Archive for January, 2020
Decibel Therapeutics Announces Strategic Research Focus on Regenerative Medicine for the Inner Ear – Yahoo Finance
Company signs option agreement with The Rockefeller University to access intellectual property covering compounds targeting key regeneration pathway
Decibel Therapeutics, a development-stage biotechnology company developing novel therapeutics for hearing loss and balance disorders, today announced a new strategic research focus on regenerative medicine approaches for the inner ear. The company is also announcing a collaboration and option agreement that gives Decibel exclusive access to novel compounds targeting proteins in a critical regenerative pathway.
Decibels research focus on regeneration will be powered by the companys research and translation platform. The company has built one of the most sophisticated single cell genomics and bioinformatics platforms in the industry to identify and validate targets. Decibel has also developed unique insights into regulatory pathways and inner ear delivery mechanisms that together enable precise control over gene expression in the inner ear and differentiate its AAV-based gene therapy programs.
"Our deep understanding of the biology of the inner ear and our advanced technological capabilities come together to create a powerful platform for regenerative medicine therapies for hearing and balance disorders," said Laurence Reid, Ph.D., acting CEO of Decibel. "We see an exciting opportunity to leverage this platform to address a broad range of hearing and balance disorders that severely compromise quality of life for hundreds of millions of people around the world."
The first program in Decibels regeneration portfolio aims to restore balance function using an AAV-based gene therapy (DB-201), which utilizes a cell-specific promoter to selectively deliver a regeneration-promoting gene to target cells. In collaboration with Regeneron Pharmaceuticals, Decibel will initially evaluate DB-201 as a treatment for bilateral vestibulopathy, a debilitating condition that significantly impairs balance, mobility, and stability of vision. Ultimately, this program may have applicability in a broad range of age-related balance disorders. There are currently no approved medicines to restore balance. Decibel expects to initiate IND-enabling experiments for this program in the first half of 2020.
Decibel is also pursuing novel targets for the regeneration of critical cells in both the vestibule and cochlea of the inner ear; these targets may be addressable by gene therapy or other therapeutic modalities. As a key component of that program, Decibel today announced an exclusive worldwide option agreement with The Rockefeller University, which has discovered a novel series of small-molecule LATS inhibitors. LATS kinases are a core component of the Hippo signaling pathway, which plays a key role in regulating both tissue regeneration and the proliferation of cells in the inner ear that are crucial to hearing and balance. The agreement gives Decibel an exclusive option to license this series of compounds across all therapeutic areas.
The agreement also establishes a research collaboration between Decibel and A. James Hudspeth, M.D., Ph.D., the F.M. Kirby Professor at The Rockefeller University and the director of the F.M. Kirby Center for Sensory Neuroscience. Dr. Hudspeth is a world-renowned neuroscientist, a member of the National Academy of Sciences and the American Academy of Arts and Sciences, and a Howard Hughes Medical Institute investigator. Dr. Hudspeth has been the recipient of numerous prestigious awards, including the 2018 Kavli Prize in Neuroscience.
"Rockefeller scientists are at the leading edge of discovery, and we are excited to see the work of Dr. Hudspeth move forward in partnership with Decibel," said Jeanne Farrell, Ph.D., associate vice president for technology advancement at The Rockefeller University. "The ambitious pursuit of harnessing the power of regenerative medicine to create a new option for patients with hearing loss could transform how we address this unmet medical need in the future."
In parallel with its new research focus on regenerative strategies, Decibel will continue to advance key priority preclinical and clinical programs. DB-020, the companys clinical-stage candidate designed to prevent hearing damage in people receiving cisplatin chemotherapy, is in an ongoing Phase 1b trial. Decibel will also continue to progress DB-OTO, a gene therapy for the treatment of genetic congenital deafness, which is being developed in partnership with Regeneron Pharmaceuticals. The DB-OTO program aims to restore hearing to people born with profound hearing loss due to a mutation in the otoferlin gene and is expected to progress to clinical trials in 2021.
Story continues
To support the new research focus, Decibel is restructuring its employee base and discontinuing some early-stage discovery programs.
About Decibel Therapeutics, Inc.Decibel Therapeutics, a development-stage biotechnology company, has established the worlds first comprehensive drug discovery, development, and translational research platform for hearing loss and balance disorders. Decibel is advancing a portfolio of discovery-stage programs aimed at restoring hearing and balance function to further our vision of a world in which the benefits and joys of hearing are available to all. Decibels lead therapeutic candidate, DB-020, is being investigated for the prevention of ototoxicity associated with cisplatin chemotherapy. For more information about Decibel Therapeutics, please visit decibeltx.com or follow @DecibelTx.
View source version on businesswire.com: https://www.businesswire.com/news/home/20200129005162/en/
Contacts
Matthew Corcoran, Ten Bridge Communicationsmcorcoran@tenbridgecommunications.com (617) 866-7350
Follow this link:
Decibel Therapeutics Announces Strategic Research Focus on Regenerative Medicine for the Inner Ear - Yahoo Finance
Makers of novel cell/gene therapy say off-the-shelf approach only way to solve pricing woes – MedCity News
Innovative treatments have turned the tables somewhat in the battle against cancer but one stumbling block appears to be pricing. CAR-T cell therapy can cost more than $1.5 million including the $475,000 cost of the drug (in this case, Kymriah from Novartis).
We are seeing that price is becoming a barrier because if you can imagine, hundreds of thousands of people all suddenly becoming eligible for CAR-T, there isnt enough money in the healthcare system to pay for that, said Paul Wotton, CEO of Obsidian Therapeutics, based in Cambridge, Massachusetts.
In a recent interview in San Francisco, Wotton and another biopharma executive pointed to a solution to the price conundrum: an off-the-shelf approach.
To clarify, to date the approved CAR-T therapies involve cells from the patients own body that are re-engineered and placed back into the body in order to overpower and kill the cancerous growth. While revolutionary, this is not only a cumbrous process but also expensive.
Now, some companies are going the route of using donor cells to develop their own treatment regimens. These are known as allogeneic therapies.
Wugen Therapeutics is one such company that is taking an allogeneic approach to CAR-T therapy. Based in St. Louis Missouri with technology developed out of Washington University, the company targets T-cell malignancies in leukemia and lymphoma, said Ayman Kabakibi, vice president of research and development. In a recent interview, he explained that so far CAR-T therapies have focused on B-cell malignancies because it is less difficult to target B-cell malignancies with a T-cell.
The reason is that if you go back to the basics of CAR-T you are trying to put a receptor (CAR) on the normal T-cell to allow it to recognize another antigen or marker on the tumor cell and when that interaction happens, two things happen the T-cell will proliferate and make more daughter cells and thats why we call it a living drug, Kabakibi explained. And the other thing that happens is that it secretes toxins that kill the tumor cells. Well, you can do that more easily for B cells because the antigens are not shared between the two.
But at Wugen, the company is using re-engineeerd normal T-cells to target cancerous T-cells and certain adjustments need to be made so that the cells dont end up killing each other.
So what we do is that we take the T-cells and we remove the antigen that we are targeting on the cancer cell using CRISPR CAS technology, he said. We take T-cells from a normal person. We eliminate that marker and then we put another gene to make it stress the receptor that it will recognize.
Why not take T-cells from the patients own body?
One reason is that in many cases by the time patients land on CAR-T therapy, they may have already undergone several rounds of other treatments that may have compromised the health of a normal T-cell.
Because the patient has had so many chemotherapies the chances of getting a healthy T-cell are actually pretty low, he said. There are 20-30 percent of patients that go for CAR-T therapy and they get into the clinic and get their blood taken out and then it takes six weeks to generate autologous CAR-T therapy but they cant do it because theres not enough starting material, not enough healthy cells.
This approach of using donor T-cells gets around this problem but Kabakibi believes that it also solves the problem of the skyrocketing cost of CAR-T therapies.
You dont get the economies of scale [with CAR-T using autologous approach,] he said. Thats why you have to be able to generate hundreds of doses and not from the patient, but from a normal patient. You need an off-the-shelf, allogenic version. You take the cells from a normal person and generate a hundred vials that could be shipped overnight to a patient and then that person can be treated in a few days.
Wotton, the CEO of Obsidian Therapeutics, echoed Kabakibi.
You have to find a way to drive down that cost of goods. The way science is going to address that I think is to have off-the-shelf approaches where you can grow billions of cells from a single cell, engineer it to be able to get it to all of us to treat whatever it is we are suffering from, Wotton said. It is much better to build that scale of manufacturing rather than on a patient by patient basis.
Obsidian Therapeutics has developed what it calls destabilizing domain technology to be able to more precisely dose cell and gene therapies.
We are pioneering controllable cell and gene therapies using technology that came out of Stanford University, Wotton said. So in a nutshell, if you give somebody gene therapy today, to produce a particular protein in the body you actually have no idea how much of that protein is going to express. And the same in the case of a CAR-T cell to patients, you actually dont know how many of those cells are going to survive, how quickly they are going to proliferate so being able to dose cell and gene therapies in the same way you can dose a small molecule would be extremely useful.
Obsidianhas a partnership with Celgene through which Celgene can in-license global rights to cell therapy product candidates developed by Obsidian that incorporate destabilizing domain-regulated interleukin 12 or CD40L to fight cancer. Obdisial is using an allogeneic approach.
Our goal in life is to turn cell therapy into the first line of treatment instead of the last line of treatment, Wotton said. The only way you are going to be able to do that is to provide a cell therapeutic that is off-the-shelf, readily available and easy for patients to access, which is actually the approach that we are trying to take.
However, he added that there has to be a balance between cost and value when it comes to novel treatment.
Kabakibi of Wugen Therapeutics agreed.
If you are generating a 100 vials of CAR-T cells, is the price going to drop by 100 percent? Unlikely, he said. I think some therapies will never be as inexpensive as a pill.
Photo: champc, Getty Images
The FDA Is Approving Drugs Faster, But That May Not Be A Good Thing – PharmaLive
In a second research report published this year so far, investigators found that the U.S. Food and Drug Administration (FDA) is approving drugs faster than ever. Unfortunately, it appears that the agency is also approving those drugs on less data and weaker evidence.
The first studypublishedin the journal SSRN was by researchers at Harvard University, the University of Texas at Dallas, and the Massachusetts Institute of Technology (MIT).It questioned if the FDA and other regulatory agencies worldwide dont rush certain approvals, particularly at the end of the year in a kind of desk-clearing activity.
The report notes, In the United States, the number of December drug approvals is roughly 80% larger than in any other month. Similar approval spikes occur at the end of each calendar month. Additionally, approvals spike before holidays, such as before Thanksgiving in the United States and the Chinese New Year in China (but not vice versa).
And more troubling is that there appears to be a correlation with more problems with these drugs. Lauren Cohen, a professor of finance and entrepreneurial management at Harvard Business School and one of the authors, told the Wall Street Journal, We see about twice as many adverse effects.
The second study appeared in the journal JAMA Network and was conducted by researchers with Harvard Medical School. The lead author, Jonathan Darrow, a lawyer with the medical schools Program on Regulation, Therapeutics and Law, told NPR, There has been a gradual erosion of the evidence thats required for FDA approval. He points out that patients and physicians should not expect that new drugs will be dramatically better than older ones.
The study notes that about half of recent drug approvals were built on a single pivotal clinical trial. Typically, two pivotal, Phase III trials were the norm. In addition, the study says that surrogate measures, which are utilized as stand-ins for presumed patient benefits, has grown. For example, in oncology drugs, what most patients would want are improvements in survival after receiving treatment. But some cancer trials use a surrogate measure of tumor shrinkage. Ideally, both would be taken into consideration.
Darrow and his research associates studied FDA approvals, changes in the law and regulations, and how the industry funds agency reviews from 1983 through 2018. They found that the average number of new drug approvals annually grew from 34 in the 1990s to 41 in the 2010s. In the 2000s, it dropped to 25 a year. But now they are increasing. For example, in 2019, the FDA approved 48 new molecular entities and new therapeutic biological products. That doesnt include vaccines, allergenic products, blood and blood products, plasma derivatives, cellular and gene therapy products, or the numerous new indications approved for existing therapies.
Darrow, with Jerry Avorn and Aaron S. Kesselheim, both with the Division of Pharmacoepidemiology & Pharmacoeconomics at Brigham & Womens Hospital, found that faster approvals were related to legislative and regulatory modifications that started in the 1980s. Although there are probably several reasons for those changes beginning in that period, much of it is likely related to the beginning of the HIV epidemic and demands from patient populations and advocates to fund more research and get therapiesany therapiesto market faster.
Just some of those regulations include: the 21st Century Cures Act (2016), which authorized funds for the Precision Medicine Initiative and Cancer Moonshot; the Biologics Price Competition and Innovation Act (BPCIA, 2010), creating an abbreviated pathway for follow-on biologic products; Breakthrough Therapy designation (2012), for drugs that showed substantial improvement over existing therapies; the Hatch-Waxman Act (1984), which created an Abbreviated New Drug Application pathway for drugs approved after 1962; and the Pediatric Research Equity Act (2003), which required results from pediatric assessments to be submitted as part of New Drug Applications (NDAs).
Congress also passed the Prescription Drug User Fee Act in 1993, and that first year, FDA collected $29 million in fees. In 2018, the agency brought in $908 million in PDUFA fees. Or, as the study notes, industry fees were responsible for about 80% of the money spent on FDA employee salaries for drug reviews.
There is some concern about the incentives that this created within the FDA, Darrow told NPR. And whether it has created a culture in the FDA where the primary client is no longer viewed as the patient, but as the industry.
Another factor that is related, is the concept of me-too drugs. These are basically drugs that are very structurally similar to approved drugs, with only minor differences. Thats not necessarily a bad thing, because they need to be at least as good as the drugs already on the market, and generally need to be betteralthough not necessarily by much. Which does mean a number of companies spend time on developing drugs that are only incrementally better than others on the market.
Joshua Sharfstein, former FDA Principal Deputy Commissioner, told NPR that there are more changes needed to ensure drugs are worthwhile for patients. Some of them are really great, and some of them [are] not so great. And a lot of them are very expensive.
Sharfstein is currently a professor at the Johns Hopkins Bloomberg School of Public Health. He wrote an editorial in JAMA that accompanied the newer study. In it, he suggests its time to reevaluate the FDAs expedited approval programs to determine which ones are working and which ones are increasing healthcare costs.
