Archive for the ‘Crispr’ Category

Dunn GP, Old LJ, Schreiber RD. The immunobiology of cancer immunosurveillance and immunoediting. Immunity. 2004;21:13748.

Article CAS PubMed Google Scholar

Waldman AD, Fritz JM, Lenardo MJ. A guide to cancer immunotherapy: from T cell basic science to clinical practice. Nat Rev Immunol. 2020;20:118.

Article Google Scholar

Baulu E, Gardet C, Chuvin N, Depil S. TCR-engineered T cell therapy in solid tumors: state of the art and perspectives. Sci Adv. 2023;9:eadf3700.

Article CAS PubMed PubMed Central Google Scholar

Lemoine J, Ruella M, Houot R. Born to survive: how cancer cells resist CAR T cell therapy. J Hematol Oncol. 2021;14:199.

Article PubMed PubMed Central Google Scholar

Rodrigo S, Senasinghe K, Quazi S. Molecular and therapeutic effect of CRISPR in treating cancer. Med Oncol. 2023;40:81.

Article CAS PubMed PubMed Central Google Scholar

Tomasik J, Jasiski M, Basak GW. Next generations of CAR-T cells - new therapeutic opportunities in hematology? Front Immunol. 2022;13:1034707.

Article CAS PubMed PubMed Central Google Scholar

Zhu X, Li Q, Zhu X. Mechanisms of CAR T cell exhaustion and current counteraction strategies. Front Cell Dev Biol. 2022;10:1034257.

Article PubMed PubMed Central Google Scholar

Ren P, Zhang C, Li W, Wang X, Liang A, Yang G, et al. CAR-T therapy in clinical practice: technical advances and current challenges. Adv Biol (Weinh). 2022;6:e2101262.

Article PubMed Google Scholar

Verma NK, Wong BHS, Poh ZS, Udayakumar A, Verma R, Goh RKJ, et al. Obstacles for T-lymphocytes in the tumour microenvironment: therapeutic challenges, advances and opportunities beyond immune checkpoint. EBioMedicine. 2022;83:104216.

Article CAS PubMed PubMed Central Google Scholar

Young RM, Engel NW, Uslu U, Wellhausen N, June CH. Next-Generation CAR T-cell therapies. Cancer Discov. 2022;12:162533.

Article CAS PubMed PubMed Central Google Scholar

Shen C, Zhang Z, Zhang Y. Chimeric antigen receptor T cell exhaustion during treatment for hematological malignancies. Biomed Res Int. 2020;2020:8765028.

Article PubMed PubMed Central Google Scholar

McLane LM, Abdel-Hakeem MS, Wherry EJ. CD8 T cell exhaustion during chronic viral infection and cancer. Annu Rev Immunol. 2019;37:45795.

Article CAS PubMed Google Scholar

Anderson KG, Stromnes IM, Greenberg PD. Obstacles posed by the tumor microenvironment to T cell activity: a case for synergistic therapies. Cancer Cell. 2017;31:31125.

Article CAS PubMed PubMed Central Google Scholar

Cheng H, Ma K, Zhang L, Li G. The tumor microenvironment shapes the molecular characteristics of exhausted CD8+ T cells. Cancer Lett. 2021;506:5566.

Article CAS PubMed Google Scholar

Gumber D, Wang LD. Improving CAR-T immunotherapy: overcoming the challenges of T cell exhaustion. EBioMedicine. 2022;77:103941.

Article CAS PubMed PubMed Central Google Scholar

Bucks CM, Norton JA, Boesteanu AC, Mueller YM, Katsikis PD. Chronic antigen stimulation alone Is sufficient to drive CD8+ T cell exhaustion. J Immunol. 2009;182:6697708.

Article CAS PubMed Google Scholar

Yin Z, Bai L, Li W, Zeng T, Tian H, Cui J. Targeting T cell metabolism in the tumor microenvironment: an anti-cancer therapeutic strategy. J Exp Clin Cancer Res. 2019;38:403.

Article PubMed PubMed Central Google Scholar

Bader JE, Voss K, Rathmell JC. Targeting metabolism to improve the tumor microenvironment for cancer immunotherapy. Mol Cell. 2020;78:101933.

Article CAS PubMed PubMed Central Google Scholar

Peng HY, Lucavs J, Ballard D, Das JK, Kumar A, Wang L, et al. Metabolic reprogramming and reactive oxygen species in T cell immunity. Front Immunol. 2021;12:652687.

Article CAS PubMed PubMed Central Google Scholar

Watson MJ, Delgoffe GM. Fighting in a wasteland: deleterious metabolites and antitumor immunity. J Clin Invest. 2022;132:e148549.

Article CAS PubMed PubMed Central Google Scholar

Zhang Z, Liu S, Zhang B, Qiao L, Zhang Y, Zhang Y. T Cell dysfunction and exhaustion in cancer. Front Cell Dev Biol. 2020. https://doi.org/10.3389/fcell.2020.00017.

Wang S, Wu J, Shen H, Wang J. The prognostic value of IDO expression in solid tumors: a systematic review and meta-analysis. BMC Cancer. 2020;20:471.

Article CAS PubMed PubMed Central Google Scholar

Allard B, Longhi MS, Robson SC, Stagg J. The ectonucleotidases CD39 and CD73: novel checkpoint inhibitor targets. Immunol Rev. 2017;276:12144.

