new genome editing method.106,107 The efficiency with which CRISPR-mediated alteration can be used to evaluate hematopoietic stem/progenitor and mature cell function via transplantation. As a result, hematopoietic research has significantly advanced with the implementation of these technologies. Whilst single-gene CRISPR/Cas9 programming is a significant tool for testing gene function in primary hematopoietic cells, high-throughput screenings potentially offer CRISPR/Cas9 an even greater advantage in hematopoietic research.104
While understanding human haematological disorders requires the ability to mimic diseases, the ultimate goal is to transfer this innovation into therapies. Despite significant advancements in CRISPR technology, there are still barriers to overcome before CRISPR/Cas9 can be used effectively and safely in humans. CRISPR has also been used to target CCR5 in CD34+ HSPCs in an effort to make immune cells resistant to HIV infection, as CCR5 is an important coreceptor for HIV infection.104
CRISPR is a modern genome editing technique that could be used to treat immunological illnesses including HIV. The utilization of CRISPR in stem cells for HIV-related investigation, on the other end, was ineffective, and much of the experiment was done in vivo. The new research idea is about increasing CRISPR-editing efficiencies in stem cell transplantation for HIV treatment, as well as its future perspective. The possible genes that enhance HIV resistance and stem cell engraftment should be explored more in the future studies. To strengthen HIV therapy or resistance, double knockout and knock-in approaches must be used to build a positive engraftment. In the future, CRISPR/SaCas9 and Ribonucleoprotein (RNP) administration should be explored in the further investigations.108 As well as some different title studies were explained the effectiveness of the CRISPR gene editing technology on the management of HIV/AIDS including: CRISPR view of hematopoietic stem cells: Moving innovative bioengineering into the clinic,104 CRISPR-Edited Stem Cells in a Patient with HIV and Acute Lymphocytic Leukaemia,109 Sequential LASER ART and CRISPR Treatments Eliminate HIV-1 in a Subset of Infected Humanized Mice,110 Extinction of all infectious HIV in cell culture by the CRISPR-Cas12a system with only a single crRNA,111 HIV-specific humoral immune responses by CRISPR/Cas9-edited B cells,112 CRISPR-Cas9 Mediated Exonic Disruption for HIV-1 Elimination,113 RNA-directed gene editing specifically eradicates latent and prevents new HIV-1 infection,114 CRISPR/Cas9 Ablation of Integrated HIV-1 Accumulates Pro viral DNA Circles with Reformed Long Terminal Repeats,115 CRISPR-Cas9-mediated gene disruption of HIV-1 co-receptors confers broad resistance to infection in human T cells and humanized mice,116 Inhibition of HIV-1 infection of primary CD4+ T-cells by gene editing of CCR5 using adenovirus-delivered CRISPR/Cas9,117 Transient CRISPR-Cas Treatment Can Prevent Reactivation of HIV-1 Replication in a Latently Infected T-Cell Line,118 CCR5 Gene Disruption via Lentiviral Vectors Expressing Cas9 and Single Guided RNA Renders Cells Resistant to HIV-1 Infection,119 CRISPR/Cas9-Mediated CCR5 Ablation in Human Hematopoietic Stem/Progenitor Cells Confers HIV-1 Resistance In Vivo.109
Induced pluripotent stem cells (iPSCs) have significantly advanced the field of regenerative medicine by allowing the generation of patient-specific pluripotent stem cells from adult individuals. The progress of iPSCs for HIV treatment has the potential to generate a continuous supply of therapeutic cells for transplantation into HIV-infected patients. The title of the study is reported on Generation of HIV-1 Resistant and Functional Macrophages from Hematopoietic Stem Cellderived Induced Pluripotent Stem Cells. In this investigation, researchers used human hematopoietic stem cells (HSCs) to produce anti-HIV gene expressing iPSCs for HIV gene therapy. HSCs were dedifferentiated into constantly growing iPSC lines using 4 reprogramming factors and a combination anti-HIV lentiviral vector comprising a CCR5 shRNA and a human/rhesus chimeric TRIM5 gene. After directing the anti-HIV iPSCs toward the hematopoietic lineage, a large number of colony-forming CD133+ HSCs were acquired. These cells were distinguished further into functional end-stage macrophages with a normal phenotypic profile. Upon viral challenge, the anti-HIV iPSC-derived macrophages displayed good protection against HIV-1 infection. Researchers have clearly shown how iPSCs can establish into HIV-1 resistant immune cells and explain their prospective use in HIV gene and cellular therapies.120
Some other similar titles of the studies reported on the effectiveness of IPSCs on HIV/AIDS managements are as follows: Generation of HIV-Resistant Macrophages from IPSCs by Using Transcriptional Gene Silencing and Promoter-Targeted RNA,121 Generation of HIV-1-infected patients gene-edited induced pluripotent stem cells using feeder-free culture conditions,122 A High-Throughput Method as a Diagnostic Tool for HIV Detection in Patient-Specific Induced Pluripotent Stem Cells Generated by Different Reprogramming Methods,123 Genetically edited CD34+ cells derived from human iPS cells in vivo but not in vitro engraft and differentiate into HIV-resistant cells,124 Engineered induced-pluripotent stem cell-derived monocyte extracellular vesicles alter inflammation in HIV humanized mice,125 Sustainable Antiviral Efficacy of Rejuvenated HIV-Specific Cytotoxic T Lymphocytes Generated from Induced Pluripotent Stem Cells.126