Weve kind of reached a point where it makes sense to pause and see whether we can do things better, Sharfstein said. And I think we can.
View post:
The FDA Is Approving Drugs Faster, But That May Not Be A Good Thing - PharmaLive
Repurposed Drug Proves Neuroprotective in Stroke Model – Technology Networks
Stroke is the third leading cause of death and disability in the United States. More than 87 percent are ischemic strokes, caused by obstruction of one or more cerebral arteries. With limited progress in developing treatments, there is a critical need for neuroprotective agents to effectively treat stroke.A study from Florida Atlantic University's Schmidt College of Medicine holds promise for a new way to treat stroke using an already FDA-approved drug granulocyte colony-stimulating factor (GCSF). GCSF enhances blood cellular development and is currently used to treat neutropenia (low white blood cells) caused by chemotherapy and has successfully been used with very few side effects for patients who require bone marrow transplants to stimulate blood cell formation.
The study is the first to report on the neuroprotective effect of GCSF against autophagy and mitochondrial stress in vivo. The data support the hypothesis that GCSF is one of the few growth factors that can reduce infarction by decreasing endoplasmic reticulum (ER) and mitochondrial stress while improving behavioral performance.
Results showed that GCSF improved neurological deficits that occur in the first few days following cerebral ischemia and improved long-term behavioral outcomes while also stimulating a neural progenitor recovery response. Researchers tested behavioral performance on corner and locomotor tests, used as an indicator of brain injury.
Using a mouse model, researchers investigated the efficacy of GCSF beyond the typical four-hour thrombolytic therapy (tPA) clot-busting drug the gold standard to treat stroke for global ischemia. They examined the pro-survival mechanisms of GCSF against apoptosis resulting from autophagy, mitochondrial stress and ER stress.
"In recent years, many studies including ours have shown that as an endogenous growth factor and immune system modulator factor, GCSF is beneficial in models of neurological disorders such as stroke and traumatic brain injury," said Jang-Yen (John) Wu, Ph.D., corresponding author, distinguished professor of biomedical science in FAU's Schmidt College of Medicine, and a member of the FAU Brain Institute (I-BRAIN). "Although the anti-apoptotic activity of GCSF is reported in global cerebral ischemia, this mechanism has not been fully explored."
Researchers used a mechanism-based therapeutic approach for stroke first to examine the connection of mitochondrial, autophagy and ER stress inhibition in the protective action of GCSF and then to analyze relevant ER stress pathways in the bilateral common carotid artery occlusion (BCAO) model of stroke. They confirmed the neuroprotection of GCSF gene therapy in the BCAO mouse stroke model by a decrease of dynamin-related protein (DRP1), a marker of mitochondrial stress, in the frontal and middle brain of the GCSF treated group.
The initial dose of GCSF was administered 24 hours post-BCAO and then followed by a single application of the same dose for another three days for a total of four days of administration. Researchers examined behavior and used immunoblotting to analyze key proteins in ER stress, autophagy and mitochondrial stress-induced apoptosis. BCAO mice receiving GCSF protein showed significantly less asymmetric turning in the corner test than BCAO mice without GCSF. In the behavioral assays, GCSF elicited increased locomotor sensitization verified by greater activity in the locomotor activity test, demonstrating the neuroprotective properties of the drug.
"More than 15 million people worldwide suffer from stroke and our study provides new and important insights into GCSF induced protection as it relates to ER stress and mitochondrial stress activated apoptosis, " said Howard Prentice, Ph.D., corresponding author, a professor of biomedical sciences in FAU's Schmidt College of Medicine, and a member of FAU's I-BRAIN. "Future research will need to focus on uncovering the complete mechanisms by which GCSF retains the ER and mitochondrial homeostasis."
Wu and Prentice have been developing GCSF as a therapeutic method to replenish new brain cells because of its ability to preserve the central nervous system, suppress cell death and at the same time elicit neurogenesis as well as angiogenesis. GCSF works the same way for other neurological diseases such as Parkinson's disease due to its neuroprotective properties.ReferenceModi et al. (2020) Mode of action of granulocyte-colony stimulating factor (G-CSF) as a novel therapy for stroke in a mouse model. Journal of Biomedical Science. DOI: https://doi.org/10.1186/s12929-019-0597-7
This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source.
More:
Repurposed Drug Proves Neuroprotective in Stroke Model - Technology Networks
Protecting against vision loss in multiple sclerosis OT – AOP
A new study by University of Massachusetts scientists has described the molecular process in which synaptic connections in the brain are compromised in multiple sclerosis.
The research, which was published in Immunity, investigates how gene therapy could be used to preserve neural circuits and prevent sight loss.
In experiments in mice, researchers inhibited a protein commonly found in the synapses of patients with multiple sclerosis.
Dr Sebastian Werneberg, from the University of Massachusetts Medical School, highlighted that the protein C3 prompts microglia to attack synapses.
A gene therapy approach was used to deliver a natural inhibitor of C3 to synapses in the visual system while leaving the rest of the brain untouched.
As a result of this inhibition, we saw improved visual function in mice, Dr Werneberg said.
Researchers will next explore how the C3 protein is being produced in multiple sclerosis and other neurodegenerative diseases.
Image credit: Pixabay/PublicDomainPictures
Go here to read the rest:
Protecting against vision loss in multiple sclerosis OT - AOP
Otonomy Presents Preclinical Results for GJB2 Gene Therapy Collaboration and Cisplatin Otoprotection Program – Yahoo Finance
SAN DIEGO, Jan. 28, 2020 (GLOBE NEWSWIRE) -- Otonomy, Inc.(OTIC), a biopharmaceutical company dedicated to the development of innovative therapeutics for neurotology, today announced preclinical results from the companys gene therapy collaboration with Applied Genetic Technologies Corporation (AGTC) focused initially on treating GJB2 deficiency for congenital hearing loss, and preclinical results demonstrating the therapeutic potential of a class of compounds being evaluated for otoprotection against cisplatin-induced hearing loss (CIHL). These results were presented during the ongoing Association for Research in Otolaryngology (ARO) 43rd Annual MidWinter Meeting being held in San Jose, California.
Together with our strategic partner, AGTC, we are encouraged by these initial preclinical results that demonstrate our ability to express a gene of interest in the target cells relevant to the treatment of congenital hearing loss due to GJB2 deficiency," said David A. Weber, Ph.D., president and chief executive officer of Otonomy. Also, the preclinical results presented for our OTO-510 program highlight the therapeutic potential of a novel class of cisplatin-binding molecules for protection against CIHL and the higher potency of these agents versus other molecules currently in clinical development.
Preclinical Results for GJB2 Gene Therapy Collaboration
In October 2019, Otonomy and AGTC announced a strategic collaboration to co-develop and co-commercialize an AAV-based gene therapy to restore hearing in patients with sensorineural hearing loss caused by a mutation in the gap junction protein beta 2 gene (GJB2) -- the most common cause of congenital hearing loss. The joint presentation by Otonomy and AGTC at ARO provided initial demonstration that a gene of interest can be expressed in support cells of the cochlea, which are the relevant target cells for treating GJB2 deficiency, using novel and proprietary AAV capsids. Furthermore, these studies identified several capsids with favorable tropism and gene expression level in support cells compared to previously reported capsids used in the field. Importantly, none of the novel AAV capsids evaluated for further development exhibited signs of cellular toxicity.
Preclinical Results for OTO-510 Otoprotection Program
Cisplatin is a potent chemotherapeutic agent that is widely used to treat a variety of cancers in adults and children. Unfortunately, the administration of cisplatin is commonly associated with severe adverse effects including CIHL that is progressive, bilateral and irreversible. At ARO, Otonomy presented preclinical results demonstrating varying degrees of otoprotection against CIHL for several different classes of therapeutic agents. In particular, a novel proprietary class of agents that potently bind to cisplatin demonstrated greater otoprotection than anti-oxidant and anti-apoptotic molecules, and increased potency relative to other cisplatin-binding molecules currently in clinical development. These results highlight the therapeutic potential of Otonomys novel otoprotectant agents as the basis for the OTO-510 program for CIHL.
About Otonomy
Otonomy is a biopharmaceutical company dedicated to the development of innovative therapeutics for neurotology. The company pioneered the application of drug delivery technology to the ear in order to develop products that achieve sustained drug exposure from a single local administration. This approach is covered by a broad patent estate and is being utilized to develop a pipeline of products addressing important unmet medical needs including Mnires disease, hearing loss, and tinnitus. For additional information please visit http://www.otonomy.com.
Cautionary Note Regarding Forward Looking Statements
This press release contains forward-looking statements within the meaning of the Private Securities Litigation Reform Act of 1995. Forward-looking statements generally relate to future events or the future financial or operating performance of Otonomy. Forward-looking statements in this press release include, but are not limited to expectations regarding the potential benefits, development activity and advancement of preclinical programs; the potential benefits of and activity under the collaboration agreement between AGTC and Otonomy, including but not limited to development activity; and statements by Otonomys president and CEO. Otonomys expectations regarding these matters may not materialize, and actual results in future periods are subject to risks and uncertainties. Actual results may differ materially from those indicated by these forward-looking statements as a result of these risks and uncertainties, including but not limited to: Otonomys limited operating history and its expectation that it will incur significant losses for the foreseeable future; Otonomys ability to accurately forecast financial results; Otonomys ability to obtain additional financing; Otonomys dependence on the regulatory success and advancement of its product candidates; the uncertainties inherent in the clinical drug development process, including, without limitation, Otonomys ability to adequately demonstrate the safety and efficacy of its product candidates, the nonclinical and clinical results for its product candidates, which may not support further development, and challenges related to patient enrollment in clinical trials; Otonomys ability to obtain regulatory approval for its product candidates; the risks of the occurrence of any event, change or other circumstance that could give rise to the termination of the collaboration agreement between AGTC and Otonomy; the risks of the occurrence of any event, change or other circumstance that could impact Otonomys ability to repay or comply with the terms of the loan provided by Oxford Finance LLC; side effects or adverse events associated with Otonomys product candidates; Otonomys ability to successfully commercialize its product candidates, if approved; competition in the biopharmaceutical industry; Otonomys dependence on third parties to conduct nonclinical studies and clinical trials; Otonomys dependence on third parties for the manufacture of its product candidates; Otonomys dependence on a small number of suppliers for raw materials; Otonomys ability to protect its intellectual property related to its product candidates in the United States and throughout the world; expectations regarding potential therapy benefits, market size, opportunity and growth; Otonomys ability to manage operating expenses; implementation of Otonomys business model and strategic plans for its business, products and technology; and other risks. Information regarding the foregoing and additional risks may be found in the section entitled "Risk Factors" in Otonomys Quarterly Report on Form 10-Q filed with the Securities and Exchange Commission (the "SEC") on November 5, 2019, and Otonomys future reports to be filed with the SEC. The forward-looking statements in this press release are based on information available to Otonomy as of the date hereof. Otonomy disclaims any obligation to update any forward-looking statements, except as required by law.
Story continues
See the original post:
Otonomy Presents Preclinical Results for GJB2 Gene Therapy Collaboration and Cisplatin Otoprotection Program - Yahoo Finance
Green Park Collaborative and the National Hemophilia Foundation launch project to develop a PROM to measure mental health outlook – P&T Community
BALTIMORE, Jan. 29, 2020 /PRNewswire/ --Green Park Collaborative (GPC) is partnering with the National Hemophilia Foundation (NHF) to develop a publicly available, patient-reported outcome measure that measures impact on mental health outlook associated with receiving gene therapy for hemophilia A and B.
This project follows work completed in coreHEM, where a multi-stakeholder group achieved consensus on a core outcome set for gene therapy in hemophilia. In coreHEM, a mental health outcome was included, and the proposed definition included elements of psychological and mental health status, and emotional functioning due to the transformational change of a potentially one-time treatment. Because gene therapy will serve as a durable treatment for hemophilia, changes in mental and emotional health are expected. No current measures exist to effectively evaluate this outcome.
"Developing a new instrument to measure the transformative potential of gene therapy on an individual's overall mental health, whether positive or negative, will further enable our understanding of the entire spectrum of functional and social impact of living with hemophilia," stated Mark Skinner, co-investigator of the coreHEM study.
"Mental health in the bleeding disorders community has always been vital to the individuals and families we serve," said Dawn Rotellini, Interim CEO at NHF. "As we move towards enhanced and innovative treatments in hemophilia it will become imperative to measure how the community responds and how NHF can support them. We are excited to continue our partnership with the Green Park Collaborative to better serve the bleeding disorders community."
About Green Park Collaborative (GPC)GPC is a major initiative of CMTP, an independent 501(c)(3) non-profit organization dedicated to improving the quality, relevance, and efficiency of clinical research. GPC is a multi-stakeholder forum for developing condition- and technology-specific study design recommendations to guide the creation of evidence needed to inform both clinical and payment decisions.
About the National Hemophilia Foundation (NHF)The National Hemophilia Foundation (NHF) is a 501(c)(3) non-profit organization dedicated to finding better treatments and cures for inheritable bleeding disorders and to preventing the complications of these disorders through education, advocacy and research. NHF's programs and initiatives are made possible through the generosity of individuals, corporations and foundations, as well as through a cooperative agreement with the Centers for Disease Control and Prevention (CDC).
View original content to download multimedia:http://www.prnewswire.com/news-releases/green-park-collaborative-and-the-national-hemophilia-foundation-launch-project-to-develop-a-prom-to-measure-mental-health-outlook-300995122.html
SOURCE Center for Medical Technology Policy
Read the rest here:
Green Park Collaborative and the National Hemophilia Foundation launch project to develop a PROM to measure mental health outlook - P&T Community
Eyeing a trio of trial initiations, Jim Wilson’s gene therapy startup woos Bruce Goldsmith from Deerfield as CEO – Endpoints News
Passage Bio Jim Wilsons self-described legacy company has wooed a seasoned biotech executive to steer the clinical entry of its first three gene therapy programs.
Bruce Goldsmith jumps to the helm of Passage after a brief CEO stint at Civetta, a cancer-focused startup he helped launch while a venture partner at Deerfield. He takes over from OrbiMed partner and interim chief Stephen Squinto, who will now lead the R&D team.
He joins as the biotech preps IND filings for three lead programs in rare, monogenic diseases of the central nervous system in 2020 the lysosomal storage disorders GM1 gangliasidosis and Krabbe disease, as well as frontotemporal dementia.