Article CAS PubMed PubMed Central Google Scholar

Fang L, Liu K, Liu C, Wang X, Ma W, Xu W, et al. Tumor accomplice: T cell exhaustion induced by chronic inflammation. Front Immunol. 2022;13:979116.

Article CAS PubMed PubMed Central Google Scholar

Soriano-Baguet L, Brenner D. Metabolism and epigenetics at the heart of T cell function. Trends Immunol. 2023;44:23144.

Article CAS PubMed Google Scholar

Wherry EJ. T cell exhaustion. Nat Immunol. 2011;12:4929.

Article CAS PubMed Google Scholar

Blank CU, Haining WN, Held W, Hogan PG, Kallies A, Lugli E, et al. Defining T cell exhaustion . Nat Rev Immunol. 2019;19:66574.

Article CAS PubMed PubMed Central Google Scholar

Catakovic K, Klieser E, Neureiter D, Geisberger R. T cell exhaustion: from pathophysiological basics to tumor immunotherapy. Cell Commun Signal. 2017;15:1.

Article PubMed PubMed Central Google Scholar

Fuertes Marraco SA, Neubert NJ, Verdeil G, Speiser DE. Inhibitory receptors beyond T Cell Exhaustion. Front Immunol. 2015;6:310.

Article PubMed PubMed Central Google Scholar

Huang Y, Si X, Shao M, Teng X, Xiao G, Huang H. Rewiring mitochondrial metabolism to counteract exhaustion of CAR-T cells. J Hematol Oncol. 2022;15:38.

Article CAS PubMed PubMed Central Google Scholar

Pereira RM, Hogan PG, Rao A, Martinez GJ. Transcriptional and epigenetic regulation of T cell hyporesponsiveness. J Leukoc Biol. 2017;102:60115.

Article CAS PubMed PubMed Central Google Scholar

Seo H, Chen J, Gonzlez-Avalos E, Samaniego-Castruita D, Das A, Wang YH, et al. TOX and TOX2 transcription factors cooperate with NR4A transcription factors to impose CD8+ T cell exhaustion. Proc Natl Acad Sci USA. 2019;116:124105.

Article CAS PubMed PubMed Central Google Scholar

Chi X, Luo S, Ye P, Hwang WL, Cha JH, Yan X, et al. T-cell exhaustion and stemness in antitumor immunity: characteristics, mechanisms, and implications. Front Immunol. 2023;14:1104771.

Article CAS PubMed PubMed Central Google Scholar

Fujiwara Y, Kato T, Hasegawa F, Sunahara M, Tsurumaki Y. The past, present, and future of clinically applied chimeric antigen receptor-T-cell therapy. Pharm (Basel). 2022;15:207.

CAS Google Scholar

Watanabe N, Mo F, McKenna MK. Impact of manufacturing procedures on CAR T cell functionality. Front Immunol. 2022;13:876339.

Article CAS PubMed PubMed Central Google Scholar

Zhang Y, Xu Y, Dang X, Zhu Z, Qian W, Liang A, et al. Challenges and optimal strategies of CAR T therapy for hematological malignancies. Chin Med J (Engl). 2023;136:26979.

Article CAS PubMed Google Scholar

Zhou Z, Tao C, Li J, Tang JCO, Chan ASC, Zhou Y. Chimeric antigen receptor T cells applied to solid tumors. Front Immunol. 2022;13:984864.

Article CAS PubMed PubMed Central Google Scholar

Chow A, Perica K, Klebanoff CA, Wolchok JD. Clinical implications of T cell exhaustion for cancer immunotherapy. Nat Rev Clin Oncol. 2022;19:77590.

Article PubMed PubMed Central Google Scholar

Hosseinkhani N, Derakhshani A, Kooshkaki O, Abdoli Shadbad M, Hajiasgharzadeh K, Baghbanzadeh A, et al. Immune checkpoints and CAR-T cells: the pioneers in future cancer therapies? Int J Mol Sci. 2020;21:8305.

Article CAS PubMed PubMed Central Google Scholar

Mirzaei HR, Pourghadamyari H, Rahmati M, Mohammadi A, Nahand JS, Rezaei A, et al. Gene-knocked out chimeric antigen receptor (CAR) T cells: Tuning up for the next generation cancer immunotherapy. Cancer Lett. 2018;423:95104.

Article CAS PubMed Google Scholar

Gonzlez Castro N, Bjelic J, Malhotra G, Huang C, Alsaffar SH. Comparison of the feasibility, efficiency, and safety of genome editing technologies. Int J Mol Sci. 2021;22:10355.

Article PubMed PubMed Central Google Scholar

Gonzlez-Romero E, Martnez-Valiente C, Garca-Ruiz C, Vzquez-Manrique RP, Cervera J, Sanjuan-Pla A. CRISPR to fix bad blood: a new tool in basic and clinical hematology. Haematologica. 2019;104:88193.

Article PubMed PubMed Central Google Scholar

Gilles AF, Averof M. Functional genetics for all: engineered nucleases, CRISPR and the gene editing revolution. EvoDevo 2014;5:43.