Recently, one HIV patient appeared to be virus-free after having undergone a stem-cell transfusion in which their WBCs were changed with HIV-resistant variations.84 Timothy Ray Brown also noted as the Berlin patient, who is still virus-free, was the first individual to undertake stem-cell transplantation a decade earlier. The most recent patient, like Brown, had a type of leukaemia that was vulnerable to chemo treatments. They required a bone marrow transplantation, which involved removing their blood cells and replacing them with stem cells from a donor cell.5,31,34,41,127130 Rather than simply choosing a suitable donor, Ravindra Gupta et al chose one who already had 2 copies of a mutant within the CCR5 gene,128,131 which provides resistance to HIV infection.3
Additionally, this gene encodes for a specific receptor of white blood cells that are assisted in the bodys immunological responses. The transplant, according to Guptas team, completely replaced the clients White cells with HIV-resistant forms.41,83 Cells in the patients blood disrupted expressing the CCR5 receptor, making it unfeasible for the clients form of HIV to infect the above cells again. The scientists determined that the virus had been cleared from the patients blood after the transplantation. Besides that, after 16 months, the client has withdrawn antiretroviral treatment. The infection was not detected in the most recent follow-up, which occurred 18 months after the treatment was discontinued. Adam, also known as the London patient, was the second person to be cured of HIV as a result of a stem cell transfusion. This discovery is an important step forward in HIV research because it may aid in the detection of potential future therapeutic interventions. It must be noted, but even so, that this is not an extensively used HIV treatment. For HIV-infected patients, antiretroviral drugs have been the foremost therapeutic option.3,31,41,94,129,130 It also encourages many investigators and clinicians to look at the use of stem cells in the treatment of a wide range of serious medical conditions. The reprogramming abilities of stem cells, as well as their accessibility, have created a window of opportunity in medical research. The clinical utility of stem cells is forecast to expand rapidly in the coming years.
On Feb 15, 2022, scientific researchers confirmed that a woman had become the 3rd person in history to be successfully treated for HIV, the virus that causes AIDS, after just receiving a stem-cell transfusion that has used cells from cord blood. Within those transplant recipients, adult hematopoietic stem cells have been used; these are stem cells that eventually develop into all blood cell types, which include white blood cells, these are a vital component of the immune framework. Even so, the woman who had fairly recently been completely cured of HIV infection had a more unique experience than that of the 2 men who were actually cured before her.132
The clients physician, Dr. JingMei Hsu of Weill Cornell Medicine in New York, informed them that, she had been discharged from the hospital just 17 days after her procedure was performed, even with no indications of graft vs host ailment. The woman was HIV-positive but also had acute myeloid leukaemia, a blood cancer of the bone marrow that affects blood-forming cells. She had likely received cord blood as a successful treatment for both her cancer and HIV once her doctors decided on a potential donor well with HIV-blocking gene mutation. Cord blood comprises a high accumulation of hematopoietic stem cells; the blood is obtained during a childs birth and donated by the parents.132
The patients donor was partly nearly matched, and she received stem cells from a close family member to enhance her immune function after the transfusion. The procedure was performed on the woman in August of 2017. She chose to discontinue taking antiretroviral drugs, the standardized HIV intervention, 37 months upon her transfusion. After more than 14 months, there is no evidence of the viral infection or antibodies against it in her blood. Umbilical cord blood, in reality, is much more commonly accessible and simpler to try to match to beneficiaries than bone marrow. Perhaps, some research suggests that the method could be more available to HIV patients than bone marrow transplantation. Nearly 38 million people worldwide are infected with HIV. The potential for using partly matched umbilical cord blood transplantation increases the chances of choosing appropriate suitable donors for these clients considerably.132
It is really exciting to see the earlier terminally ill diseases of being effectively treated. In recent times, there has been a surge of focus on stem cell research.3 Stem cell therapy advancements in inpatient care are receiving a growing amount of attention.20 HIV/AIDS has been and remains a significant health concern around the world. Effective control of the HIV pandemic will necessitate a thorough understanding of the viruss transmission.32
Despite concerns about full compliance and adverse reactions, HAART has demonstrated to be able to succeed and is a sign specifically targeted form of treatment against HIV advancement. As illustrated by the first case of HIV infection relapse attained by bone marrow transplant, anti-HIV HPSC-based stem cell treatment and genotype technology have established a possible future upcoming technique to try to combat HIV/AIDS.