Bruce is ideally suited to lead Passage Bio as chief executive officer given his strong neuroscience background coupled with his robust healthcare and biotechnology industry experience, board chairman Tachi Yamada said in a statement.
Passage launched last February with $115 million from a marquee group of Series A investors including Frazier (where Yamada is a partner), OrbiMed, Versant Ventures, New Leaf Venture Partners, Vivo Capital and Lilly Asia Ventures. With an office just a 10-minute walk away from Wilsons lab at the University of Pennsylvania, the company was designed to apply the gene therapy pioneers 35-year experience into cross-correctional therapies for CNS.
According to what he calls the Jim Wilson 90/10 rule, Squinto previously told Endpoints News, AAV vectors can cover and transduce 90% of motor neuron cells but only 10% to 15% of other brain cells making it difficult to go after indications where broad transduction is needed. But it can still prove useful in disorders that result from mutations in enzymes that can be taken up by neighboring cells once secreted normally.
A close pact with Penns Gene Therapy Program and Orphan Disease Center gave Passage rights to five programs right out of the gate, with options to license seven more.
Its a very aggressive clinical development strategy across a multitude of programs, Squinto said as he closed a $110 million Series B in September. Were not gonna rely on any one program to drive the value of Passage, were gonna rely on what is a very very full pipeline of opportunities.
Goldsmith will now lead a team of about 25 to build on preclinical and IND-enabling data from Wilsons lab a company growing exercise he honed as COO of Lycera. There, he was also credited for a number of business development initiatives.
The transition into the clinic would also mean moving production from early facilities at Penn to Paragons GMP sites, and eventually to a customized suite slated for completion in the third quarter of this year.
Squinto, a rare disease expert who devoted much of his career to Alexion, will continue to help oversee all of that as a board director.
Go here to read the rest:
Eyeing a trio of trial initiations, Jim Wilson's gene therapy startup woos Bruce Goldsmith from Deerfield as CEO - Endpoints News
Boost for cell and gene therapy manufacture – Business Weekly
The Cell and Gene Therapy Catapult and the University of Hertfordshire have launched a new course specifically addressing the foreseeable skills gap in the production of cell and gene therapies as they progress towards manufacturing at scale.
Developed in collaboration between the two organisations, this three-day course will provide theoretical and practical training on the aseptic manufacturing of cell and gene therapies in line with European regulatory guidance for good manufacturing practice.
The cell and gene therapy industry in the UK currently supports over 3,000 jobs, a six-fold increase since 2012, and employment in the sector is set to more than double by 2024 as more therapies progress towards commercialisation.
Manufacturing and bioprocessing roles in particular have tripled in the past two years alone, with scientists operating in the 26 cell and gene therapy manufacturing facilities throughout the UK.
Cell and gene therapies are transformative and potentially curative medicines and it is vital that manufacturing processes are safe and efficient whilst preserving the effectiveness of these living medicines.
The new training programme is designed for staff working in cell and gene therapy manufacturing. Delegates will benefit from experience in state-of-the-art facilities and will be awarded a University of Hertfordshire accredited certificate upon successful completion of the training, contingent on assessments of their knowledge, understanding and practical skills.
Dr Salman Rahman, commercial lead in the School of Life & Medical Sciences at the University of Hertfordshire, said: Students on the course will be taught theoretical knowledge including principles and operational aspects necessary for aseptic manufacturing of cell and gene therapy products in line with European regulatory guidance, complimented by practical learning experiences in state-of-the-art clean room facilities.
Keith Thompson, CEO of the Cell and Gene Therapy Catapult added: There is an accelerating demand for skills in the UK cell and gene therapy industry as employment, manufacturing space and the number of ongoing clinical trials increases year on year.
We are delighted to collaborate with the University of Hertfordshire in developing this new initiative which will support professionals andBy providing training on GMP quality standards which are vital to the manufacture of cell and gene therapies, we are furthering our mission to fuel the continuing growth of the industry.
Read the rest here:
Boost for cell and gene therapy manufacture - Business Weekly
Horizon and New Jersey university power up gene therapy technology – Business Weekly
Horizon Discovery is to provide access to a novel base editing technology licensed from Rutgers, The State University of New Jersey, for exclusive use in therapeutic, diagnostic and services applications.
The technology is incorporated into Horizons next-generation gene editing platform. It will enable the development of novel therapeutics that rely on engineering patients cells either directly in the body (gene therapy), or externally before transplanting back into the patient (cell therapy).
The platform will also expand the companys research tools and service provisions.
Horizon formed an exclusive partnership with Rutgers in January 2019 to further develop the novel base editing technology invented by Dr Shengkan Jin, associate professor of pharmacology, and co-inventor Dr Juan C. Collantes, post-doctoral research fellow at Rutgers Robert Wood Johnson Medical School, and has since been funding research in base editing at the university while undertaking its own evaluation and proof-of-concept studies.
Horizon has a number of internal programs designed to accelerate the clinical uptake of this technology and is now seeking 35 partners to assess and shape the development of its Pin-point base editing platform.
Horizon will offer partners access to a novel system that could be used to progress more effective multi-gene knockout cell therapy programs through clinical development with an improved safety profile.
Partners will also gain access to the companys expertise in genome engineering of different cell types, access to early technical data, and influence over the direction of future development.
Base editing is a novel technology for engineering DNA in cells, which the potential to correct certain errors or mutations in the DNA, or inactivate disease-causing genes.
Compared to currently available gene editing methodologies such as conventional CRISPR/Cas9, which creates cuts in the gene that can lead to adverse or negative effects, this new technology allows for accurate gene editing while reducing unintended genomic changes that could lead to deleterious effects in patients.
Dr Jonathan Frampton, corporate development partner at Horizon Discovery, said: The technology could have a significant impact in enabling cell therapies to be progressed through clinical trials and towards commercialisation.
Horizon is pleased to offer an effective and precise base editing technology and, alongside Rutgers, aims to make base editing available to all appropriate cell and gene therapy companies as well as research departments. Partnering with leading organisations will help us to drive innovation and deliver the best therapy for the patient.
Dr Shengkan Victor Jin of Rutgers University added: The cytidine deaminase version of the technology alone could potentially be used for developing cell therapies such as gene modified cells for sickle cell anaemia and beta thalassemia, HIV resistant cells for AIDS, over-the-shelf CAR-T cells for cancer, and MHC-compatible allogenic stem cells for transplantation.
Other applications could include use as gene therapies for inherited genetic diseases including antitrypsin deficiency and Duchenne muscular dystrophy. In addition, we intend to take full advantage of the unique modularity and versatility features of Pin-point platform and develop efficient gene inactivation agents for potential treatment of many devastating diseases where the leading causal contributing factors are well defined.
At the top of this disease list are Alzheimers disease, amyotrophic lateral sclerosis, and familial hypercholesterinemia.
See more here:
Horizon and New Jersey university power up gene therapy technology - Business Weekly
Global Gene Therapy Market 2019 by Manufacturers, Regions, Type and Application, Forecast to 2025 – Dagoretti News
The global Gene Therapy market report includes a scrupulous analysis of the Gene Therapy market in the forecasted period. It also assesses the Gene Therapy market in terms of topography, technology, and consumers. The report also covers the volume of the market during the projected period. The uniqueness of the global Gene Therapy market research report is the representation of the Gene Therapy market at both the global and regional level.The key playersBluebird Bio, Sangamo, Spark Therapeutics, Dimension Therapeutics, Avalanche Bio, Celladon, Vical Inc., Advantagene play an important role in the global Gene Therapy market.
Apply here for the free sample copy of the report :https://www.intenseresearch.com/report/155917#request-sample
The global Gene Therapy report offers the weaknesses as well as plus points of the established market players. It analyses numerous features of the global Gene Therapy market such as demand, drivers, challenges, and options. The report appraises the influence of these aspects on each market region during the estimated time. It presents the value chain analysis together with vendor list and highlights the present confronts between consumer and supplier.
There are 15 Segment to show the Global Gene Therapy market
Segment 1,Definition, Specifications and Classification of Gene Therapy, Applications of Gene Therapy, Market Segment by Regions;Segment 2,Aggregating Cost Structure, Rough Material and Suppliers, Social occasion System, Industry Chain Structure;Segment 3,Specialized Information and Assembling Plants Examination of Gene Therapy, Limit and Business Production Date, Assembling Plants Circulation, Research and development Status and Innovation Source, Raw Materials Sources Investigation;Segment 4,Generally Market Examination, Cutoff Examination (Affiliation Piece), Arrangements Examination (Affiliation Bit), bargains Regard Examination (Affiliation Portion);Segment 5 and 6,Regional Market Investigation that incorporates United States, China, Europe, Japan, Korea and Taiwan, Gene Therapy segment Market Examination (by Sort);Segment 7 and 8,The Gene Therapy Segment Market Analysis (by Application) Major Manufacturers Analysis of Gene Therapy;Segment 9,Market Trend Analysis, Regional Market Trend, Market Trend by Product Type Ex vivo, In Vivo Market Trend by Application Cancer, Monogenic, Infectious disease, Cardiovascular disease, Other;Segment 10,Common Propelling Sort Examination, By and large Exchange Type Examination, Stock framework Examination;Segment 11,The Clients Examination of worldwide Gene Therapy;Segment 12,Gene Therapy Research Findings and Conclusion, Appendix, system and information source;Segment 13, 14 and 15,Gene Therapy deals channel, wholesalers, merchants, traders, Exploration Discoveries and End, appendix and data source.
Browse Full Global Gene Therapy Market Report :https://www.intenseresearch.com/report/155917
Additionally, the global Gene Therapy market is segmented on the basis of the region as well. It employs some practical tools to assess the expansion of the global Gene Therapy market in the upcoming time. The global Gene Therapy market report also offers a synopsis of the market on a global level that helps users in the decision-making processes, which in turn helps to boost their businesses. This synopsis incorporates the index growth as well as the competitive framework of the global Gene Therapy market over the projected period.
The highlight of the global Gene Therapy market research report is the in-depth market segmentation {Ex vivo, In Vivo}; {Cancer, Monogenic, Infectious disease, Cardiovascular disease, Other}. The report uses primary and secondary sources for analysis. The global Gene Therapy market is assessed in terms of value (USD Million). The global Gene Therapy market research report offers the performance of all the related key players, vendors, and suppliers. Additionally, this report represents the majority of the data with the help of graphics and tables together with the projected statistics.
Inquire more about this Gene Therapy report :https://www.intenseresearch.com/report/155917#inquiry-for-buying
Motivations to Purchase Gene Therapy Market Report Covered
1. The report studies how Gene Therapy market will perform in the future.2. Considering different perspectives on the Gene Therapy market with the assistance of Porters five powers examination.3. Separating the article type that is obviously to control the market and districts that are likely going to watch the quickest improvement between the assessed time period.4. Distinguish the new advancements, Gene Therapy market offers, and techniques utilized by the key market players.5. The focused scene including the market offer of huge players nearby the key frameworks recognized for advancement in the past five years.6. Complete organization profiles covering the item contributions, key monetary data, current improvements, SWOT examination and techniques utilized by the significant Gene Therapy market players.
Thanks for reading this article;you can also get individual chapter wise section or region wise report version like North America, Europe, Asia-Pacific, South America, Middle East and Africa.
For more information, please read ourProduct Specification
See the original post:
Global Gene Therapy Market 2019 by Manufacturers, Regions, Type and Application, Forecast to 2025 - Dagoretti News
Gene Therapy Market 1Q 2018: Current Trends, SWOT Analysis, Strategies, Industry Challenges, Business Overview and Forecast Research Study – Dagoretti…
According to a recent report General market trends, the Gene Therapy economy is likely to witness a CAGR growth of XX% within the forecast period (2019-2029) and reach at a value of US$ at the ending of 2029. The micro and macroeconomic elements that are forecasted to influence the trajectory of this Gene Therapy market are examined in the market analysis that was presented.
The report throws light on the raw material Providers, vendors, manufacturers, and market participants at the value string of their market that is Gene Therapy . Whats more, the political and economic scenarios of various regions and its effect on the Gene Therapy market are discussed in the report.
Critical Details included from the record:
Request Sample Report @https://www.mrrse.com/sample/17781?source=atm
Competitive Outlook
Light onto the throws Business prospects of players operating in the Gene Therapy industry. Preferred marketing channels the product pricing plans and product portfolio of prominent players, and market presence of each provider is included in the accounts. The dominant players covered in the report contain Business 2 Company, Company 3, and Business 4.
Regional Assessment
The market study that is introduced sheds light on the market Scenario in regional markets. Additionally, the governmental and regulatory policies on the prospects of this Gene Therapy market in every regions effect is examined in the report.
segmented as follows:
Global Gene Therapy Market, by Product
Global Gene Therapy Market, by Application
Global Gene Therapy Market, by Region
Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/17781?source=atm
The report Suits the queries pertaining Into the Gene Therapy market:
Reasons Gene Therapy Market Report Stands Out
Buy This Report @ https://www.mrrse.com/checkout/17781?source=atm
The FDA unveils a new regulatory framework to speed along gene therapies, rewarding the leading players – Endpoints News
What happens when a successful biotech venture capitalist is unexpectedly diagnosed with a chronic, life-disrupting vertigo disorder? Innovation in neurotology.
That venture capitalist was Jay Lichter, Ph.D., and after learning there was no FDA-approved drug treatment for his condition, Mnires disease, he decided to create a company to bring drug development to neurotology. Otonomy was founded in 2008 and is dedicated to finding new drug treatments for the hugely underserved community living with balance and hearing disorders. Helping patients like Jay has been the driving force behind Otonomy, a company heading into a transformative 2020 with three clinical trial readouts: Phase 3 in Mnires disease, Phase 2 in tinnitus, and Phase 1/2 in hearing loss. These catalysts, together with others in the field, highlight the emerging opportunity in neurotology.Otonomy is leading the way in neurotologyNeurotology, or the treatment of inner ear neurological disorders, is a large and untapped market for drug developers: one in eight individuals in the U.S. have moderate-to-severe hearing loss, tinnitus or vertigo disorders such as Mnires disease.1 With no FDA-approved drug treatments available for these conditions, the burden on patientsincluding social anxiety, lower quality of life, reduced work productivity, and higher rates of depressioncan be significant.2, 3, 4
Read More
Genprex Inc. (NASDAQ: GNPX) Up, As Independent Research Reveals TUSC2 Could Be A Therapy For Thyroid Cancer – Invest Million
Genprex Inc. (NASDAQ: GNPX) maintained upside momentum in yesterdays session, and closed the day with gains of 23.44%. This came after news that, independent researchers had found the companys TUSC2 to be a possible novel biomarker for treating thyroid cancer. The results found that, the overexpression of TUSC2 reduced thyroid cancer tumor metastasis. It was also shown to drive up sensitivity to apoptosis by pushing up cytochrome C and SMAC/DIABLO protein levels.