Article PubMed PubMed Central Google Scholar

Hirakawa MP, Krishnakumar R, Timlin JA, Carney JP, Butler KS. Gene editing and CRISPR in the clinic: current and future perspectives. Biosci Rep. 2020;40:BSR20200127.

Article CAS PubMed PubMed Central Google Scholar

Khan A, Sarkar E. CRISPR/Cas9 encouraged CAR-T cell immunotherapy reporting efficient and safe clinical results towards cancer. Cancer Treat Res Commun. 2022;33:100641.

Article PubMed Google Scholar

Stadtmauer EA, Fraietta JA, Davis MM, Cohen AD, Weber KL, Lancaster E, et al. CRISPR-engineered T cells in patients with refractory cancer. Science. 2020;367:7365.

Article Google Scholar

Lu Y, Xue J, Deng T, Zhou X, Yu K, Deng L, et al. Safety and feasibility of CRISPR-edited T cells in patients with refractory non-small-cell lung cancer. Nat Med. 2020;26:73240.

Article CAS PubMed Google Scholar

Nidhi S, Anand U, Oleksak P, Tripathi P, Lal JA, Thomas G, et al. Novel CRISPRCas systems: an updated review of the current achievements, applications, and future research perspectives. Int J Mol Sci 24 mars. 2021;22:3327.

Article CAS Google Scholar

Asmamaw M, Zawdie B. Mechanism and applications of CRISPR/Cas-9-mediated genome editing. Biologics. 2021;15:35361.

PubMed PubMed Central Google Scholar

Peng R, Lin G, Li J. Potential pitfalls of CRISPR/Cas9-mediated genome editing. FEBS J. 2016;283:121831.

Article CAS PubMed Google Scholar

Pickar-Oliver A, Gersbach CA. The next generation of CRISPRCas technologies and applications. Nat Rev Mol Cell Biol. 2019;20:490507.

Read the original here:
CRISPR-Cas gene knockouts to optimize engineered T cells for cancer immunotherapy | Cancer Gene Therapy - Nature.com

The discovery of Clustered Regularly Interspaced Short Palindromic Repeats (widely known as just CRISPR) has been revolutionary in many ways. For one, it has transformed disease research. Just recently, scientists revealed they could cut HIV out of cells using the gene-editing technology, and it also has the potential to completely change the way cancer is treated, too. But CRISPRs abilities dont end there. It could also change the way that food tastes (making healthier foods more appealing to children, for example), and even save the food system from the brutal impact of the climate crisis.

Right now, extreme weather events, including drought, heatwaves, and floods, threaten essential crops all over the world. In fact, one 2021 study from NASA suggested that the impact of global climate change could impact crops within the decade. Maize yields are a particular concern, as the research suggested they could drop by 24 percent. A 20 percent decrease from current production levels could have severe implications worldwide, Jonas Jgermeyr, crop modeler and climate scientist, said at the time.

But, by improving their resilience, CRISPR could help to save more crops from falling foul to extreme weather events, which, as the human-driven climate crisis intensifies, are only set to become more common over the coming years.

Pexels

CRISPR is, essentially, a revolutionary gene-editing technology. Adapted from a naturally occurring defense mechanism found in bacteria, the system enables scientists to make precise changes to the DNA of organisms. In 2020, Emmanuelle Charpentier and Jennifer Douda were awarded the Nobel Prize in Chemistry for pioneering CRISPR-Cas9. The technology is also known as genetic scissors, because of the way it can help researchers cut DNA.

The statement from The Nobel Prize at the time noted that, since 2012, when Charpentier and Doudna first discovered the CRISPR-Cas9 genetic scissors, it has contributed to many important discoveries in basic research, adding that as well as leading to major breakthroughs in curing inherited diseases, plant researchers have been able to develop crops that withstand mold, pests, and drought.

In terms of crops, CRISPR can help scientists change and insert DNA into plants to make them more resistant to harsher surroundings. It could help make them less vulnerable to extreme temperatures, for example, and even help increase crop yield to produce more food for more people.

Pexels

CRISPR is already helping scientists to overcome major challenges in the food system. In January 2024, for example, a paper published in Nature revealed that researchers in Kenya are working on making sorghuma staple food across many African countriesmore resilient to a parasitic weed, called Striga, using the gene-editing technology.

In Singapore, a company called Singrow launched the worlds first climate-resilient strawberry last year, which was also created with the help of CRISPR. In North Carolina, the scientists behind the food startup Pairwise are developing more nutritious crops, produce higher yields, and require fewer resources to grow with the technology. Earlier this year, the company was even acknowledged by Time Magazine as one of Americas Top Greentech Companies.

These companies are far from alone. According to the food innovation platform Forward Fooding, more than 50 companies around the world are currently using DNA technology to improve crops. It notes that since 2013, they have raised around 2.3 billion in funding.

CRISPR is not perfect. Its important to note that this technology is still new, and more research is needed into the long-term effects of gene-editing crops. But so far, the progress is promising.

As well as a move away from animal agriculture, which is widely considered by scientists to be depleting the earth of natural resources and driving up emissions, CRISPR could be one of the key factors in building a more sustainable, resilient, nutritious food system, which may also be able to feed more people than ever.

Charlotte is a writer and editor based in sunny Southsea on England's southern coast.