Investigators have conducted experiments with engineering distinct anti-HIV genetic traits trying to target different phases of HIV infection utilizing advanced scientific modalities. In numerous in vivo and in vitro animal studies, HSPCs and successive mature cells were secured from HIV infection by trying to target genetic factors in the infection. Anti-HIV gene engineering of HSPCs is safe and efficacious.15
The number of stem-cell-based research trials has risen in recent years. Thousands of studies claiming to use stem cells in experimental therapies have been registered worldwide. Despite some promising results, the majority of clinical stem cell technologies are still in their early life. These achievements have drawn attention to the possibility of the potential and advancement of various promising stem cell treatments currently in development.11
HIV remains a major danger to humanity. This virus has developed the ability to evade antiretroviral medication, resulting in the death of individuals. Scientists are constantly looking for a treatment for HIV/AIDS that is both effective and efficient.52 The 1st treatments in HIV+ clients were conducted in the early 1980s, even though they were cognizant of their viral disease. Following these early cases, allogeneic SCT was used to treat HIV+ patients with associated cancer or other haematological disorders all over the world. Stem cell transplantation developments have also stimulated the improvement of innovative HIV therapeutic approaches, especially for large goals like eradication and relapse.60
Numerous stem cell therapy progressions have been recognized with autologous and allogeneic hematopoietic stem cell transplantation, as well as umbilical cord blood mesenchymal stem cell transplant in AIDS immunologic non-responders. Whereas this sector continues to advance and distinguishing directives for these cells become much more effective, totipotent stem cells such as hESC and the recently reported induced pluripotent stem cells (iPSC) could be very useful for genetic engineering methods to counter hematopoietic abnormalities such as HIV disease.133135
Immunocompromised people are at a higher risk of catching life-threatening diseases. The perseverance of latently infected cells, which is formed by viral genome inclusion into host cell chromosomes, is a significant challenge in HIV-1 elimination. Stem cell therapy is producing impressive patient outcomes, illustrating not only the broad relevance of these strategies but also the huge potential of cell and gene treatment using adult stem cells and somatic derivative products of pluripotent stem cells (PSCs).
Stem cells have enormous regeneration capacity, and a plethora of interesting therapeutic uses are on the frontier. This is a highly interdisciplinary scientific field. Evolutionary biologists, biological technicians, mechanical engineers, and others that have evolved novel concepts and decided to bring them to medical applications are required to make important contributions. Further to that, recent advancements in several different research areas may contribute to stem cell application forms that are novel. Several hurdles must be conquered, however, in the advancement of stem cells. On the other hand, this discipline appears to be a promising and rapidly expanding research area.
Stem cell-based approaches to HIV treatment resemble an innovative approach to trying to rebuild the ravaged bodys immune system with the utmost goal of eliminating the virus from the body. We will probably see effective experiments from the next new generation of stem cell-based strategies shortly, which will start serving as a base for the further development and use of these techniques in a range of treatment application areas for other chronic diseases.
My immense pleasure was mentioned to family members and friends, who supported and encouraged me in every activity.
There was no funding for this work.
The authors declare that they have no conflicts of interest in relation to this work.
1. Zakrzewski W, Dobrzyski M, Szymonowicz M, Rybak Z. Stem cells: past, present, and future. Stem Cell Res Ther. 2019;10:68. doi:10.1186/s13287-019-1165-5
2. Nadig RR. Stem cell therapy hype or hope? A review. J Conserv Dent JCD. 2009;12:131138. doi:10.4103/0972-0707.58329
3. Tasnim KN, Adrita SH, Hossain S, Akash SZ, Sharker S. The prospect of stem cells for HIV and cancer treatment: a review. Pharm Biomed Res. 2020;6:1726.
4. Weissman IL. Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science. 2000;287:14421446. doi:10.1126/science.287.5457.1442
5. Pernet O, Yadav SS, An DS. Stem cellbased therapies for HIV/AIDS. Adv Drug Deliv Rev. 2016;103:187201. doi:10.1016/j.addr.2016.04.027
6. Kolios G, Moodley Y. Introduction to stem cells and regenerative medicine. Respir Int Rev Thorac Dis. 2013;85:310.
7. Ebrahimi A, Ahmadi H, Ghasrodashti ZP, et al. Therapeutic effects of stem cells in different body systems, a novel method that is yet to gain trust: a comprehensive review. Bosn J Basic Med Sci. 2021;21:672701. doi:10.17305/bjbms.2021.5508
8. Introduction stem cells. Available from: https://www.dpz.eu/en/platforms/degenerative-diseases/research/introduction-stem-cells.html. Accessed December 19, 2021.
9. Hu J, Chen X, Fu S. Stem cell therapy for thalassemia: present and future. Chin J Tissue Eng Res. 2018;22:3431.
10. Aly RM. Current state of stem cell-based therapies: an overview. Stem Cell Investig. 2020;7:8. doi:10.21037/sci-2020-001
11. Chari S, Nguyen A, Saxe J. Stem cells in the clinic. Cell Stem Cell. 2018;22:781782. doi:10.1016/j.stem.2018.05.017
12. De Luca M, Aiuti A, Cossu G, Parmar M, Pellegrini G, Robey PG. Advances in stem cell research and therapeutic development. Nat Cell Biol. 2019;21:801811. doi:10.1038/s41556-019-0344-z
13. Hipp J, Atala A. Sources of stem cells for regenerative medicine. Stem Cell Rev. 2008;4:311. doi:10.1007/s12015-008-9010-8
14. Bobba S, Di Girolamo N, Munsie M, et al. The current state of stem cell therapy for ocular disease. Exp Eye Res. 2018;177:6575. doi:10.1016/j.exer.2018.07.019
15. Khalid K, Padda J, Fernando RW, et al. Stem cell therapy and its significance in HIV infection. Cureus. 2021;13. doi: 10.1038/d41586-019-00798-3
16. Gq D, Morrell CN, Tarango C. Stem cells: roadmap to the clinic. J Clin Invest. 2010;121:120. doi:10.1172/JCI39828
17. Prentice DA. Adult Stem Cells. Circ Res. 2019;124:837839. doi:10.1161/CIRCRESAHA.118.313664
18. McKee C, Chaudhry GR. Advances and challenges in stem cell culture. Colloids Surf B Biointerfaces. 2017;159:6277. doi:10.1016/j.colsurfb.2017.07.051
19. Prez Lpez S, Otero Hernndez J. Advances in stem cell therapy. In: Lpez-Larrea C, Lpez-Vzquez A, Surez-lvarez B, editors. Stem Cell Transplantation. New York, NY: Springer US; 2012:290313.