Thestudy further noted that, there was a high chance that TUSC2 was effective intreating thyroid cancer and that, it adds to research on TUSC2 way beyond thenon-small cell lung cancer treatment that the company was earlier looking into.The independent research was published in the International Journal ofMolecular Sciences.
Theresearchers also concluded that from their studies, TUSC2 has a negativeassociation with the aggressiveness of thyroid cancer. As such, it could be anew target and biomarker for thyroid cancer treatment. They also stated that,thyroid carcinoma is one of the most prevalent endocrine cancers and takesdifferent forms. They further noted that, anaplastic carcinoma is rare, but isone of the most dangerous subtypes.People suffering from it usually exhibit increased neck mass, a high rateof metastases and a 95% mortality at only 6 months. On the other hand,papillary thyroid carcinoma is more common, but has good outcomes and iscurable with radioiodine surgery and surgery.
Commentingon this research, Genprex CEO Rodney Varner stated that, the company isencouraged by the data conducted by different institutions on TUS2 that suggestit is helpful in treating multiple cancers.
Fromits price action, GNPX is in an uptrend. The stock opened the day at $1.57 andtraded between a low of $1.37, and a high of $1.75 before closing the day at$1.75. Volumes in the day stood at 21.44 million.
About GenPrex Inc.
GenPrexInc. is a gene therapy company that develops technologies for people sufferingfrom cancer. It is based in Austin, Texas.
Read the original here:
Genprex Inc. (NASDAQ: GNPX) Up, As Independent Research Reveals TUSC2 Could Be A Therapy For Thyroid Cancer - Invest Million
Analysis Of Gene Therapy Market 2020-2028 Accentuating Forecast Of Target Market Size, Trends, Consumption And Dominating Players – Briotainment
The market has been meticulously and expansively evaluated in a 116-page market research publication added into the repository, titled Global Gene Therapy Market The analysts have put forth brilliant and in-depth research about the current and future status of the global market. The forecast period considered by the analysts in this publication is from 2019 to 2025 and the review period is 20152018. This Global Gene Therapy Market report is a systematically organized compilation based on the growth rate, present market trends, and factors that affect consumers approach towards products and services available in the market.
Request A Sample Copy Of Report: Click Here https://www.reportconsultant.com/request_sample.php?id=3147
Top Key Players: Sangamo, Spark Therapeutics, Dimension Therapeutics, Avalanche Bio, Celladon, Vical, Advantagene
Under the overall analysis of the Global Gene Therapy Market, the researchers have shed light on sales price, sales, and capacity factors. Five key geographies across the world have been assessed in the report, viz., Asia-Pacific, Europe, Middle East & Africa, Latin America and North America. The sales price analysis of the global market has been offered for the year 2018 based on the industry segments. However, a six-year review period of Global Gene Therapy Market has been taken into consideration for assessing global sales price. Commodity sales and other capacity factors have been included featuring the evaluation of the growth rate.
This has been followed by a statistical surveying study of different classifications and applications deemed vital for players operating in the Global Gene Therapy Market. The authors have provided the important definitions and specifications ofthe global market right at the beginning of the report. Standard spheres and micrometers could be the prominent types of market applications. In the sixth chapter, the report has presented a comprehensive analysis of the driving factors, interview prices, and sales of the Global Gene Therapy Market in terms of type. An analytical comparison of different applications apart from the sales factors is offered in the report.
Ask For Discount@ https://www.reportconsultant.com/ask_for_discount.php?id=3147
Segment By Regions/Countries, This Gene Therapy Market Report Covers
South America
North America
Europe
Center East and Africa
Asia Pacific
Table Of Content:
The Global Gene Therapy Market Report Contains:
See the original post here:
Analysis Of Gene Therapy Market 2020-2028 Accentuating Forecast Of Target Market Size, Trends, Consumption And Dominating Players - Briotainment
Jewish or not, this week could save you a lot of heartache – Atlanta Journal Constitution
Monday marks the beginning of the first Jewish Genetic Screening Awareness Week.
And, this being February, there are at least a dozen other awareness efforts just as there were in January and will be come March and the nine months that follow. February is, of course, the month in which we raise awareness about HIV/AIDS, Teen Dating Violence and screen for eating disorders, among a long list of other things.
Now comes Feb. 3-7, the week JScreen hopes will get us to focus on genetic screening and more specifically the need for people here and across the country to take charge of their health and any children they hope to have in the future. To kick things off, the Georgia Legislature is expected to pass a proclamation to highlight the effort midweek.
JScreen, you might recall, is a national nonprofit public health initiative dedicated to preventing Jewish genetic diseases. But the goal is to prevent diseases common in other ethnic groups as well, said Karen Arnovitz Grinzaid, an assistant professor of human genetics at Emory University and JScreens executive director.
The nonprofit, based at Emory University, began in 2010 as a pilot project in Atlanta and has since evolved into a national initiative offering affordable, accessible and comprehensive genetic screening.
RELATED |DeKalb couples personal tragedy becomes crusade for genetic testing
Since its national launch in 2013, Grinzaid said, JScreen has helped thousands, testing people from every state across the country and offering services remotely.
That means once you register for a genetic screen kit atjscreen.org, JScreen will mail the kit to your home. All you have to do is spit in a tube and mail the saliva sample to the lab. A genetic counselor will then report the results either by phone or secure video conference.
For people with health insurance, the cost, regardless of coverage, is $149 and includes the testing and follow-up genetic counseling. The self-pay price is $349.
While the focus is on the Jewish community, screening is encouraged for anyone planning to have a family, Grinzaid said.
JScreen screens for over 200 diseases. For most of these diseases, both parents must carry the same recessive gene in order for their children to be at risk.
So why an awareness week?
Were always trying to raise awareness, but by dedicating a week and calling this out, we can save lives, Grinzaid said. So many people dont hear about genetic screening until they show up pregnant in their doctors office. At that point, if they are a high-risk couple, they dont have as many options to help them plan ahead for a healthy baby. Genetic screening is something people should ideally do before they get pregnant.
Unlike other awareness campaigns, JScreens promises to be very purposeful, focusing each day on a specific theme in hopes that more people will take advantage of screening.
RELATED |A mother and her daughters bare all to help prevent breast cancer
On Monday, organizers will be laser focused on Tay-Sachs, a rare, inherited disorder that destroys nerve cells in the brain and spinal cord.
On Tuesday, theyll turn their focus to college students. While having a baby may be the farthest thing from any students mind, discounted screenings will be provided at colleges and universities across the country so students will have access to important information they need for future family planning.
BRCA awareness will follow on Wednesday. Ashkenazi Jews are at 10 times greater risk to have a mutation in a BRCA gene, increasing their risk for breast, ovarian, prostate and pancreatic cancer.
Then on Thursday, Jews with Sephardi and Mizrahi ancestry, such as Persians, Syrians and Bukharians, are encouraged to be screened.
Finally on Friday, interfaith couples will be the focus. While there are a number of diseases that are commonly found in people with Jewish background, Grinzaid said these diseases also occur in the general population, making screening important for interfaith couples as well.
Thats not all.
Beyond carrier screening, Grinzaid said that JScreen is running the PEACH BRCA study for people with Jewish background who are at risk for carrying a BRCA mutation based on their ancestry. Knowing ones BRCA status can be life-saving.
Were piloting BRCA testing in metro Atlanta, she said. Participation in the study is free, but you must be at least 25 or older, male or female, and have at least one Jewish grandparent and no personal or close family history of related cancers.
Of the 500 available slots, only 100 are left. People interested in learning more about the PEACH BRCA study can log on here:jscreen.org/brca.
Once the study is complete, JScreen will launch a cancer genetic testing program nationally.
For information about any of these programs or to register for a screening kit,log onto jscreen.org.
Sure, the focus for now is on this week, but you can get screened any time and you should. Genetic testing is just that important.
Find Gracie on Facebook (www.facebook.com/graciestaplesajc/) and Twitter (@GStaples_AJC) or email her at gstaples@ajc.com.
Support real journalism. Support local journalism. Subscribe to The Atlanta Journal-Constitution today. See offers.
Your subscription to the Atlanta Journal-Constitution funds in-depth reporting and investigations that keep you informed. Thank you for supporting real journalism.
See the rest here:
Jewish or not, this week could save you a lot of heartache - Atlanta Journal Constitution
Precision Medicine in Primary Care: Bespoke. Genetic and Genomic. And Maybe Not Ready. – Managed Care magazine
Say precision medicine and people think of personalized cancer treatment. But this innovation has already begun to revolutionize primary care tooeven though the jury is still out, in many cases, on whether it makes a clear difference in outcomes.
Just what precision (alias personalized) medicine is isnt always spelled out precisely. But usually it is discussed as prevention or treatment that takes into account individual differences among patients, most often genetic differences. Some people expand the concept to consider individual differences in environment and lifestyle.
In adult primary care, two subsets of precision medicine have attracted the most attention recently: predictive genetic testing and pharmacogenomics.
Predictive genetic testing is what it sounds like: A genetic test that forecasts a persons chance of getting a disease. The term is also applied to germline genetic tests that provide some indication of the predisposition being passed down to offspring. Proponents see predictive genetic testing for certain inherited conditions as a way to unearth risks in people who can then get early treatment or take preventive steps to head off serious and possibly costly conditions. Actor Angelina Jolie put BRCA testing as a predictive genetic test into the public consciousness with her announcement in 2013 that she underwent a double mastectomy after testing positive for a BRCA mutation.
Pharmacogenomics studies show how a persons genes can affect his or her response to medications. Ideally, pharmacogenomic (sometimes called pharmacogenetic) results could end some of the trial and error with drugs and help providers and patients choose the most effective drug right off the bat.
Where federal dollars are concerned, precision medicine has already stepped out of the cancer box. In 2015, President Barack Obama committed $215 million to precision medicine research, including a genomic study of more than a million Americans to extend precision medicine from cancer to other diseases. A year later, the 21st Century Cures Act expanded this funding to $1.5 billion over the next 10 years.
Aided by a multibillion-dollar genomic testing industry, some providers have started testing precision medicine beyond oncology. In 2018, Geisinger Health System in central Pennsylvania made a splash by announcing that it would add DNA sequencing to routine primary care. A small number of other hospitals are starting to monetize these tests. In August 2019, STAT reported that a handful of academic medical centers, including Brigham and Womens Hospital and the Mayo Clinic, have started elective genome sequencing clinics for generally healthy patients willing to pay hundreds, sometimes thousands of dollars in cash for a genetic workup.
Skeptics see carts preceding horses; solid evidence that routine genetic testing results in better outcomes is lacking. As one genome-sequencing clinic leader conceded in the STAT article, such testing can lead to expensive follow-up testing. Not surprisingly, payers have been reluctant to cover sequencing tests of various kinds.
Regulators have breathed life into some kinds of testing and poured cold water on others. Last year, 23andMe was the first testing company to get FDA approval to market a direct-to-consumer genetic test for three (of the more than 1,000 known) BRCA gene mutations linked to increased risk of breast, ovarian, and prostate cancer. But in April 2019, the agency issued a warning letter to Inova Health System in Northern Virginia to stop marketing pharmacogenomics tests it claimed could predict patients responses to antidepressants, opioids, and other drugs. The FDA said it was unaware of data to support these claims.
A survey published two years ago in Clinical Pharmacology and Therapeutics found that clopidogrel, a blood thinner, was the medication most commonly tested for a druggene interaction, followed by simvastatin and warfarin. Nearly 40 academic medical centers and community health systems testing ways to implement pharmacogenomics in clinical practice were surveyed.
Some evidence suggests that traditional screening methods may not identify everyone at risk for certain inherited conditions. In a study published in Science three years ago, researchers at Geisinger and Regeneron (which manufactures Praluent, a drug used to treat familial hypercholesterolemia) found that only about one in four people carrying the familial hypercholesterolemia gene variant met the Dutch Lipid Clinic Network criteria (widely used diagnostic criteria) for genetic testing. Still, evidence for the clinical utility of many pharmacogenomic or predictive genetic tests is pretty scanty at this point.
Right now, for the average primary care provider, there are a relatively limited number of situations where pharmacogenomic testing is clearly beneficial to outcomes in a way thats dramatic, says Greg Feero, MD, a faculty member at Maine Dartmouth Family Medicine Residency and a former senior advisor to the director of the NIHs genomics research division.
For predictive genetic testing, there are a few notable exceptionshereditary breast and ovarian cancer, Lynch syndrome, and familial hypercholesterolemiaif certain criteria such as family history of the condition are met. The CDC has designated genomics applications for these conditions as Tier 1, the highest tier on its evidence-based ranking system of genomic applications by their potential for a positive public health impact.
In a 2017 editorial published in American Family Physician, Vinay Prasad, MD, and Adam Obley, MD, of Oregon Health and Science University said that rigorous meta-analyses havent yet shown that genotype-guided dosing for warfarin, clopidogrel, or antidepressant selection is better than usual care. Prasad is a well-known critic of what he sees as the proliferation of medical treatments and therapies without good evidence behind them. We need to know on a broad scale that [these tests] improve outcomes for patients, and dont just reassure physicians theyre choosing a better drug, Obley tells Managed Care.
Prasad and Obley also argued in their editorial that without further proof of improved outcomes, routine genetic testing could just fuel more inappropriate care. Guidelines carve out clear boundaries for who should get tested because there are scenarios in which the risks and benefits of preventive measures arent known, they said, noting that the U.S. Preventive Services Task Force advises against genetic testing for BRCA mutations in women without a family history of BRCA-related cancers.
A small pilot study suggests that genetic testing in primary care may not lead to improved outcomes. In 2017, The Annals of Internal Medicine published the first randomized trial of whole-genome sequencing in primary care. Gene variants were found in 20% of the participants whose genomes were sequenced. But six months later none of them had improved outcomes.