Original post:
Revolutionary CRISPR Technology Is Helping Make Crops More Resilient to the Climate Crisis - VegNews

Greater use of CRISPR-based therapies in clinical trials is expected to drive further advancements in precision medicine, GlobalData states.

There has been a notable rise in licensing agreements for innovator drugs incorporating clustered regularly interspaced short palindromic repeats (CRISPR)-based technology for gene therapies over the past five years, according to data and analytics firm GlobalData.

These agreements have amassed a total deal value of $21 billion. Of note, between 2020 to 2022, there was a remarkable surge in deal worth. For agreements relating to or involving treatments for haematological disorders, the total deal value reached $1.8 billion, the research found.

For instance, the approval of Casgevy in the US in December 2023 signified a breakthrough in gene therapy. Vertex Pharmaceuticals treatment was subsequently the first CRISPR/Cas9 gene-edited therapy to be granted a marketing authorisation by the European Commission (EC) in February 2024.

Innovator drugs harnessing CRISPR technologies saw 182 percent growth in total licensing agreement deal value from $5.6 billion in 2020 to $15.8 billion in 2022. Among the top three therapy areas, oncology represented over half of the total deal value with $11.9 billion, followed by immunology with $6.7 billion, and central nervous system with $2.2 billion, Ophelia Chan, Business Fundamentals Analyst at GlobalData explained.

GlobalData highlighted that the largest CRISPR-based deal of 2023 was Eli Lilys subsidiary, Prevail Therapeutics gaining rights to Scribe Therapeuticss CRISPR X-Editing (XE) technologies. In a deal potentially worth over $1.57 billion, the agreement seeks to advance in vivotherapies for targets that cause serious neurological and neuromuscular diseases.

The increasing presence of CRISPR-based therapies in clinical trials is anticipated to fuel further advancements in precision medicine

CRISPR technology is transforming targeted gene therapies for diverse unmet diseases by precisely targeting diverse genomic sites, promising tailored treatments and improved patient outcomes. The increasing presence of CRISPR-based therapies in clinical trials is anticipated to fuel further advancements in precision medicine, Chan stated.

In other recent gene therapy news, last month the US Food and Drug Administration (FDA) authorised Lenmeldy (atidarsagene autotemcel) for children with early-onset metachromatic leukodystrophy (MLD).

Anti-Cancer Therapeutics, Big Pharma, Biopharmaceuticals, business news, Clinical Development, Clinical Trials, Data Analysis, Drug Development, Drug Markets, Drug Safety, Gene therapy, Industry Insight, Research & Development (R&D), Technology, Therapeutics

Read more from the original source:
CRISPR technologies fuelling haematological innovations - European Pharmaceutical Review

Kelly Banas, Ph.D., principal investigator at ChristianaCares Gene Editing Institute, will present her latest research discovery related to targeting the NRF2 gene in cancer cells at the first CRISPR Medicine Conference held in Copenhagen, Denmark, April 22 to 25. The Gene Editing Institutes research has focused on the NRF2 gene and the strong immune response []

The post Kelly Banas, Ph.D., To Present Her Latest Discovery at CRISPR Medicines First International Conference appeared first on ChristianaCare News.

Gold Alert Issued for Two Missing Dover Children1 day ago

I-95 Drive to Save Lives Commences During National Distracted Driving Awareness Month April 20241 day ago

State Police Asking for Witnesses Following Fatal Pedestrian Hit-and-Run Crash in Newark1 day ago

State Police Investigating a Pedestrian Killed by a Train Near Newark1 day ago

Post Views: 270

Share this Post

View original post here:
Kelly Banas, Ph.D., To Present Her Latest Discovery at CRISPR Medicine's First International Conference - Milford LIVE

CRISPR technology offers the promise to cure human genetic diseases with gene editing. This promise became a reality when the worlds first CRISPR therapy was approved by regulators to treat patients with sickle cell disease and beta-thalassemia last year.

American biopharma Vertex Pharmaceuticals CASGEVY works by turning on the BCL11A gene, which codes for fetal hemoglobin. While this form of hemoglobin is produced before a baby is born, the body begins to deactivate the gene after birth. As both sickle cell disease and beta-thalassemia are blood disorders that affect hemoglobin, by switching on the gene responsible for fetal hemoglobin production, CASGEVY presents a curative, one-time treatment for patients.

As CASGEVYs clearance is a significant milestone, the technology has come a long way. CRISPR/Cas9 was first used as a gene-editing tool in 2012. Over the years, the technology exploded in popularity thanks to its potential for making gene editing faster, cheaper, and easier than ever before.

CRISPR is short for clustered regularly interspaced short palindromic repeats. The term makes reference to a series of repetitive patterns found in the DNA of bacteria that form the basis of a primitive immune system, defending them from viral invaders by cutting their DNA.

Using this natural process as a basis, scientists developed a gene-editing tool called CRISPR/Cas that can cut a specific DNA sequence by simply providing it with an RNA template of the target sequence. This allows scientists to add, delete, or replace elements within the target DNA sequence. Slicing a specific part of a genes DNA sequence with the help of the Cas9 enzyme, aids in DNA repair.

This system represented a big leap from previous gene-editing technologies, which required designing and making a custom DNA-cutting enzyme for each target sequence rather than simply providing an RNA guide, which is much simpler to synthesize.