20. Zhang F-Q, Jiang J-L, Zhang J-T, Niu H, X-Q F, Zeng -L-L. Current status and future prospects of stem cell therapy in Alzheimers disease. Neural Regen Res. 2020;15:242250. doi:10.4103/1673-5374.265544
21. Hu L, Zhao B, Wang S. Stem-cell therapy advances in China. Hum Gene Ther. 2018;29:188196. doi:10.1089/hum.2017.224
22. Tadlock D Stem cell basics introduction; 19.
23. Poulos J. The limited application of stem cells in medicine: a review. Stem Cell Res Ther. 2018;9:1. doi:10.1186/s13287-017-0735-7
24. Madl CM, Heilshorn SC, Blau HM. Bioengineering strategies to accelerate stem cell therapeutics. Nature. 2018;557:335342. doi:10.1038/s41586-018-0089-z
See the rest here:
PROMISING STEM CELL THERAPY IN THE MANAGEMENT OF HIV & AIDS | BTT - Dove Medical Press
Mesenchymal Stem Cells Market Size is Projected to Reach at USD 2600.5 Million by 2027 at a CAGR of 7.1%, Driven by Rising Prevalence of Hepatitis…
Global Mesenchymal Stem Cells Market Size is expected to be worth USD 2,600.5 million by 2027, with a CAGR of 7.1% over the forecasting years, according to Acumen Research & Consulting
The development of stem cell therapies to address serious medical conditions has significantly increased in recent years. In this regard, consistent advancement in the environment of stem cell treatments is expected to drive tremendous attention in the mesenchymal stem cells market. The market for mesenchymal stem cells is expected to increase dramatically in the future years. Extensive Research and development activities based on mesenchymal stem cells are propelling the markets rapid potential expansion. These cells are also being employed increasingly frequently in tissue engineering. As a result of many factors, the global mesenchymal stem cells market is expected to see new demand possibilities in the coming years.
Mesenchymal stem cells (MSCs) are multipotent stem cells, which can capable of converting into a variety of cellular structures such as adipocytes, chondrocytes, osteoblasts, and myocytes. MSCs have the ability to drastically alter their environment, demonstrating anti-fibrotic and anti-inflammatory properties while secreting chemicals that enhance the tissue healing. MSCs are advantageous to other stem cell technologies for a number of purposes, especially its immune-privileged status, which makes them a suitable cell type for allogenic transplantation. Moreover, mesenchymal stem cells (MSCs) comprise intimal cells that have the ability to self-renew and develop into a variety of lineages. It can be isolated from a variety of tissues, including endometrial polyps, bone marrow, menstrual blood, adipose tissue, and the umbilical cord. It is the most commonly used cell type in regenerative medicine to address neurological issues, diabetes, heart ischemia, and musculoskeletal and cartilage disorders.
Get Free Sample Report Copy : https://www.acumenresearchandconsulting.com/request-sample/2629
Global Mesenchymal Stem Cells Market Dynamics
The increasing utilization of mesenchymal stem cells (MSCs) in the aged population for the treatment of different diseases and disabilities is favorably impacting the global mesenchymal stem cell market size. The increasing medicinal evaluation of mesenchymal stem cells for the dealing of various illness, including musculoskeletal and cartilage disorders, and autoimmune problems, is expected to drive the global mesenchymal stem cells market growth. As per the investigation, these stem cells promote angiogenesis in the heart and help to reduce chronic inflammation. Pre-clinical investigations for employing mesenchymal stem cells to address cardiovascular disorders, liver ailments, and tumors are expected to open up overseas customers for the mesenchymal stem cells market trend. Furthermore, due to the regenerative potential, ease of separation, and immunoregulatory features of these stem cells, mesenchymal stem cell therapy has emerged as a feasible technique for the treatment of inflammatory, chronic, degenerative, and autoimmune diseases.
Rising Drug Discovery and Development activities around the globe are Fueling the Market Growth
Stem cell biology is a rapidly expanding field of study that has made substantial contributions to a wide range of scientific disciplines, including tissue regeneration and cell therapy treatment. In recent years, one of the most promising applications of mesenchymal stem cell biology has been drug discovery and development. Stem cells are quickly being exploited in creative ways to improve medication research, with applications ranging from academic circles to biotechnological start-ups to major pharmaceutical companies. Mesenchymal stem cells (MSCs) have the potential to be a valuable tool in drug discovery and development, as indicated by their ability to impact immune system response.