The test produces lots of information, says Obley, who wasnt involved in the study. But its not clear that any patient was managed differently in a way that improved their health.
Without evidence supporting the clinical utility of routine pharmacogenomics or genetic testing, most payers are unwilling to cover them. Some exceptions exist, such as employers that offer routine genetic testing as an employee benefit. In a blog post published in 2018, Color Genomics touted Visa and the German software company SAP as customers. Medicare covers pharmacogenomic testing of two gene variants that predict warfarin responsiveness for beneficiaries enrolled in a randomized, controlled clinical study that meets certain standards.
The high cost of genetic testing has been cited as another reason insurance coverage is limited, but payers may not budge even as testing gets cheaper. The cost of doing the test itself has been declining quite rapidly, says Kathryn Phillips, a health economics professor at University of CaliforniaSan Francisco who researches personalized medicine access, quality, and reimbursement. She has disclosed in recent studies that she is a paid consultant for Illumina, a DNA sequencing company. But she says its hardand its going to take longerto figure out where to use genetics in primary care in healthy populations, and [for insurers] to pay for it.
The current state of evidence and bleak reimbursement prospects havent deterred early adopters from embracing precision medicine in primary care. For Megan Mahoney, MD, chief of general primary care at Stanford Medicine, precision medicine begins with going after data on key determinants of healthnot just genes, but also environmental factors, social determinants, and health behaviors.
In a yearlong pilot of 50 patientsmore than half of whom were at risk for cardiovascular conditionsStanford Medicine care teams created personalized care plans to prevent and manage chronic illness. The plans leveraged data from several sources, including genetic-risk assessments and genetic testing for the three CDC Tier 1 conditions and remote monitoring devices.
Before the pilot, which ended in 2018, Stanford did not offer routine genetic testing in primary care. So far, that hasnt changed. But Stanford is making the genetic-risk assessment tested in the pilot available to its primary care providers, hoping it can increase screening rates for the Tier 1 conditions, says Mahoney. Studies show that many primary care providers are uncomfortable evaluating and addressing genetic risk. Five patients in the pilot discovered through the genetic risk screening that theyre at high risk for breast cancer, demonstrating that this type of tool can help to identify previously unknown risks.
Post-pilot, Stanford is also offering patients with poorly controlled blood pressure connection to a Bluetooth-enabled blood pressure cuff and health coaching as part of a larger study. Genetic testing has dominated the discussion of precision medicine in primary care, but Stanfords experience shows that it isnt the only way to tailor preventive care to individual patients needs.
Even if clinical utility is ultimately shown, folding precision medicine into primary care will likely follow the path of many new developments in medicine: There will be some early adopters, but most practices will have a wait-and-see and depends-on-the-reimbursement attitude.
Educating doctors on how to interpret, use, and communicate genetic testing results to patients will be one of the biggest hurdles. Theyll be learning on the job, says Susanne Haga, associate professor of internal medicine at Duke Universitys medical school, who leads educational activities in genetics and genomics for the Duke Center for Applied Genomics. An obstacle course of other possible barriers awaits: the limited number of certified genetic counselors, concerns about privacy and genetic discrimination, and the potential for the lack of diversity in genomic data sets to exacerbate disparities in care.
Still, Haga sees the convergence of three factors that will force the health care systems hand and usher in precision medicine in primary care: patients increasing ability to influence decisions about their care, the declining cost of testing, and a critical mass of people, numbering in the millions, who will have had their DNA sequenced in genome programs such as Geisingers or several national genomics research initiatives.
Its coming, she says, one way or another.
How Genetic Testing with 23andMe Can Improve Your Health – PR Web
NEW YORK (PRWEB) January 30, 2020
At-home DNA testing service 23andMe is more than just a tool to discover ancestry - it also offers insight into how genes can impact overall health and wellness. 23andMe offers a wealth of reports that provide genetic health information that can help customers be more proactive about their health. Recently, 23andMe Genetics Trends Expert, Madeline Lynch, and customer Michelle Martinez, teamed with YourUpdateTV to discuss.
A video accompanying this announcement is available at: https://youtu.be/VAKAywAd4VY
A recent survey of 23andMes Health + Ancestry Service customers found that more than three-quarters reported that after receiving their personalized genetic reports they made at least one positive change in their health behavior. Designed by 23andMe and M/A/R/C Research, researchers asked 23andMe Health + Ancestry customers about the overall impact of their 23andMe experience, regardless of their results.
51 percent of respondents reporting theyve set future goals to be healthier. Changes included eating healthier, getting more sleep, and exercising more, among others. Of those who responded to the survey:
For more information and to get started, visit 23andMe.com
Madeline Lynch:Madeline Lynch is the Genetics Trends Expert at 23andMe. She serves as a subject matter expert and company spokesperson for media engagements, the analyst community, online communities, and the general public at large. Her responsibilities on the customer care team include providing input on prioritization and resolution of customer-facing issues and working directly with cross-functional teams to influence and support development of new and existing communications materials and messaging from the perspective of the customer. She holds a BA from University of California, Davis.
About Michelle Martinez:Michelle Martinez is a 51-year-old lab assistant from Arlington, Texas. Michelle was inspired to order a 23andMe Health + Ancestry kit to help prepare for any potential genetic health risks, due to several serious health risks running in her family. When she opened her Genetic Weight wellness report, she saw that she is genetically predisposed to weigh less than average. She thought, "I've been denying my genetics and just falling into bad habits. I'm not being my best self." That report, along with the knowledge of lifestyle and environmental factors that affect one's health, inspired Michelle to make better lifestyle decisions like eating healthier. She has since lost more than 50 pounds and gained confidence in being in her own skin. She believes that her weight loss journey is one of patience and acceptance with and of herself -- no matter her size.
About 23andMe:23andMe, Inc. is the leading consumer genetics and research company. Founded in 2006, the mission of the company is to help people access, understand and benefit from the human genome. The company was named by TIME as a Genius Company in 2018 and featured as Fast Company's #2 Most Innovative Health Company in 2018. 23andMe has millions of customers worldwide, with more than 80 percent of customers consented to participate in research. 23andMe, Inc. is located in Sunnyvale, CA. More information is available at http://www.23andMe.com.
About YourUpdateTV: YourUpdateTV is a social media video portal for organizations to share their content, produced by award-winning video communications firm, D S Simon Media (http://www.dssimon.com). It includes separate channels for Health and Wellness, Lifestyle, Media and Entertainment, Money and Finance, Social Responsibility, Sports and Technology.
Share article on social media or email:
See original here:
How Genetic Testing with 23andMe Can Improve Your Health - PR Web
Global Molecular Diagnostics Market is Likely to Surpass US$ 22.5 Billion by the End of Year 2025 – ResearchAndMarkets.com – Yahoo Finance
The "Molecular Diagnostics Market Share & Global Forecast, By Application, Technology, End User, Regions, Companies" report has been added to ResearchAndMarkets.com's offering.
Increasing prevalence of Infectious diseases such as Influenza, HPV, Hepatitis, HIV and Tuberculosis despite rise in sanitation practices globally. In the past, antimicrobials medicines were used to fight powerful infectious disease but slowly in today's time antimicrobial agent is not able to give the desired results because the problem of drug resistant occurs in many people across the world.
Nowadays, a new diagnostic procedure is being followed to fight infectious disease like molecular diagnostic test is very effective which is quite fast and precise. The number of cancer patients is increasing very fast, so it is believed that in the coming time the molecular diagnostic test market will be growing at rapid pace. Global Molecular Diagnostics Market is likely to surpass US$ 22.5 Billion by the end of year 2025.
There are various reasons that will propel the market growth in forecast year; rising incidence rate of infectious disease, increasing incidence rate of cancer of all type, increasing people awareness regarding molecular diagnostic, rapid technological growth, widely acceptance of personalized medicine, rising healthcare infrastructure, increasing healthcare per capita expenditure across the developed and developing nation, accuracy of diagnosis, growing population of cardiovascular and neurological disorder etc. In addition, increasing prevalence of genetic disorder will further boost the market in forecast period of time.
The report titled Molecular Diagnostics Market Share & Forecast, By Application (Infectious Diseases, Blood Screening, Oncology, Genetic Testing, HLA (Tissue Typing), Microbiology, Cardiovascular Diseases, Neurological Diseases, Pharmacogenomics and Others), By Technology (PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others), By End User (Hospitals & Academic Laboratories, Clinics and Commercial Laboratories, Others), By Regions [United States, Europe (Expect Russia), India, China, Japan, Brazil, South Korea, Mexico, Russia and ROW], Companies (Roche, Abbott, Myriad Genetics, Qiagen, BioMrieux and Others) provides a complete analysis of Molecular Diagnostics Market.
Market Insight by Application
The report provides comprehensive analysis of molecular diagnostic test market by application into ten parts: Infectious Diseases, Genetic Testing, Blood Screening, Oncology, HLA (Tissue Typing), Microbiology, Neurological Diseases, Pharmacogenomics, Cardiovascular Diseases, and Others. This report also provides key opportunities market and specific factors are given by each application market.
Market Insight by Technology
Here the market is fragmented into six parts; PCR, Transcription-Mediated Amplification (TMA), Hybridiazation (In-situ Hybridiazation & FISH), DNA Sequencing & NGS, Microarray and Others. Besides, many factors are analyzed that influence the growth, challenges and opportunities of market in technological context.
Market Insight by End User
The report provides complete insight of market by End User segments: Hospitals & Academic Laboratories, Clinics & Commercial Laboratories and Others. According to the publisher, Hospitals & Academic Laboratories will hold the largest market in global molecular diagnostic test market in forecast period of time.
Market Insight by Regions
This report covers the complete regional profile by 10 geographical market; United States, Europe, India, China, Japan, Brazil, South Korea, Mexico, Russia and Rest of World (ROW).
Key Topics Covered:
1. Executive Summary
2. Global Molecular Diagnostic Market
3. Market Share - Global Molecular Diagnostics
3.1 By Application
3.2 By Technology
3.3 By Countries
3.4 By Companies
4. Application - Molecular Diagnostics Market
4.1 Infectious Diseases
4.1.1 Hospital Acquired Infections (HAI)
4.1.2 HIV / HCV Testing
4.1.3 STD Testing
4.1.4 HPV Testing
4.2 Blood Screening
4.3 Oncology / Cancer
4.3.1 Breast
4.3.2 Colorectal
4.3.3 Prostate
4.3.4 Others
4.4 Genetic Testing
4.5 HLA (Tissue Typing)
4.6 Microbiology
Story continues
4.7 Cardiovascular Diseases
4.8 Neurological Diseases
4.9 Pharmacogenomics
4.10 Others
5. Technology - Molecular Diagnostics Market
5.1 PCR
5.2 Transcription-Mediated Amplification (TMA)
5.3 Hybridiazation (In-situ Hybridiazation & FISH)
5.4 DNA Sequencing & NGS
5.5 Microarray
5.6 Others
6. Region - Molecular Diagnostics Market
6.1 United States
6.2 Europe
6.3 India
6.4 China
6.5 Japan
6.6 Brazil
6.7 South Korea
6.8 Mexico
6.9 Russia
6.10 Rest of World (ROW)
7. End Users - Molecular Diagnostics Market
7.1 Hospitals & Academic Laboratories
7.2 Clinics and Commercial Laboratories
7.3 Others
8. Roche Diagnostics - Company Analysis
8.1 Merger & Acquisitions
8.2 Sales Analysis
9. Abbott Laboratories - Company Analysis
9.1 Merger & Acquisitions
9.2 Sales Analysis
10. Myriad Genetics - Company Analysis
10.1 Merger & Acquisitions
10.2 Sales Analysis
11. Qiagen - Company Analysis
11.1 Merger & Acquisitions
11.2 Sales Analysis
12. BioMrieux's Inc - Company Analysis
12.1 Merger & Acquisitions
12.2 Sales Analysis
13. Market Drivers
13.1 Various Developments in the Molecular Diagnostics Landscape
13.2 Integral to Traditional Labs
13.3 Improved Assay / Test Efficiencies
13.4 Targeting Antibiotic Resistance
13.5 Next Generation Ultrasensitive Molecular Diagnostics
13.6 Increasing Investment in Genomics & Proteomics Research
13.7 Technological Advances in Molecular Diagnostics
13.8 Increasing Acceptance of the Personalized Medicine
13.9 Growing Molecular Diagnostics for Food Safety
14. Challenges
14.1 Dearth of Trained Professionals
14.2 Regulatory Issues
14.3 Various Factors Slowing Growth of Molecular Diagnostics
14.4 Reimbursement Capabilities
14.5 Quality Checkpoints, Awareness & Acceptance
For more information about this report visit https://www.researchandmarkets.com/r/j3on5s
View source version on businesswire.com: https://www.businesswire.com/news/home/20200130005474/en/
Contacts
ResearchAndMarkets.comLaura Wood, Senior Press Managerpress@researchandmarkets.com For E.S.T Office Hours Call 1-917-300-0470For U.S./CAN Toll Free Call 1-800-526-8630For GMT Office Hours Call +353-1-416-8900
Follow this link:
Global Molecular Diagnostics Market is Likely to Surpass US$ 22.5 Billion by the End of Year 2025 - ResearchAndMarkets.com - Yahoo Finance
Allison Vorderstrasse Named Dean of UMass Amherst College of Nursing – UMass News and Media Relations
AMHERST, Mass. Allison Vorderstrasse, a faculty member and Ph.D. program director at New York University, has been named the dean of the College of Nursing at the University of Massachusetts Amherst. She will begin her appointment on July 1.
Vorderstrasse currently serves as a faculty member and director of the Florence S. Downs Ph.D. Program in Nursing Research and Theory Development at New York University (NYU) Rory Meyers College of Nursing. The appointment was made by John J. McCarthy, provost and senior vice chancellor for academic affairs.
Dr. Vorderstrasse emerged as the best in an exceptionally well-qualified pool of candidates. I look forward to working with her as she leads the College of Nursing into its 67th year, McCarthy said.
An adult nurse practitioner with clinical experience, Vorderstrasse received her doctorate and masters degrees in nursing at the Yale University School of Nursing, with specialties in chronic illness self-management research and diabetes. She received her bachelors degree in nursing from Mount Saint Mary College in Newburgh, N.Y.