CRISPR gene editing has already changed the way scientists do research, allowing a wide range of applications across multiple fields. Here are some of the diseases that scientists aim to tackle using CRISPR/Cas technology, testing its possibilities and limits as a medical tool.

Cancer is a complex, multifactorial disease, and a cure remains elusive. There are hundreds of different types of cancer, each with a unique mutation signature. CRISPR technology is a game-changer for cancer research and treatment as it can be used for many things, including screening for cancer drivers, identifying genes and proteins that can be targeted by cancer drugs, cancer diagnostics, and as a treatment.

China spearheaded the first in-human clinical trials using CRISPR/Cas9 as a cancer treatment. The study tested the use of CRISPR to modify immune T cells extracted from a patient with late-stage lung cancer. The gene-editing technology was used to remove the gene that encodes for a protein called PD-1 that some tumor cells can bind to to block the immune response against cancer. This protein found on the surface of immune cells is the target of some cancer drugs termed checkpoint inhibitors.

CRISPR technology has also been applied to improve the efficacy and safety profiles of cancer immunotherapy, such as CAR-T cell and natural killer cell therapies. In the U.S., CRISPR Therapeutics is one of the leading companies in this space, developing off-the-shelf, gene-edited T cell therapies using CRISPR, with two candidates targeting CD19 and CD70 proteins in clinical trials.

In 2022, the FDA granted Orphan Drug designation to Intellia Therapeutics CRISPR/Cas9-gene-edited T cell therapy for acute myeloid leukemia (AML). Currently, Vor BioPharmas VOR33 is undergoing phase 2 trials to treat AML, and the CRISPR trial is one to watch, according to a report published by Clinical Trials Arena earlier this year.

However, CRISPR technology still has limitations, including variable efficiency in the genome-editing process and off-target effects. Some experts have recommended that the long-term safety of the approach remain under review. Others have suggested using more precise gene-editing approaches such as base editing, an offshoot of CRISPR that hit the clinic in the U.S. last year.

There are several ways CRISPR could help us in the fight against AIDS. One is using CRISPR to cut the viral DNA that the HIV virus inserts within the DNA of immune cells. This approach could be used to attack the virus in its hidden, inactive form, which is what makes it impossible for most therapies to completely get rid of the virus.

The first ever patient with HIV was dosed with a CRISPR-based gene-editing therapy in a phase 1/2 trial led by Excision Biotherapeutics and researchers at the Lewis Katz School of Medicine at Temple University in Philadelphia back in 2022.

The decision to move the therapy to the clinic was bolstered by the success of an analog of the drug EBT-101 called EBT-001 in rhesus macaques infected with simian immunodeficiency virus (SIV). In a phase 1/2 study, EBT-101 was found to be safe.

Another approach could make us resistant to HIV infections. A small percentage of the worlds population is born with a natural resistance to HIV, thanks to a mutation in a gene known as CCR5, which encodes for a protein on the surface of immune cells that HIV uses as an entry point to infect the cells. The mutation changes the structure of the protein so that the virus is no longer able to bind to it.

This approach was used in a highly controversial case in China in 2018, where human embryos were genetically edited to make them resistant to HIV infections. The experiment caused outrage among the scientific community, with some studies pointing out that the CRISPR babies might be at a higher risk of dying younger.

The general consensus seems to be that more research is needed before this approach can be used in humans, especially as recent studies have pointed out this practice can have a high risk of unintended genetic edits in embryos.

Cystic fibrosis is a genetic disease that causes severe respiratory problems. Cystic fibrosis can be caused by multiple different mutations in the target gene CFTR more than 700 of which have been identified making it difficult to develop a drug for each mutation. With CRISPR technology, mutations that cause cystic fibrosis can be individually edited.

In 2020, researchers in the Netherlands used base editing to repair CFTR mutations in vitro in the cells of people with cystic fibrosis without creating damage elsewhere in their genetic code. Moreover, aiming to strike again with yet another win is the duo Vertex Pharmaceuticals and CRISPR Therapeutics, which have collaborated to develop a CRISPR-based medicine for cystic fibrosis. However, it might be a while until it enters the clinic as it is currently in the research phase.

Duchenne muscular dystrophy is caused by mutations in the DMD gene, which encodes for a protein necessary for the contraction of muscles. Children born with this disease experience progressive muscle degeneration, and existing treatments are limited to a fraction of patients with the condition.

Research in mice has shown CRISPR technology could be used to fix the multiple genetic mutations behind the disease. In 2018, a group of researchers in the U.S. used CRISPR to cut at 12 strategic mutation hotspots covering the majority of the estimated 3,000 different mutations that cause this muscular disease. Following this study, Exonics Therapeutics was spun out to further develop this approach, which was then acquired by Vertex Pharmaceuticals for approximately $1 billion to accelerate drug development for the disorder. Currently, Vertex is in the research stage, and is on a mission to restore dystrophin protein expression by targeting mutations in the dystrophin gene.

However, a CRISPR trial run by the Boston non-profit Cure Rare Disease targeting a rare DMD mutation resulted in the death of a patient owing to toxicity back in November 2022. Further research is needed to ensure the safety of the drug to treat the disease.

Huntingtons disease is a neurodegenerative condition with a strong genetic component. The disease is caused by an abnormal repetition of a certain DNA sequence within the huntingtin gene. The higher the number of copies, the earlier the disease will manifest itself.