Report Customization: https://www.acumenresearchandconsulting.com/request-customization/2629
Market Segmentation
According to Acumen Research and Consulting, the global mesenchymal stem cells industry is fragmented into application, and product type. By application, the segment has been classified into myocardial and cardiovascular infarction, drug discovery and development, injuries, and others. By product type, the segment is further segmented into rat, mouse, human, and others.
Mesenchymal Stem Cells Market Regional Overview
The mesenchymal stem cells industry is divided into five regions including Asia-Pacific, Europe, North America, Latin America, as well as the Middle East and Africa. According to the mesenchymal stent cells market forecast, the North American region is expected to gain a significant market share in the coming periods. Increased utilization for clinical trials, medication research, and development, as well as the safety and efficacy of mesenchymal stem cells for chronic conditions, are driving market expansion in North America. Furthermore, organizations are concentrating on monetizing mesenchymal stem cells and delivering them to successful disease recovery treatment. This crucial element will continue to drive market expansion in North America over the anticipated timeframe.
Furthermore, the Asia-Pacific region is expected to experience considerable growth in the global market. Factors contributing to the regions growth include increased use of stem cell treatments as a result of consumers low expendable income and limited financial assistance for high-end procedures, which is expected to raise the use of mesenchymal stem cells technologies throughout the projected timeframe.
Get Premium Report Copy For This : https://www.acumenresearchandconsulting.com/buy-now/0/2629
Mesenchymal Stem Cells Market Players
Some of the significant mesenchymal stem cells market companies are R&D Systems, Inc., Axol Bioscience, Cytori Therapeutics, Inc., BrainStorm Cell Therapeutics Inc., Stemedica Cell Technologies, Inc., Cell Applications, Inc., Cyagen Biosciences, STEMCELL Technologies Inc., and Celprogen, Inc.
About Acumen:
Acumen Research and Consulting is a global provider of market intelligence and consulting services to information technology, investment, telecommunication, manufacturing, and consumer technology markets. ARC helps investment communities, IT professionals, and business executives to make fact based decisions on technology purchases and develop firm growth strategies to sustain market competition. With the team size of 100+ Analysts and collective industry experience of more than 200 years, Acumen Research and Consulting assures to deliver a combination of industry knowledge along with global and country level expertise.
Contact Us:
Mr. Frank WilsonAcumen Research and ConsultingUSA: +13474743864India: +918983225533E-mail:[emailprotected]
Bone Marrow Market Global Projection By Key Players AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc Analysis and Forecast to 2028 …
This bone marrow market report provides details of new recent developments, trade regulations, import export analysis, production analysis, value chain optimization, market share, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, strategic market growth analysis, market size, category market growths, application niches and dominance, product approvals, product launches, geographic expansions, technological innovations in the market. To gain more info on the bone marrow market contact Data Bridge Market Research for anAnalyst Brief,our team will help you take an informed market decision to achieve market growth.
The bone marrow market is expected to gain market growth in the forecast period of 2021 to 2028. Data Bridge Market Research analyses that the market is growing with the CAGR of 5.22% in the forecast period of 2021 to 2028 and is estimated to reach 13,899.60 USD Million by 2028. The growing amount of bone marrow diseases will help in escalating the growth of the bone marrow market. Bone marrow transplant also referred to as hematopoietic stem cell. It is a soft vascular tissue present in the interior of long bones. It comprises of two types of stem cells, that are hematopoietic and mesenchymal stem cells. Bone marrow is mainly responsible for the haematopoiesis, (formation of blood cells), production of lymphocytes, and the storage of fats. The bone marrow transplant is the last alternative generally recommended by the physicians in the cases of fatal bone marrow diseases and bone or skin cancer.
Get a Sample PDF of the report https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-bone-marrow-market
Major factors that are boosting the growth of the bone marrow market in the forecast period are the growing of the incidences of non-Hodgkin and Hodgkin lymphoma, thalassemia, and leukemia, along with the common bone marrow diseases around the world, the developments in the technology and the enhancing of the healthcare infrastructure. Furthermore, the advancing signs of bone marrow transplant for heart and neuronal disorders, increasing funding in the logistic services and the growing per capita of the healthcare expenses are some of the other factors anticipated to further propel the growth of the bone marrow market in the coming years. However, the high expenditure for the treatment, shortage of the bone marrow donors and instability of the repayment are few of the factors further responsible for the impeding the growth of the bone marrow market in the near future.
Bone MarrowMarket Scope and Market Size
The bone marrow market is segmented on the basis of transplantation type, disease indication and end user. The growth amongst these segments will help you analyse meagre growth segments in the industries, and provide the users with valuable market overview and market insights to help them in making strategic decisions for identification of core market applications.