As a researcher, Vorderstrasse focuses on development and implementation of innovative behavioral interventions for diabetes and cardiovascular disease that could expand preventive and self-care management support for adults at risk for, or living with, chronic diseases. Her contributions to chronic disease prevention have identified that genetic testing for chronic conditions may improve risk reduction in certain groups. She was among the first researchers to demonstrate that virtual environments are an effective way to provide self-management education and support to improve outcomes for patients with diabetes and cardiovascular disease.
Prior to joining the faculty at NYU, Vorderstrasse was an associate professor of nursing and faculty lead for precision health research at the Duke University School of Nursing. She taught at the Duke University School of Nursing from 2009 to 2014. In 2014, she received the Duke University School of Nursing Distinguished Teaching Award. She was inducted as a fellow of the American Academy of Nursing in 2015, and in 2017 received the International Society of Nurses in Genetics Founders Award for Excellence in Genomic Nursing Research.
While at NYU, Vorderstrasse led curriculum and program changes in its nursing Ph.D. program that included a new entry point for post-bachelor to Ph.D. students to facilitate earlier entry into careers in research without sacrificing academic rigor in the program. She has worked with global partners to establish a global track option for Ph.D. students that will launch in the fall of 2020. She also focused on faculty and student culture and wellness as a part of her leadership at NYU.
View original post here:
Allison Vorderstrasse Named Dean of UMass Amherst College of Nursing - UMass News and Media Relations
Illumina (ILMN) Q4 Earnings and Revenues Top Estimates – Yahoo Finance
Illumina (ILMN) came out with quarterly earnings of $1.70 per share, beating the Zacks Consensus Estimate of $1.59 per share. This compares to earnings of $1.32 per share a year ago. These figures are adjusted for non-recurring items.
This quarterly report represents an earnings surprise of 6.92%. A quarter ago, it was expected that this genetic testing tools company would post earnings of $1.40 per share when it actually produced earnings of $1.93, delivering a surprise of 37.86%.
Over the last four quarters, the company has surpassed consensus EPS estimates four times.
Illumina, which belongs to the Zacks Medical - Biomedical and Genetics industry, posted revenues of $953 million for the quarter ended December 2019, surpassing the Zacks Consensus Estimate by 0.63%. This compares to year-ago revenues of $867 million. The company has topped consensus revenue estimates four times over the last four quarters.
The sustainability of the stock's immediate price movement based on the recently-released numbers and future earnings expectations will mostly depend on management's commentary on the earnings call.
Illumina shares have lost about 5.3% since the beginning of the year versus the S&P 500's gain of 1.4%.
What's Next for Illumina?
While Illumina has underperformed the market so far this year, the question that comes to investors' minds is: what's next for the stock?
There are no easy answers to this key question, but one reliable measure that can help investors address this is the company's earnings outlook. Not only does this include current consensus earnings expectations for the coming quarter(s), but also how these expectations have changed lately.
Empirical research shows a strong correlation between near-term stock movements and trends in earnings estimate revisions. Investors can track such revisions by themselves or rely on a tried-and-tested rating tool like the Zacks Rank, which has an impressive track record of harnessing the power of earnings estimate revisions.
Ahead of this earnings release, the estimate revisions trend for Illumina was unfavorable. While the magnitude and direction of estimate revisions could change following the company's just-released earnings report, the current status translates into a Zacks Rank #4 (Sell) for the stock. So, the shares are expected to underperform the market in the near future. You can see the complete list of today's Zacks #1 Rank (Strong Buy) stocks here.
It will be interesting to see how estimates for the coming quarters and current fiscal year change in the days ahead. The current consensus EPS estimate is $1.55 on $907.18 million in revenues for the coming quarter and $6.99 on $3.90 billion in revenues for the current fiscal year.
Investors should be mindful of the fact that the outlook for the industry can have a material impact on the performance of the stock as well. In terms of the Zacks Industry Rank, Medical - Biomedical and Genetics is currently in the top 31% of the 250 plus Zacks industries. Our research shows that the top 50% of the Zacks-ranked industries outperform the bottom 50% by a factor of more than 2 to 1.
Want the latest recommendations from Zacks Investment Research? Today, you can download 7 Best Stocks for the Next 30 Days. Click to get this free reportIllumina, Inc. (ILMN) : Free Stock Analysis ReportTo read this article on Zacks.com click here.
View original post here:
Illumina (ILMN) Q4 Earnings and Revenues Top Estimates - Yahoo Finance
Trends in the Ready To Use Genetic Testing Services Market 2019-2021 – Dagoretti News
As per a report Market-research, the Genetic Testing Services economy is likely to see a CAGR increase of XX% within the forecast period (2019-2029) and reach at a value of US$ at the ending of 2029. The macro economic and micro elements which are predicted to influence the trajectory of this market are examined from the market analysis that was presented.
Light onto the material throws Providers, vendors, manufacturers, and market participants at the value string of their industry that is Genetic Testing Services . Whats more, its particular influence on the market and the political and economic scenarios of regions are discussed within the analysis.
Critical Details included from this record:
Request Sample Report @https://www.mrrse.com/sample/15214?source=atm
Competitive Outlook
Light onto the throws Business prospects of players operating from the industry that is Genetic Testing Services . The item pricing plans, marketing stations that were preferred and product portfolio of most players, and promote presence of every and every provider is contained in the title. The players comprise Business 4, Business two, Business 3, and Business.
Regional Assessment
The marketplace research that is introduced sheds light onto the Marketplace Scenario in numerous markets. Additionally, the effects of the governmental and regulatory policies to this market in every regions prospects is examined from the report.
companies profiled in the report are Laboratory Corporation of America Holdings, Quest Diagnostics Incorporated, Genomic Health, Inc., NeoGenomics Laboratories, Inc., Eurofins Scientific, Ambry Genetics, Hoffmann-La Roche Ltd, Illumina, Inc., CENTOGENE AG, and 23andMe, Inc.
The global genetic testing services market has been segmented as follows:
Global Genetic Testing Services Market, by Test Type
Global Genetic Testing Services Market, by Service Provider
Global Genetic Testing Services Market, by Application
Global Genetic Testing Services Market, by Geography
Request For Discount On This Report @ https://www.mrrse.com/checkdiscount/15214?source=atm
The report Suits the questions pertaining Into the Genetic Testing Services economy:
Reasons Genetic Testing Services Market Report Sticks out
Buy This Report @ https://www.mrrse.com/checkout/15214?source=atm
Read more:
Trends in the Ready To Use Genetic Testing Services Market 2019-2021 - Dagoretti News
Global Direct Patients Genetic Testing Market Analysis and Forecast to by Top Key Players, Trend, Size, Industry Growth, Demand, Applications, Share…
Genetic testing, also known as DNA testing, is used to identify changes in DNA sequence or chromosome structure. Genetic testing can also include measuring the results of genetic changes, such as RNA analysis as an output of gene expression, or through biochemical analysis to measure specific protein
The Global Direct Patients Genetic Testing Industry estimated to be Increasing awareness about the risk of genetic diseases and growing proactive tendency among the public about prevention and efficient management of chronic diseases mainly drive the market. However, high cost of testing service is one of the major factors expected to hamper the growth of the global market.
Get Sample Copy of this Report Visit @ https://www.orianresearch.com/request-sample/1381456
Direct Patients Genetic Testing Industry 2020 research analysts provide an elaborate description of the value chain and its distributor analysis. This Market study Research Report provides comprehensive data that enhances the understanding, scope, and application of this report. The study also consists of data regarding the consumption aspect of the Direct Patients Genetic Testing Market. It provides details regarding the consumption volume as well as value of the product.
Major Key Players in Direct Patients Genetic Testing Market are:-
Key Benefits of the Report:
Inquire more or share questions if any before the purchase on this report @ https://www.orianresearch.com/enquiry-before-buying/1381456
On the basis of type, the market is split into:
On the basis of technology, the market is split into:
The market estimates and forecasts have been verified through exhaustive primary research with the Key Industry Participants (KIPs), which typically include:-
Research Methodology:-
The market is derived through extensive use of secondary, primary, in-house research followed by expert validation and third party perspective, such as, analyst reports of investment banks. The secondary research is the primary base of our study wherein we conducted extensive data mining, referring to verified data sources, such as, white papers, government and regulatory published articles, technical journals, trade magazines, and paid data sources.
For forecasting, regional demand & supply factors, recent investments, market dynamics including technical growth scenario, consumer behavior, and end use trends and dynamics, and production capacity were taken into consideration. Different weightages have been assigned to these parameters and quantified their market impacts using the weighted average analysis to derive the market growth rate.
Order a copy of Global Direct Patients Genetic Testing Market Report @ https://www.orianresearch.com/checkout/1381456
Why to Buy this Report:-
Table of Content:-
Customization Service of the Report:-
Orian Research provides customisation of reports as per your need. This report can be personalised to meet your requirements. Get in touch with our sales team, who will guarantee you to get a report that suits your necessities.
About us: Orian Researchis one of the most comprehensive collections of market intelligence reports on the World Wide Web. Our reports repository boasts of over 500000+ industry and country research reports from over 100 top publishers. We continuously update our repository so as to provide our clients easy access to the worlds most complete and current database of expert insights on global industries, companies, and products. We also specialize in custom research in situations where our syndicate research offerings do not meet the specific requirements of our esteemed clients.
Contact Us:-
Ruwin Mendez
Vice President Global Sales & Partner Relations
Orian Research Consultants
US +1 (415) 830-3727| UK +44 020 8144-71-27
Email: [emailprotected]
See the article here:
Global Direct Patients Genetic Testing Market Analysis and Forecast to by Top Key Players, Trend, Size, Industry Growth, Demand, Applications, Share...
Aneuploidy and a deregulated DNA damage response suggest haploinsufficiency in breast tissues of BRCA2 mutation carriers – Science Advances
Abstract
Women harboring heterozygous germline mutations of BRCA2 have a 50 to 80% risk of developing breast cancer, yet the pathogenesis of these cancers is poorly understood. To reveal early steps in BRCA2-associated carcinogenesis, we analyzed sorted cell populations from freshly-isolated, non-cancerous breast tissues of BRCA2 mutation carriers and matched controls. Single-cell whole-genome sequencing demonstrates that >25% of BRCA2 carrier (BRCA2mut/+) luminal progenitor (LP) cells exhibit sub-chromosomal copy number variations, which are rarely observed in non-carriers. Correspondingly, primary BRCA2mut/+ breast epithelia exhibit DNA damage together with attenuated replication checkpoint and apoptotic responses, and an age-associated expansion of the LP compartment. We provide evidence that these phenotypes do not require loss of the wild-type BRCA2 allele. Collectively, our findings suggest that BRCA2 haploinsufficiency and associated DNA damage precede histologic abnormalities in vivo. Using these hallmarks of cancer predisposition will yield unanticipated opportunities for improved risk assessment and prevention strategies in high-risk patients.
Breast cancers arising in women who inherit heterozygous mutations in BRCA2 are associated with a high prevalence of genomic alterations and aggressive clinical behavior (1, 2). Because of the high risk of these cancers in BRCA2 mutation carriers, many such women elect to undergo bilateral mastectomy for breast cancer prevention. However, despite the unmet need for more effective breast cancer prevention approaches in this setting, the stepwise evolution from an otherwise normal BRCA2 heterozygous mutant (BRCA2mut/+) cell to an invasive malignancy has not been defined. Homozygous loss of BRCA2 is embryonically lethal (35), and acute loss in cultured cells rapidly leads to DNA damage and growth arrest or cell death (68). These observations suggest a multistep pathogenesis in which homozygous BRCA2 loss is not the earliest genetic event but rather that the wild-type BRCA2 allele may remain intact as early genetic changes accumulate. Critically, however, this scenario leaves unresolved the nature and enabling mechanism for early cancer evolution. Haploinsufficiency for BRCA2 has been proposed as a possible driver of early pathogenesis, but direct evidence for such an effect in the normal human mammary gland is inconsistent. Furthermore, heterozygous genetically engineered mouse models (GEMMs) of BRCA2 are not tumor prone and therefore represent a poor model of precancerous evolution in this setting (35, 8, 9). While the BRCA1 tumor suppressor shares many of these features (9, 10), the pathogenesis of BRCA1- versus BRCA2-associated breast cancers may differ in important ways, as the former are primarily hormone receptor (HR) and HER2-negative tumors, while the latter are primarily HR positive (11).
We sought to unveil the earliest steps in the pathogenesis of BRCA2-associated breast tumors through detailed analysis of histologically normal glands from women harboring germline deleterious mutations who elected to undergo bilateral prophylactic mastectomy. Genomic analysis of individual cells revealed frequent polyclonal chromosomal damage, which was most prevalent among the subset of epithelial cells that are the suspected cells of origin of these cancers. Corresponding defects in replication stress and DNA damage checkpoint responses in these same cells collectively define a previously unappreciated phenotype for BRCA2 that precedes histologic abnormalities in the human breast. The discovery of these precancerous hallmarks paves the way for improving clinical risk prediction and cancer prevention in this population.
We carried out detailed analysis of noncancerous glands from BRCA2 carriers who elected to undergo bilateral prophylactic mastectomy, using as control tissues from women matched for age, menopausal status, and hormonal exposure electing cosmetic breast surgery (Fig. 1A and table S1). None of these women had a previous breast cancer diagnosis or chemotherapy exposure, and no occult cancers were detected upon histologic analysis of the tissues we analyzed (table S1). We used established markers to carry out flow cytometrybased isolation and sorting of the three major epithelial cell subpopulations: mature luminal (ML), luminal progenitor (LP), and basal epithelial cells (Fig. 1A). Notably, data from GEMMs and gene expression analyses of human tumors have suggested that the cell of origin of BRCA1-associated breast cancer is the LP cell (12, 13), while BRCA2-associated tumors may arise from an LP-related cell or a more ML cell (14).
(A) Workflow depicts dissociation and isolation of human breast epithelial cells from BRCA2 carrier (BRCA2mut/+) prophylactic mastectomy and control [wild-type (WT)] elective mammoplasty cases for subsequent analyses, as indicated. Dot plot at center shows representative flow cytometry sorting via CD49f and EpCAM of ML, LP, and basal epithelial cells. FACS, fluorescence-activated cell sorting. (B) Summary of single-cell whole-genome sequencing (WGS) analysis of flow-sorted, primary uncultured breast epithelial cells. Copy number variation (CNV) calls for individual cells (rows) across the genome (x axis; Chr, chromosome) are shown, with gains and losses boxed. Cell types and genotypes are indicated at the top left, and individual patient ID numbers are indicated at the right. In total, 252 sequenced breast epithelial cells from BRCA2mut/+ (n = 5) and control (n = 2) tissue specimens are depicted. (C) Bar chart depicting the prevalence of CNVs in LP (L) and basal (B) cells of BRCA2 carrier and control (WT) patients. Color code depicts the number of CNVs identified per cell. (D) LP cells from BRCA2 carriers are significantly more likely to harbor CNVs than basal cells. P value is determined by 2 test.