Treating Huntingtons can be tricky, as any off-target effects of CRISPR in the brain could have very dangerous consequences. To reduce the risk, scientists are looking at ways to tweak the genome-editing tool to make it safer.

In 2018, researchers at the Childrens Hospital of Philadelphia revealed a version of CRISPR/Cas9 that includes a self-destruct button. A group of Polish researchers opted instead for pairing CRISPR/Cas9 with an enzyme called nickase to make the gene editing more precise.

More recently, researchers at the University of Illinois Urbana-Champaign used CRISPR/Cas13, instead of Cas9, to target and cut mRNA that codes for the mutant proteins responsible for Huntingtons disease. This technique silences mutant genes while avoiding changes to the cells DNA, thereby minimizing permanent off-target mutations because RNA molecules are transient and degrade after a few hours.

In addition, a 2023 study published in Nature went on to prove that treatment of Huntingtons disease in mice delayed disease progression and that it protected certain neurons from cell death in the mice.

With CASGEVYs go-ahead to treat transfusion-dependent beta-thalassemia and sickle cell disease in patients aged 12 and older, this hints that CRISPR-based medicines could even be a curative therapy to treat other blood disorders like hemophilia.

Hemophilia is caused by mutations that impair the activity of proteins that are required for blood clotting. Although Intellia severed its partnership with multinational biopharma Regeneron to advance its CRISPR candidate for hemophilia B a drug that was recently cleared by the FDA to enter the clinic the latter will take the drug ahead on its own.

As hemophilia B is caused by mutations in the F9 gene, which encodes a clotting protein called factor IX (FIX), Regenerons drug candidate uses CRISPR/Cas9 gene editing to place a copy of the F9 gene in cells in order to get the taps running for FIX production.

The two biopharmas will continue their collaboration in developing their CRISPR candidate to treat hemophilia A, which manifests as excessive bleeding because of a deficit of factor VIII. The therapy is currently in the research phase.

While healthcare companies were creating polymerase chain reaction (PCR) tests to screen for COVID-19 in the wake of the pandemic, CRISPR was also being put to use for speedy screening. A study conducted by researchers in China in 2023, found that the CRISPR-SARS-CoV-2 test had a comparable performance with RT-PCR, but it did have several advantages like short assay time, low cost, and no requirement for expensive equipment, over RT-PCRs.

To add to that, the gene editing tool could fight COVID-19 and other viral infections.

For instance, scientists at Stanford University developed a method to program a version of the gene editing technology known as CRISPR/Cas13a to cut and destroy the genetic material of the virus behind COVID-19 to stop it from infecting lung cells. This approach, termed PAC-MAN, helped reduce the amount of virus in solution by more than 90 percent.

Another research group at the Georgia Institute of Technology used a similar approach to destroy the virus before it enters the cell. The method was tested in live animals, improving the symptoms of hamsters infected with COVID-19. The treatment also worked on mice infected with influenza, and the researchers believe it could be effective against 99 percent of all existing influenza strains.

As European, U.S., and U.K. regulators have given their stamp of approval for the first-ever CRISPR-based drug to treat patients, who is to say we wont see another CRISPR-drug hitting this milestone in the near future.

And apart from the diseases mentioned, CRISPR is also being studied to treat other conditions like vision and hearing loss. In blindness caused by mutations, CRISPR gene editing could eliminate mutated genes in the DNA and replace them with normal versions of the genes. Researchers have also demonstrated how getting rid of the mutations in the Atp2b2 and Tmc1 genes helped partially restore hearing.

However, one of the biggest challenges to turn CRISPR research into real cures is the many unknowns regarding the potential risks of CRISPR therapy. Some scientists are concerned about possible off-target effects as well as immune reactions to the gene-editing tool. But as research progresses, scientists are proposing and testing a wide range of approaches to tweak and improve CRISPR in order to increase its efficacy and safety.

Hopes are high that CRISPR technology will soon provide a way to address complex diseases such as cancer and AIDS, and even target genes associated with mental health disorders.

New technologies related to CRISPR research:

This article was originally published in June 2018, and has since been updated by Roohi Mariam Peter.

Read more here:
Seven diseases that CRISPR technology could cure - Labiotech.eu

ZUG, Switzerland and BOSTON, April 01, 2024 (GLOBE NEWSWIRE) -- CRISPR Therapeutics(Nasdaq: CRSP), a biopharmaceutical company focused on creating transformative gene-based medicines for serious diseases, today announced an oral presentation at the American Society of Gene & Cell Therapy (ASGCT) 2024 Annual Meeting, taking place May 7 11, 2024, in Baltimore, MD and virtually.

Title: Development of an In Vivo Non-Viral Ocular Editing Platform and Application to Potential Treatments for Glaucoma Session Type: In-Person Oral Presentation Session Title: Ophthalmic and Auditory: Delivery Innovations Abstract Number:87 Location: Room 318 323 Session Date and Time: Wednesday, May 8, 2024, 1:30 p.m. 3:15 p.m. ET

Abstracts will be released to the public on April 22, 2024, at 4:30 p.m. ET at https://annualmeeting.asgct.org/. The data are embargoed until 6:00 a.m. ET on the presentation day, Wednesday May 8, 2024. A copy of the presentation will be available at http://www.crisprtx.com once the presentation concludes.