To Gain More Insights into the Market Analysis, Browse Summary of the Research Report@ https://www.databridgemarketresearch.com/reports/global-bone-marrow-market
Bone MarrowMarket Country Level Analysis
The bone marrow market is analysed and market size insights and trends are provided by country, transplantation type, disease indication and end user as referenced above. The countries covered in the bone marrow market report are the U.S., Canada and Mexico in North America, Germany, France, U.K., Netherlands, Switzerland, Belgium, Russia, Italy, Spain, Turkey, Rest of Europe in Europe, China, Japan, India, South Korea, Singapore, Malaysia, Australia, Thailand, Indonesia, Philippines, Rest of Asia-Pacific (APAC) in the Asia-Pacific (APAC), Saudi Arabia, U.A.E, South Africa, Egypt, Israel, Rest of Middle East and Africa (MEA) as a part of Middle East and Africa (MEA), Brazil, Argentina and Rest of South America as part of South America.
Europe dominates the bone marrow market because of the occurrence of the increasing number of innovative healthcare centers. Furthermore, the healthcare systems have introduced the bone marrow transplant in their contributions and the state-of-the-art public facilities which will further boost the growth of the bone marrow market in the region during the forecast period. North America is projected to observe significant amount of growth in the bone marrow market because of the growing cases of chronic diseases such as blood cancer. Moreover, the increasing of the geriatric population is one of the factors anticipated to propel the growth of the bone marrow market in the region in the coming years.
The country section of the bone marrow market report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as consumption volumes, production sites and volumes, import export analysis, price trend analysis, cost of raw materials, down-stream and upstream value chain analysis are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of domestic tariffs and trade routes are considered while providing forecast analysis of the country data.
Competitive Landscape and Bone MarrowMarket Share Analysis
The bone marrow market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, production capacities, company strengths and weaknesses, product launch, product width and breadth, application dominance. The above data points provided are only related to the companies focus related to bone marrow market.
The major players covered in the bone marrow market report are AGendia, Agilent Technologies, Inc., Ambrilia Biopharma Inc., Astellas Pharma Inc., diaDexus, Illumina, Inc., QIAGEN, F Hoffmann-La Roche Ltd, Sanofi, Stryker Corporation, PromoCell GmbH, STEMCELL Technologies Inc., Lonza, ReachBio LLC, AllCells, ATCC, Lifeline Cell Technology., Conversant bio, HemaCare, Mesoblast Ltd., Merck KGaA, Discovery Life Sciences., ReeLabs Pvt. Ltd., Gamida Cell, among other domestic and global players. Market share data is available for global, North America, Europe, Asia-Pacific (APAC), Middle East and Africa (MEA) and South America separately. DBMR analysts understand competitive strengths and provide competitive analysis for each competitor separately.
Browse the complete table of contents at https://www.databridgemarketresearch.com/toc/?dbmr=global-bone-marrow-market
Related Reports:
Allogenic Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-allogenic-stem-cell-therapy-market
Cancer Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-cancer-stem-cell-therapy-market
North America Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/north-america-stem-cell-therapy-market
Europe Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/europe-stem-cell-therapy-market
Asia-Pacific Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/asia-pacific-stem-cell-therapy-market
Middle East and Africa Stem Cell Therapy Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/middle-east-and-africa-stem-cell-therapy-market
Asia-Pacific Drug-Device Combination Market Size, Shares, Trends and Industry Growth Outlook https://www.databridgemarketresearch.com/reports/global-drug-device-combination-market
About Data Bridge Market Research:
An absolute way to forecast what future holds is to comprehend the trend today! Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavours to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process. Data Bridge is an aftermath of sheer wisdom and experience which was formulated and framed in the year 2015 in Pune.
Data Bridge Market Research has over 500 analysts working in different industries. We have catered more than 40% of the fortune 500 companies globally and have a network of more than 5000+ clientele around the globe. Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude. We are content with our glorious 99.9 % client satisfying rate.
Contact Us:-
Data Bridge Market Research
US: +1 888 387 2818
UK: +44 208 089 1725
Hong Kong: +852 8192 7475
Smooth muscle protein 22-Cre recombination in resting cardiac fibroblasts and hematopoietic precursors | Scientific Reports – Nature.com
Animals
All animal experiments were performed in accordance with the institutional guidelines of the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University (Kyoto, Japan), and all experimental protocols were approved by the same institute. The reporting in this manuscript followed the recommendations in the ARRIVE guidelines. For euthanasia, mice were intraperitoneally administrated with a mixture of Medetomidine (0.3mg/kg body weight), Midazolam (4mg/kg body weight), and Butorphanol (5mg/kg body weight). SM22-Cre mice(Tg (Tagln-cre)1Her/J, Stock# 004746) and dual fluorescent membrane-localized tdTomato/eGFP (mT/mG) mice (B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato, -EGFP)Luo/J, Stock# 007676) were purchased from the Jackson Laboratory. SM22 -Cre mice were bred with flox mT/mG mice to produce mT/mGflox/wt: SM22-Cre+(SM22mT/mG) mice. For embryos, SM22 -Cre mice were paired overnight with flox mT/mG mice. The morning after mating was considered 0.5days post-coitus (dpc).