Among the earliest events in cancer evolution are thought to be polyclonal somatic genomic alterations. Accordingly, we looked for the presence of somatic copy number variations (CNVs) at high resolution through single-cell whole-genome sequencing (WGS) of uncultured, flow-sorted primary LP and basal epithelial cells from BRCA2 carriers and controls. Low-coverage WGS provides sufficiently high resolution to identify subchromosomal CNVs as small as 10 Mb, and our methodology for single-cell whole-genome amplification and analysis has been previously validated (15, 16). We carried out WGS to an average depth between 0.1 to 0.05 and then used two independent algorithms (HMMcopy and DNAcopy) to assign and confirm copy number changes across the genome (15, 16). Previous studies using this methodology have demonstrated that in unselected individuals, the proportion of cells with any such CNVs is very low (<5% of cells) in normal epithelial and brain tissues (16). In contrast, among nearly 100 individual LP cells from a cohort of BRCA2 carriers analyzed by WGS, we observed that 27% demonstrated one or more CNVs of >10 Mb (Fig. 1, B to D). Applying this methodology to an equal number of basal breast epithelial cells from the same individuals also revealed a substantial excess of cells harboring CNVs (13%), although significantly less than the proportion of CNV-positive LP cells (P = 0.04) (Fig. 1, B to D). By comparison, a parallel WGS analysis of sorted LP and basal cells from noncarriers revealed a single CNV in 90 cells (Fig. 1, B and C). As further validation of our sequencing and analysis pipelines, we reanalyzed existing data from normal skin and brain cells sequenced on the same platform. The overall sequence quality was comparable between these cells and the breast epithelial cells, and we confirmed the low prevalence of CNV-positive cells in 142 skin and brain cells sequenced (fig. S1). Thus, breast epithelia, and particularly, LP cells from noncancerous breast tissue of BRCA2 carriers harbor frequent subchromosomal aneuploid events (Fig. 1D and fig. S2A).
One notable CNV we observed was duplication of the entire chromosome 1q arm, which is a common genomic abnormality in breast cancer (Fig. 2A) (17). Most of the identified CNVs were subchromosomal haploid losses, consistent with the widespread pattern of losses observed in BRCA2-associated breast cancer (Fig. 2A and fig. S2B) (1). In some cases, identical losses were shared between multiple cells of the same patient, a finding that could conceivably correspond to early clonal evolution (Fig. 2B). None of the losses in any cell involved the BRCA2 locus on chromosome 13 (Fig. 1B and fig. S2, B to E). Previous analyses of germline BRCA2-associated breast cancers have demonstrated that most genetic loss-of-heterozygosity (LOH) events for BRCA2 itself are >10 Mb and therefore would have been detected by our analysis (18). This observation suggests that the wild-type BRCA2 allele is intact in our cases, implying that accumulation of subchromosomal aneuploidy may be a haploinsufficient phenotype. To confirm the integrity of the wild-type allele, we performed targeted polymerase chain reaction (PCR) amplification of the locus surrounding the patient-specific BRCA2 mutation from individual cells. Although efficiency for detection of either allele was low, we did not observe a bias toward detection of the mutant allele alone in the cells analyzed (Fig. 2C and table S2). Together, these findings imply that subchromosomal aneuploidy is an early and potentially haploinsufficient phenotype in BRCA2mut/+ breast epithelia.
(A) Representative segmentation plots of individual LP (n = 4) and basal (n = 2) cells harboring CNVs from four BRCA2 mutation carriers. Y axis depicts normalized WGS read counts across the genome (x axis). Red dots indicate region of gain, whereas blue dots indicate losses. Patient ID numbers are indicated at the right. (B) Segmentation plots of three LP cells that share a clonal loss (red box) in a BRCA2 carrier (patient 131). Zoomed-in images of the clonal loss are shown at the right. (C) Representative chromatograms from single-cell PCR-based Sanger sequencing of genomic DNA in a BRCA2mut/+ LP cell. The presence of a heterozygous single-nucleotide polymorphism (SNP) and the superimposition of sequences adjacent to the frameshift mutation suggest that LOH has not occurred.
The presence of viable aneuploid cells in BRCA2mut/+ tissues suggested ongoing DNA damage and/or a deregulated stress/damage response. Thus, we next used an independent method to directly assess DNA damage in single cells, the comet assay. This assay uses cells embedded in agarose that are lysed and then subjected to electrophoresis, causing broken DNA structures to migrate toward the anode, thus forming a comet tail (19). We briefly cultured freshly collected cells from BRCA2 carriers or controls under ultralow attachment conditions (48 to 72 hours) to select for epithelial progenitor cells before plating (20). Consistently, cells from BRCA2 carriers demonstrated increased DNA breaks at baseline compared to controls (Fig. 3A). In addition, inducing replication stress by treatment with hydroxyurea (HU) led to further increases in DNA damage in BRCA2mut/+ cells, potentially reflecting the established role of BRCA2 in protection of stalled replication forks (Fig. 3A) (21).
(A) Representative images of comet assays performed on primary human breast epithelial cells isolated from control (WT) and BRCA2mut/+ tissues. Red lines highlight tail of broken DNA. Graph below summarizes data from n = 3 patients per genotype (50 cells per patient). Cells were either untreated (Unt) or treated with HU for 4 hours. Data are depicted as fold change in tail DNA intensity. P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Error bars indicate SD. (B) Representative confocal immunofluorescence staining of primary breast epithelial cells for p-CHEK1 (Ser317) shows increased nuclear staining following HU treatment only in control (WT) but not in BRCA2mut/+ cells. Graph at the right summarizes nuclear fluorescence of individual cells (dots) (n = 4 patients for control and n = 3 patients for BRCA2mut/+; four fields counted per condition per patient). P values are determined by unpaired t test. ***P < 0.001 and ****P < 0.0001. Horizontal lines indicate means and SDs. Scale bars, 20 m. (C) Chromatograms depicting Sanger DNA sequencing of a cytospin of primary breast cells assayed in (B) from a BRCA2mut/+ patient harboring BRCA2 5799_5802delCCAA (p.Asn1933Lysfs). The superimposition of sequences adjacent to the frameshift mutation suggests that LOH has not occurred. (D) Heat map of RNA sequencing (RNA-seq) data from freshly sorted cells shows differential expression of RSRD (replication stress response deficiency) genes (24) in BRCA2mut/+ LP cells (n = 7 patients) compared to control (WT) LP cells (n = 9 patients). Columns correspond to individual patients.
We then examined the response to this genomic stress by analyzing phosphorylation of CHEK1, a central coordinator of the response to replication stress and DNA damage (22, 23). Cytospins of primary epithelial progenitor cultures prepared as above were stained for phosphorylated CHEK1 at baseline or following 4 hours of exposure to HU. As anticipated, control primary epithelia exhibited increased CHEK1 phosphorylation within 4 hours of HU treatment (Fig. 3B). In contrast, however, cells from BRCA2 carriers exhibited a failure to activate CHEK1 in response to HU, despite normal levels of total CHEK1 protein (Fig. 3B and fig. S3A). DNA sequencing of these cells revealed the presence of both wild-type and mutant BRCA2 alleles (Fig. 3C). These findings provide further support for a haploinsufficient phenotype of BRCA2 in the response to genomic stress.
Because we observed a deregulated genomic stress response in vitro, we wanted to know whether this also occurs in vivo. Thus, we carried out RNA sequencing (RNA-seq) analysis of freshly sorted LP and basal epithelial cell populations from BRCA2 carrier tissues or controls (Fig. 1A). Analysis of these data revealed enrichment in BRCA2mut/+ LP cells of an established signature reflecting a failure of the ATR (Ataxia telangiectasia mutated and Rad3-related)/CHEK1 (checkpoint kinase 1)mediated replication stress checkpoint in nontransformed mammary epithelial cells (Fig. 3D and fig. S3B) (24). This replication stress response deficiency signature is known to predict future cancer risk (24), and it contains some of the top most differentially expressed genes between BRCA2mut/+ and control LP cells (Fig. 3D). Among these are genes of potential relevance to HR-positive breast cancer (which comprise 80% of BRCA2-associated breast cancers), including the estrogen receptor target gene HOXC4 and the GATA transcription factorbinding partner gene ZFPM1 (Fig. 3D) (25, 26). Furthermore, evaluation of differentially expressed programs through gene set enrichment analysis (GSEA) revealed the highly significant deregulation of a radiation response signature in BRCA2mut/+ LP cells (fig. S3C) (27). Notably, the differential expression of this signature between BRCA2mut/+ and control cells was far more significant within the LP compared to the basal population, in keeping with the more frequent occurrence of CNVs among LP cells (fig. S3C). Again, consistent with haploinsufficiency for BRCA2, the RNA-seq data showed no evidence for exclusive expression of the mutant allele in BRCA2mut/+ LP cells (fig. S3D). Thus, BRCA2mut/+ LP cells exhibit evidence of aberrant replication stress and DNA damage responses in vivo.
We then turned to examine the downstream consequences of the DNA damage detected in LP cells of BRCA2 carriers. A hallmark genetic event that cooperates with BRCA2 deficiency in cancer pathogenesis is loss of TP53, suggesting that activation of TP53 may be an early barrier to malignant progression in this setting (28). We therefore hypothesized that the failed CHEK1-dependent replication stress response we observed might ultimately lead to DNA double-strand breaks and thereby trigger TP53 activation through a CHEK1-independent pathway (29). Recent studies suggest that CHEK1 is not required for TP53 activation in primary breast epithelial cells following DNA damage (30). RNA-seq analysis did suggest activation of TP53 in BRCA2mut/+ LP cells, evidenced by the increased expression of multiple direct TP53 target genes (Fig. 4A) (31, 32). This in vivo effect was associated with a strong transcriptional profile indicating suppression of nuclear factor B (NF-B) signaling, including numerous cytokine and inflammatory factors associated with the senescence-associated secretory phenotype (SASP) (Fig. 4, B to D). TP53 is known to suppress the NF-B/SASP response (33, 34), and this effect is emerging as a relevant component of TP53-dependent tumor suppression given that accumulation of SASP-expressing cells is an established driver of tumorigenesis (35). We independently validated the corresponding alterations in NF-B protein expression, demonstrating that the NFKB1 (p50) and NFKB2 (p52) subunits were expressed at lower levels in BRCA2 carrier tissues compared to controls (Fig. 4C). Furthermore, knockdown of BRCA2 in nontransformed mammary epithelial cells via lentiviral short hairpin RNA attenuated expression of the same cytokine and NF-B target genes that were down-regulated in BRCA2mut/+ progenitor cells in vivo (fig. S4A). Similar to the damage response signature (fig. S3C), deregulation of the SASP program was selective for LP cells in BRCA2 carriers, as no significant suppression of SASP was observed in the corresponding basal epithelial cells of these same patients (fig. S4B). These results suggest that DNA damage and TP53 activation in BRCA2mut/+ LP cells are associated with suppression of the NF-B/SASP response.
(A) Bar charts show the mean expression levels of canonical TP53 target genes in freshly sorted BRCA2 carrier LP cells (n = 7 patients) compared to controls (WT; n = 9 patients), assessed by RNA-seq. Error bars denote SEM. P values are determined by Mann-Whitney test. *P < 0.05 and **P < 0.01. XPC, Xeroderma pigmentosum group C-complementing protein; FPKM, Fragments Per Kilobase of transcript per Million mapped reads. (B) Heat map depicts down-regulation of NF-B/SASP pathway genes in BRCA2 carrier LP cells compared to controls (WT), assessed by RNA-seq as in (A). Columns correspond to individual patients. Direct NF-B target genes are highlighted in red. (C) Western blot analysis shows that NFKB1 (p50) and NFKB2 (p52) subunits are expressed at lower levels in BRCA2mut/+ breast tissues compared to control (WT) tissues (n = 3 patients per genotype). -Tubulin serves as a loading control. (D) Negative enrichment of a SASP signature in GSEA of RNA-seq data from freshly sorted LP cells of BRCA2 carriers (n = 7 patients) and controls (WT; n = 9 patients). NES, normalized enrichment score; FDR, false discovery rate.
Deregulated DNA damage and senescence/SASP responses in BRCA2 LP cells might be expected to alter the proportion of these cells over time (36). We thus sought to address whether there were differences in the proportions of progenitor or other epithelial subpopulations in BRCA2mut/+ tissues compared to controls. We collected a larger cohort of tissues from BRCA2 carriers (n = 26) and controls (n = 28), then performed flow cytometric analysis on these specimens, and plotted the proportions of each epithelial subpopulation as a function of age for each cohort (Fig. 5A). In noncarrier controls, no significant age-associated changes in the prevalence of these subpopulations were noted. In contrast, BRCA2 carriers showed an age-associated expansion in the proportion of LP cells and a decline in the basal cell fraction (Fig. 5B and fig. S5, A and B). These differences were not accounted for by demographic factors such as parity or menopausal status, as these factors were not associated with significant differences in epithelial cell proportions (fig. S5, C and D). Thus, DNA damage and suppression of a senescence-associated program in BRCA2mut/+ LP cells are accompanied by an age-associated expansion of this progenitor cell compartment (36).
(A) Representative flow cytometry analysis showing distinct epithelial subpopulations (basal, LP, and ML) isolated from breast tissues of control (WT) and BRCA2 mutation carriers following sorting via CD49f and EpCAM staining. Numbers indicate percentages of each epithelial cell subpopulation. (B) Linear regression analysis of LP and basal cell proportions by age for controls (WT) (n = 26 patients) and BRCA2 carriers (n = 28 patients). The LP/basal ratio by patient provides additional validation as it accounts for technical factors that may have subtle effects on absolute cell numbers. (C) TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining of representative control (WT) and BRCA2 carrier tissues. Summary data obtained by counting four fields for five patients per genotype are shown. ****P < 0.0001 by Fishers exact test.