About CRISPR Therapeutics Since its inception over a decade ago, CRISPR Therapeutics has transformed from a research-stage company advancing programs in the field of gene editing, to a company with a diverse portfolio of product candidates across a broad range of disease areas including hemoglobinopathies, oncology, regenerative medicine, cardiovascular and rare diseases. The Nobel Prize-winning CRISPR science has revolutionized biomedical research and represents a powerful, clinically validated approach with the potential to create a new class of potentially transformative medicines. To accelerate and expand its efforts, CRISPR Therapeutics has established strategic partnerships with leading companies including Bayer and Vertex Pharmaceuticals. CRISPR Therapeutics AG is headquartered in Zug, Switzerland, with its wholly-owned U.S. subsidiary, CRISPR Therapeutics, Inc., and R&D operations based in Boston, Massachusetts and San Francisco, California, and business offices in London, United Kingdom. To learn more, visit http://www.crisprtx.com.

Investor Contact: Susan Kim +1-617-307-7503 susan.kim@crisprtx.com

Media Contact: Rachel Eides +1-617-315-4493 rachel.eides@crisprtx.com

Read more:
CRISPR Therapeutics to Present at the American Society of Gene & Cell Therapy (ASGCT) 2024 Annual Meeting - GlobeNewswire

One of the most significant challenges in treating HIV is the virus ability to integrate its genome into the hosts DNA. This means that lifelong antiretroviral therapy is essential as latent HIV can reactivate from reservoirs as soon as treatment ends.

One potential technique being developed to address this problem is the use of gene editing technology to cut out and incapacitate HIV from infected cells. Currently, there is a Phase I/II Clinical Trial underway in people with HIV-1 (the most common strain of HIV)

Now, new research from another team shows that gene editing can be used to eliminate all traces of the HIV virus from infected cells in the laboratory.

The research is being presented early ahead of the European Congress of Clinical Microbiology and Infectious Diseases, which will be held from 27-30 April in Barcelona, Spain. Its been carried out by scientists from the Amsterdam Medical University in the Netherlands, and the Paul Ehrlich Institute in Germany, and has not yet been submitted for peer review.

Our aim is to develop a robust and safe combinatorial CRISPR-Cas regimen, striving for an inclusive HIV cure for all that can inactivate diverse HIV strains across various cellular contexts, they write in a conference abstract submitted ahead of ECCMID.

CRISPR-Cas gene editing technology acts like molecular scissors to cut DNA and either delete unwanted genes or introduce new genetic material, while guidance RNA (gRNA) tells CRISPR-Cas exactly where to cut at designated spots on the genome.

In this research, the authors used 2 gRNAs that target conserved parts of the viral genome this means they remain the same or conserved across all known HIV strains. This genetic sequence does not have a match in human genes, to prevent the system going off target and causing mutations elsewhere in the human genome.

The hope is to one day provide a broad-spectrum therapy capable of combating multiple HIV variants effectively. But before this dream can become a reality, the researchers had to address a number of issues with getting the CRISPR-Cas reagents into the right cells.

To delivered CRISPR components into cells in the body a viral vector, containing genes that code for the CRISPR-Cas proteins and gRNA, is used. This is the vehicle that delivers into the host cell the instructions to make all necessary components, but these instructions need to be kept as simple and short as possible.

Another issue is making sure the viral vector enters HIV reservoir cells specifically cells that express the receptors CD4+ and CD32a+ on their surface.

They found that in one system, saCas9, the vector size was minimised, which enhanced its delivery to HIV-infected cells. They also included proteins that target the CD4+ and CD32a+ receptors specifically in the vector.

This system showed outstanding antiviral performance, managing to completely inactivate HIV with a single guide RNA (gRNA) and excise (cut out) the viral DNA with two gRNAs in cells in the lab.

We have developed an efficient combinatorial CRISPR-attack on the HIV virus in various cells and the locations where it can be hidden in reservoirs and demonstrated that therapeutics can be specifically delivered to the cells of interest, the authors write.

These findings represent a pivotal advancement towards designing a cure strategy.

But the researchers stress that, while these preliminary findings are very encouraging, it is premature to declare that there is a functional HIV cure on the horizon.

See the original post:
How CRISPR-Cas genome editing could be used to cure HIV - Cosmos

Access to this page has been denied because we believe you are using automation tools to browse the website.

This may happen as a result of the following:

Please make sure that Javascript and cookies are enabled on your browser and that you are not blocking them from loading.

Reference ID: #8a1d39ee-ed97-11ee-84ca-ce0121ee4eed

Read the original post:
Crispr Stock, A Cathie Wood's Holding, Dives For The Fifth Straight Week Here's Why - Investor's Business Daily

CRISPR gene editing technology is beginning to deliver on a promise to quickly create crops with traits that withstand a changing climate, resist aggressive pests and reinvigorate healthy soils, according to experts at the South by Southwest event in Austin earlier this month.

Companies exploring CRISPR to make climate-friendly foods and medicines are enjoying some tailwinds:

At the same time, startups and researchers are taking on investment partnerships with larger organizations to commercialize CRISPR innovations. Bayer has a project with Pairwise to create a corn crop that is more resilient to environmental factors. In 2011, The Gates Foundation gave a $10.3 million grant to the International Rice Research Institute (IRRI) and has re-invested more than $16 million to the organization in 2023 to create climate resistant rice varieties.