Male and female SM22mT/mG mice, 610weeks of age, were used as the cell source. CFs were isolated as described previously26. Media and buffers were prepared according to a previous paper26. The descending aortas and inferior venae cavae were cut. The hearts were perfused with EDTA buffer from the right ventricle. The ascending aortas were clamped. The clamped hearts were removed, transferred to a dish containing EDTA buffer, and perfused with EDTA buffer from the left ventricle (LV). The hearts were transferred to a dish of perfusion buffer, and perfused with perfusion buffer from the LV. The hearts were transferred to a dish of collagenase buffer and perfused with collagenase buffer from the LV. The ventricles were transferred to the other dish of collagenase buffer, gently teased apart into pieces, and triturated. Stop solution was added to the cell-tissue cell suspension. The supernatants obtained via gravity settling three times for 10min in perfusion buffer were collected as nonCMs. The nonCMs were centrifuged at 300g for 5min, resuspended in DMEM containing 10% fetal bovine serum (FBS) and penicillinstreptomycin (Wako, #168-23191), plated on cell culture dishes and cultured for 67days. Almost all cells were fibroblasts after the culture.
Bone marrow was extracted from the femurs and tibias of euthanized mice and differentiated in bone marrow macrophage differentiation media (RPMI 1640 containing 10% fetal bovine serum (FBS), penicillinstreptomycin, 20g/mL recombinant mouse M-CSF (Biolegend, #576404), and 0.1mM/L 2-mercaptoethanol (Wako, #133-14571)). Seven days after being harvested, BMDMs were stimulated with recombinant mouse TGF-1 (Biolegend, # 763102) for 1 or 7days, for RNA or for Flow cytometric analysis, respectively. To investigate whether Cre-recombination occurs during the differentiation process from HSCs to BMDMs, bone marrow cells were harvested and cultured in bone marrow macrophage differentiation media containing with TGF-.
Hearts in 6-week-old mice were perfused with cold phosphate-buffered saline (PBS) and 4% paraformaldehyde, removed, and fixed with 4% paraformaldehyde (PFA) for 3h. The hearts of Embryos at 17.5 dpc were removed, washed with cold PBS and fixed with 4% PFA for 3h. The hearts were incubated in 10%, 20% and 30% sucrose diluted in PBS. The samples were then embedded in OCT compound (Sakura Finetek Japan), frozen and stored at 80. Cryosections (8m thick) were obtained using a Leica cryostat.
For immunofluorescence analysis, sections were first washed with PBS, permeabilized with PBS containing 0.1% Triton-X, and washed with PBS containing 0.1% Tween 20. The sections were then incubated in blocking buffer (PBS containing, 0.1% Tween 20, 1% BSA, and 10% normal donkey serum (Jackson ImmunoResearch, #017-000-121)) for 1h at room temperature. Primary antibodies diluted in blocking buffer were added and incubated overnight at 4. The following primary antibodies were used: anti-SMA (1:100) (Goat, Novus Biologicals, #NB300-978), anti-Vimentin (1:100) (rabbit, Cell Signaling Technology, #5741S), anti-CD68 (1:200) (rat, Bio Rad, #MCA1957GA), and anti-CD31 (1:100) (rabbit, Novus Biologicals, # NB100-2284). Then, the slides were washed three times in PBS containing 0.1% Tween 20 for 5min each, and incubated with Alexa Fluor 647 (ThermoFisher, #A-31573 or Abcam, #ab150155) or Alexa Fluor Plus 680 (ThermoFisher, #A32860) against the appropriate species (diluted at 1:500) for 1h at room temperature. The slides were washed three times in cold PBS for 5min each. Finally, the slides were mounted with VECTASHIELD Antifade Mounting Medium with DAPI (Vector Laboratories, #H-1200-10).
Immunofluorescence images were acquired on an Axio Observer (Carl Zeiss) (5objective) or SP8 Falcon (Leica) (63objective) and analyzed with Zen software (Carl Zeiss) or LAS X (Leica), respectively.
Single cardiac cell suspensions were generated as described previously27. Hearts were perfused with cold PBS and finely minced and digested in Hanks Balanced Salt Solution (HBSS) with Collagenase 2 (500 U/ml) (Worthington Biochemical, #LS004176) for 30min at 37C. Next, the hearts were digested in HBSS with Collagenase/Dispase (1mg/mL) (Merck, #11097113001) for 20min at 37C. To deactivate the enzymes, the samples were washed with cold HBSS. The solutions were passed through a 40m cell strainer (Corning, #352340). Red blood cell lysis was performed with ACK lysis buffer (0.16M ammonium chloride, 10mM Potassium bicarbonate and 0.1mM EDTA). The samples were washed with FACS buffer (HBSS with 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 2% FBS and 2mM ethylenediaminetetraacetic acid (EDTA)) and resuspended in 300 L of FACS buffer. Heart samples were blocked with TruStain FcX Plus (0.5 L/100 L) (Biolegend, #156604) for 5min at 4.
Peripheral blood samples were collected from the inferior vena cava of anesthetized mice using a heparin-contained syringe. Red blood cell lysis was performed with ACK lysis buffer. The samples were washed with FACS buffer and resuspended. Peripheral blood samples were blocked with TruStain FcX Plus for 5min at 4.
Bone marrow cells were obtained by flushing femurs and tibias with RPMI supplemented with 25mM HEPES and 10% FBS. The suspensions were passed through a 40m cell strainer. After the red blood cells were lysed, the samples were washed with FACS buffer and resuspended.
BMDMs were collected after harvesting as described before and were blocked with TruStain FcX Plus for 5min at 4.