Last, we hypothesized that altered epithelial cell proportions and a deregulated NF-B/SASP program in BRCA2 carrier tissues may be associated with differences in cell proliferation and/or survival in vivo (36). We did not observe strong differences in proliferation assessed by Ki67 staining between these BRCA2 carrier breast tissues and controls, prompting us to ask whether differences in cell survival might contribute to the age-associated expansion of the LP population in this context. We therefore carried out TUNEL (terminal deoxynucleotidyl transferasemediated deoxyuridine triphosphate nick end labeling) staining, an established marker of apoptosis, in BRCA2 carrier tissues and controls. The proportion of TUNEL-positive cells is well documented in normal human breast epithelial tissues, and we observed a similar prevalence of these cells in the control tissues we tested (Fig. 5C) (37). In contrast, however, BRCA2 mutation carrier tissues consistently showed a paucity of TUNEL-positive luminal epithelial cells across all patients tested, in keeping with established links between checkpoint and NF-B suppression and a defective apoptotic response (Fig. 5C) (38, 39). Collectively, our findings suggest that noncancerous BRCA2mut/+ breast tissues exhibit BRCA2 haploinsufficiency and an age-associated accumulation of DNA-damaged luminal epithelial progenitor cells bearing altered checkpoint and survival responses (Fig. 6).
Epithelial progenitor cells of heterozygous germline BRCA2 carriers exhibit DNA damage, failed replication stress, and damage responses, together with attenuated apoptosis. LOH analyses suggest that these findings may reflect a haploinsufficient phenotype for BRCA2 in vivo.
This study advances our understanding of early changes in BRCA2mut/+ breast tissues, defining unanticipated phenotypes in this setting with implications for both cancer risk assessment and prevention. Most of the tissues we studied were deemed to be histologically normal by highly experienced breast pathologists, suggesting that the alterations we report precede clinically defined cellular abnormalities (tables S1 and S3). We present evidence that a failed replication stress response and DNA damage in BRCA2mut/+ tissues result from haploinsufficiency for BRCA2 rather than homozygous loss of function. While the presence of haploinsufficiency for either BRCA1 or BRCA2 in vivo has been controversial, our findings are in accord with data suggesting that LOH for the wild-type BRCA2 is not universal in BRCA2-associated cancers (40). Our observations are also in keeping with a recent report that the BRCA2 protein is selectively susceptible to degradation by environmental aldehydes (41), an effect that could contribute to a haploinsufficient phenotype in cells with only one functional BRCA2 allele. Nonetheless, we analyzed a relatively small number of cells and tissues, and it is difficult to definitively rule out LOH in a subset of cells. Thus, our study suggests, rather than confirms, haploinsufficiency for BRCA2 as a potential initiating event for these cancers.
A prominent feature of the phenotype we have uncovered is frequent subchromosomal aneuploidy, most prevalent within the LP cell population. LP cells are a potential target cell for BRCA2-associated carcinogenesis in the breast, and indeed we observe instances of apparently clonally related genomic alterations among these cells. While our study does not prove that they are direct cancer precursors, these alterations could conceivably represent the earliest somatic genetic abnormalities that underlie these malignancies. Notably, all the CNVs we identified were subchromosomal and therefore are to be distinguished from whole-chromosome gains and losses that are typically later events and associated with TP53 inactivation (42).
Although the early genomic changes we observed are likely to include many passenger events, they, nevertheless, may provide a quantifiable hallmark of the preneoplastic BRCA2 carrier state. Tracking the prevalence of DNA-damaged cells in the clinical setting could possibly improve risk prediction for these women, who are faced with the difficult choice of whether to undergo mastectomy long before cancer develops. Last, the BRCA2 haploinsufficient phenotype we report may portend particular vulnerabilities of certain BRCA2mut/+ cancer precursor cells. Accordingly, this work provides a foundation for future studies seeking to identify improved pharmacologic approaches to cancer prevention in this setting.
Fresh human breast tissues were obtained from the Massachusetts General Hospital with approval by the local Institutional Review Board and signed informed patient consent (protocols 93-085 and 2008-P-1789). Samples were either normal breast tissues from reduction mammoplasties (confirmed by pathology) or noncancerous breast tissues from prophylactic mastectomies of known BRCA1 or BRCA2 mutation carriers. All BRCA1/2 carrier status was determined through clinical germline genetic testing performed by commercial providers before tissue collection.
Tissue samples were minced and digested with collagenase/hyaluronidase (STEMCELL Technologies) in complete EpiCult-B medium supplemented with hydrocortisone (0.48 g/ml; STEMCELL Technologies) overnight at 37C. The resulting suspensions were either cryopreserved or further sequentially digested with 0.25% trypsin, dispase (5 mg/ml), and deoxyribonuclease I (1 mg/ml). Single-cell suspensions were collected by filtration through a 40-m cell strainer.
Cells were blocked with rat immunoglobulin (Jackson ImmunoLabs) and antibody to Fc receptorbinding inhibitor (eBioscience) before incubation with the following primary antibodies: phycoerythrin (PE)conjugated anti-human CD31 (BD Pharmingen), PE-conjugated anti-human CD45 (BD Pharmingen), PE-conjugated anti-human CD235a (BD Pharmingen), BV650-conjugated anti-human epithelial cell adhesion molecule (EpCAM) CD326 (BioLegend), and biotin-conjugated anti-human ITGA6 (eBioscience). Where required, cells were incubated with allophycocyanin-Cy7conjugated streptavidin (BD Pharmingen). Cells were either stained with 4,6-diamidino-2-phenylindole (DAPI) for viability or fixed with 1% paraformaldehyde and stained with the Zombie Aqua Fixable Viability Kit (BioLegend). Viable cells were sorted on a FACSAria flow cytometer (Becton Dickinson). Data were analyzed using FlowJo software (Tree Star).
Microaspirated single cells were transferred into PCR tubes containing lysis buffer [water + proteinase K (400 ng/l) + 17 M SDS], and DNA was amplified by nested PCR using primers flanking BRCA2 mutations. Sanger sequencing was performed by the Center for Computational and Integrative Biology DNA Core Facility at the Massachusetts General Hospital.
Primer sequences for patient 128 (Val3079PhefsX4) are as follows: first PCR, TGGCGTCCATCATCAGATTT (forward) and TCAGAGGTTCAAAGAGGCTTAC (reverse); second PCR, CAGATTTACCAGCCACGGGA (forward) and GCCAACTGGTAGCTCCAACTAA (reverse). Primer sequences for patient 140 (6027del4) are as follows: first PCR, GGGCCACCTGCATTTAGGAT (forward) and TGAGCTGGTCTGAATGTTCGT (reverse); second PCR, GCAGGTTGTTACGAGGCATT (forward) and CCTGGACAGATTTTCCACTTGC (reverse).
Single-cell suspensions from patient samples were plated in ultralow adherence plates in Dulbeccos modified Eagles medium/F12 medium containing insulin (5 g/ml), epidermal growth factor (10 ng/ml), basic fibroblast growth factor (5 ng/ml), heparin (4 g/ml), hydrocortisone (500 ng/ml), B27, GlutaMAX, and penicillin-streptomycin. Cells were either treated with HU (10 mM; Sigma) for 4 hours or left untreated and washed with phosphate-buffered saline (PBS), and alkaline comet assays were performed using a Trevigen Comet Assay kit according to the manufacturers instructions. Olive tail movement was quantified with ImageJ, and 50 individual cells were quantified per condition.
Immunofluorescence for paraffin sections and TUNEL staining were performed by Dana-Farber/Harvard Cancer Center Specialized Histopathology Core. For immunofluorescence in cells, fixation was performed with methanol for 10 min, followed by permeabilization in 0.1% Triton X-100 for 2 min. Blocking was performed with 10% horse serum for 30 min, and cells were further incubated with primary p-CHEK1 antibody (Novus Biologicals) for 2 hours, washed with wash buffer (PBS + 10% horse serum + 0.1% Triton X-100), incubated with appropriate secondary antibody for 1 hour, and stained with DAPI. All immunofluorescence images were captured by a confocal microscope (Leica TCS SP8) and were analyzed by ImageJ.
Snap-frozen tissues were homogenized using Precellys 24 homogenizer (Bertin Technologies). For total protein extraction, cells were lysed in radioimmunoprecipitation assay buffer [10 mM tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1% sodium deoxycholate, 0.1% (w/v) SDS, 1% (v/v) NP-40, proteinase inhibitor cocktail, and phosphatase inhibitor cocktail] for 30 min on ice. Western blotting was performed using NFKB1 p50 (Santa Cruz Biotechnology) and NFKB2 p52 (Millipore) antibodies by standard protocol.
Fresh tissues were dissociated as described above, and single cells were isolated by microaspiration. Genomic DNA was amplified and sequenced as described in (16). Fastqs were aligned using bwa-mem, with resulting bams sorted and duplicates marked using Picard. Coverage was then computed over 500-kb bins across the entire genome. The count for each bin was then divided by the sum across all bins for the relative sample (to correct for library size) and then by the median for that genomic bin across all samples from the same batch. The coverage profiles were then transformed into .wig files and fed into the R package HMMcopy for segmentation and CNV calling. HMMCopy was run with e = 0.9999999 and nu = 5, with all other parameters set to default. A noise statistic termed VS was computed in the same manner as (16), with cells with values greater than or equal to 0.5 being excluded from the analysis. CNVs that mapped to the Y chromosome were less than 10 Mb in size or had an absolute log2 ratio of less than 0.4 that were excluded from the analysis.
Total RNA from sorted cell populations was extracted using an RNeasy FFPE kit according to the manufacturers instructions. Libraries for ribosomally reduced RNA were prepared by the Harvard Biopolymers Facility using directional RNA-seq Wafergen protocol. Libraries were sequenced on Illumina HiSeq 2000 at Next-Generation Sequencing Core at Massachusetts General Hospital. Transcripts per million (TPM) values were computed using Salmon and batch-corrected using ComBat. The two samples with the lowest total counts were excluded from the analysis. GSEA was run on the ComBat-corrected TPM values using phenotype permutation and default parameters. The heat maps in Fig. 4 (B and D) were made using the ComBat-corrected TPM values, subset to the comparison of interest, and transformed into z scores by gene.
P values were determined using Students unpaired t test, unless indicated otherwise.
Supplementary material for this article is available at http://advances.sciencemag.org/cgi/content/full/6/5/eaay2611/DC1
Supplementary Materials and Methods
Fig. S1. Analysis of single-cell WGS data from normal human skin and brain cells.
Fig. S2. Identification and characterization of CNVs in freshly collected BRCA2mut/+ breast epithelial cells.
Fig. S3. Characterization of replication stress response deficiency and haploinsufficiency in BRCA2mut/+ breast epithelial cells.
Fig. S4. Suppression of NF-B/SASP response associated with loss of BRCA2.
Fig. S5. Proportions of mammary epithelial cell subsets in BRCA2 carrier and control tissues.
Table S1. Characteristics of patients undergoing WGS of breast tissues.
Table S2. Summary of single-cell site-specific PCR/sequencing data.
Table S3. Characteristics of patients undergoing RNA-seq of breast tissues.
Reference (43)
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.
Acknowledgments: We thank the HSCI-CRM Flow Cytometry Core Facility for assistance with cell sorting and the MGH DF/HCC Specialized Histopathology Service Core for immunostaining experiments. We thank the Biopolymers Facility at Harvard Medical School for library processing of RNA samples and the MGH Next Generation Sequencing Core for performing RNA-seq. We are grateful to the MIT BioMicroCenter for performing genome sequencing reactions. Funding: This work was supported by DOD/CDMRP grant BC140903 (to L.W.E.), the Tracey Davis Breast Cancer Research Fund (to L.W.E.), the Weissman Family MGH Research Scholar grant (to L.W.E.), the Susan G. Komen Foundation grant PDF16380794 (to M.K.-Y.), a Terri Brodeur Breast Cancer Foundation grant 2016D001483 (to M.K.-Y.), and the Howard Hughes Medical Institute (to A.A.). Author contributions: M.K.-Y., A.A., and L.W.E. conceived and designed the study. M.C.S. contributed patient samples. M.K.-Y., R.E.S., and S.V.S. designed and performed the experiments and interpreted the data. H.R., R.M., and V.V. performed the experiments. M.K.-Y., S.V.S., E.Z., A.D., and M.Y. performed the data analysis. M.K.-Y., A.L., K.N.R., S.R., and M.L. performed the bioinformatic analysis and interpreted the data. L.W.E., A.A., and M.L. conceived the experiments, interpreted the data, and provided the funding. L.W.E. and M.K.-Y. wrote the manuscript. All authors approved the final submitted manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.
Read the original here:
Aneuploidy and a deregulated DNA damage response suggest haploinsufficiency in breast tissues of BRCA2 mutation carriers - Science Advances
Osaka University transplants iPS cell-based heart cells in world’s first clinical trial – The Japan Times
OSAKA An Osaka University team said it has carried out the worlds first transplant of cardiac muscle cells created from iPS cells in a physician-initiated clinical trial.
In the clinical project to verify the safety and efficacy of the therapy using induced pluripotent stem cells, Yoshiki Sawa, a professor in the universitys cardiovascular surgery unit, and colleagues aim to transplant heart muscle cell sheets over the course of three years into 10 patients suffering from serious heart malfunction caused by ischemic cardiomyopathy.
As part of its first step in the project, the team conducted an operation on a patient this month, which was a success. The patient has since moved to the general ward at a hospital.
The cells on the degradable sheets attached to the surface of the patients hearts are expected to grow and secrete a protein that can regenerate blood vessels and improve cardiac function. The iPS cells have already been derived from healthy donors blood cells and stored.
Each sheet is around 4 to 5 centimeters wide and 0.1 millimeter thick.
The team will continue to monitor the patient over the next year.
I hope that (the transplant) will become a medical technology that will save as many people as possible, as Ive seen many lives that I couldnt save, Sawa said at a news conference.
The researchers said Monday they decided to conduct a clinical trial instead of a clinical study in hopes of obtaining approval from the health ministry for clinical applications as soon as possible.
The trial involves stringently evaluating risks, particularly cancer probabilities, and the efficacy of transplanting some 100 million cells per patient that may include tumor cells.
This is the second iPS cell-based clinical trial in Japan. The first was conducted on eye disease patients by the Riken research institute.