Cells were stained with monoclonal antibodies at 4C for 20min in the dark. The samples were washed twice, and the final resuspension was made in 500 L of FACS buffer. 7-AAD was used to exclude dead cells. Flow cytometric analysis was performed on BD FACS ARIAII platforms. Complete lists of antibodies and flow cytometry gating strategies are provided in Supplementary Tables 1 and 2, respectively.
Total RNA was isolated and purified using TRIzol reagent (ThermoFisher), and cDNA was synthesized using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, #FSQ-301) in accordance with the manufacturer's instructions. For quantitative real-time PCR (qRTPCR), specific genes were amplified using 40 cycles with Thunderbird SYBR qPCR mix (Toyobo, #QPS-201) and StepOnePlus (ThermoFisher). Expression was normalized to the housekeeping gene18rS. Gene-specific primers are described as follows:
18rS forward, CTCAACACGGGAAACCTCAC; 18rS reverse, AGACAAATCGCTCCACCAAC; Tagln forward, CAACAAGGGTCCATCCTACGG; Tagln reverse, ATCTGGGCGGCCTACATCA; Acta2 forward, TGACGCTGAAGTATCCGATAGA; Acta2 reverse, CGAAGCTCGTTATAGAAAGAGTGG; Col1a1 forward, AATGGCACGGCTGTGTGCGA; and Col1a1 reverse, AACGGGTCCCCTTGGGCCTT.
For the Flow cytometric analysis, the lines represent the means and standard error of the samples. Differences between two groups were compared by Students t test as a parametric comparison test. For the RTPCR experiments, one-way ANOVA followed by Tukeys test was performed for multiple comparisons. The bars represent mean of the samples. The analysis and plots were generated using the ggplot2 package and R software. A P value<0.05 was considered statistically significant.
Growing Prevalence & Recurrence Of Rheumatoid Arthritis Is Expected To Growth Of The Rheumatoid Arthritis Stem Cell Therapy Market Designer Women…
The Global Rheumatoid Arthritis Stem Cell Therapy Market is replete with new growth opportunities and expansion avenues. There has been an increase in the use of products and services falling under the ambit of Rheumatoid Arthritis Stem Cell Therapy, giving a thrust to the growth of the global Rheumatoid Arthritis Stem Cell Therapy market. The unprecedented use of these products can be attributed to the increasing paying capacity of the masses.
Furthermore, in the absence of robust or utilitarian alternatives, the demand within the global Rheumatoid Arthritis Stem Cell Therapy market is projected to reach new heights of recognition. It is worthwhile to mention that the global Rheumatoid Arthritis Stem Cell Therapy market is treading along a lucrative pathway due to favorable government legislations.
To get in-depth insights Request for Brochure here https://www.factmr.com/connectus/sample?flag=B&rep_id=1001
The COVID-19 pandemic has changed narratives related to growth and expansion across several key industries. Therefore, the Rheumatoid Arthritis Stem Cell Therapy market is also battling the cons of supply chain disruptions and procurement issues. Over the course of the next quarter, market players could be investing in new technologies to recover from the shocks of the pandemic.
The global market for rheumatoid arthritis stem cell therapy is highly fragmented. Examples of some of the key players operating in the global rheumatoid arthritis stem cell therapy market include Mesoblast Ltd., Roslin Cells, Regeneus Ltd, ReNeuron Group plc, International Stem Cell Corporation, TiGenix and others.
Through the latest research report on Rheumatoid Arthritis Stem Cell Therapy market, the readers get insights on:
Share Your Requirements & Get Customized Reports: https://www.factmr.com/connectus/sample?flag=RC&rep_id=1001
Tentatively, the global rheumatoid arthritis stem cell therapy market can be segmented on the basis of treatment type, application, end-user, and geography.
Based on treatment type, the global rheumatoid arthritis stem cell therapy market can be segmented into:
Based on application, the global rheumatoid arthritis stem cell therapy market can be segmented into:
Based on the distribution channel, the global rheumatoid arthritis stem cell therapy market can be segmented into:
Based on geography, the global rheumatoid arthritis stem cell therapy market can be segmented into:
The study further identifies major manufacturing trends, technologies that will be commercialized
Reasons to choose a Fact.MR:
For In-depth Analysis & Business Strategy, Buy a Copy of this Report: https://www.factmr.com/checkout/1001
About Fact. MR
Market research and consulting agency with a difference! Thats why 80% of Fortune 1,000 companies trust us for making their most critical decisions. We have offices in US and Dublin, whereas our global headquarter is in Dubai. While our experienced consultants employ the latest technologies to extract hard-to-find insights, we believe our USP is the trust clients have in our expertise. Spanning a wide range from automotive & industry 4.0 to healthcare & retail, our coverage is expansive, but we ensure even the most niche categories are analyzed. Reach out to us with your goals, and well be an able research partner.
Contact:US Sales Office :11140 Rockville PikeSuite 400Rockville, MD 20852United StatesTel: +1 (628) 251-1583E-Mail:sales@factmr.com
Corporate Headquarter:Unit No: AU-01-H Gold Tower (AU),Plot No: JLT-PH1-I3A,Jumeirah Lakes Towers,Dubai, United Arab Emirates