The past 200 years of industrialized agriculture have increased yields and eased shipping with large, durable produce often to the detriment of the soil, the planet and taste.

"We think with gene editing you wont have to make that choice," said Tom Adams, CEO of Pairwise. The startup is producing the first CRISPR consumer product by editing out the wasabi-like spiciness of a mustard green to make it more palatable to eaters.

Pairwise sold the green at a New York grocer earlier this year and is seeking to partner with companies to sell to consumers. The companys main focus is developing business-to-business markets by selling ingredient crops or seeds to big agricultural companies or seed banks.

Traditionally, farmers mated or cross-pollinated organisms to augment their desired characteristics. It could take decades to cultivate a plant to the desired enhancement for human consumption.

In the 1970s, scientists began genetically modifying organisms (GMOs) by cultivating foreign DNA in a bacteria or virus and then inducing those cells to add their modified DNA into a plant or animal. The modified DNA would typically offer resistance to pests or diseases.

CRISPR opens up new possibilities to modify crops by knocking out or enhancing genes that are already present. "Its more precise, and more accurate and more intuitive than breeding," said Elena Del Pup, a plant genetics researcher at Wageningen University in the Netherlands. "[It] allows us to make very specific edits."

"The hope and the promise of [CRISPR] is that by making a few simple edits, you confer a highly valuable disease resistance trait onto a crop," said Vipula Shukla, senior program officer at the Bill and Melinda Gates Foundation.

If European Union states eventually accept the recent parliamentary vote, they would exempt plants with CRISPR edits from GMO labeling requirements.

The EU has been notoriously strict on GMOs, requiring labeling under consumer "right to know" rules since 1997. Every GMO product must receive EU authorization and a risk assessment.

In the United States, the FDA began requiring clear labeling on consumer products containing GMOs in 2022. In 2018, the USDA decided that CRISPR-edited foods do not need to be regulated or labeled as genetically edited because these modifications could have been done with traditional breeding alone.

Experts think the new EU vote that exempts CRISPR from these rules indicates a willingness to embrace new tools to address the challenges of providing enough food for a growing population facing climate change.

Heres how advocates foresee CRISPR helping the food system become more resilient to climate change.

In agriculture, maximizing yield remains a top priority. Crops that produce more food and use less fertilizer, water and pesticides also decrease embedded emissions.

Pairwise, in collaboration with Bayer, is editing corn that yields more kernels per ear. Another edited corn grows to 6 feet rather than the conventional 9 feet tall.

"The advantage is that it's much sturdier," said Adams. "So if there's a big wind it doesn't get blown over." It also makes applying insecticides, fungicides and herbicides easier.

To engineer the next generation of climate-efficient plants, scientists need to find specific genes in them, such as for controlling water usage or nitrogen fixation.

"One of the biggest limitations [for CRISPR] is our relatively limited knowledge of the biology of the organisms that were trying to edit," Shukla said. "You can't apply CRISPR to a gene if you don't know what the gene does."

Farmers and researchers are field-testing a strain of CRISPR-edited rice designed to resist bacterial blights, which can kill 75 percent of a crop. Rice blight is a particular problem in India and Africa.

Since 2011, The Gates Foundation has been funding field trials of CRISPR rice in India. It has engaged in similar field tests of a virus-resistant corn in Mexico since 2015. "The Gates Foundation wants to come in at a point where there's a testable hypothesis," Shukla said. "We're focusing on developing and delivering these innovations to people."

The foundation looks for preliminary laboratory results or small scale, proven field testing. It then funds a larger scale pilot in real-world conditions in developing countries.

"I don't personally have a lot of faith that we're going to reverse climate change," Adams said. "So, I think we probably should be investing in adapting to it."

Farmers need plants that can survive temperature extremes, including higher nighttime temperatures, as well as erratic rainfall patterns. CRISPR can help native plants adapt to their changing environment by enhancing their genes.

"One of the consequences of climate change is having to move crops into places they havent been before because it's warmer or wetter or drier," Shukla said. "And crops are not adapted to those pests [in the new locations]. We have the ability with gene editing to confer traits that make those crops more tolerant to pests and diseases that they haven't experienced before."

The Gates Foundation is looking at genes for heat tolerance as its next target for research and investment, according to Shukla.

CRISPR technology may also diversify the genetic composition of current crops and domesticate new crops. That could help address the damage done by industrial, monoculture farming practices, in which a single crop species dominates a field or farm, depleting the soil of its nutrients.

"Wild relatives of plants contain traits that can be super-valuable for agriculture," Shukla said. "But we haven't had a way through crossing or other methods to bring those traits into the agricultural system."

If Pairwises mild mustard green becomes a hit, it might offer an incentive for farmers to plant a new leafy green alongside their kale, lettuce and spinach adding to biodiversity.

See the original post:
Why Bayer and the Gates Foundation are using CRISPR to reduce food's climate impact - GreenBiz

TCGA data acquisition and pre-processing

TCGA SNV data for 16 cancer types (BLCA, BRCA, COAD, GBM, HNSC, KIRC, KIRP, LIHC, LUAD, LUSC, OV, PAAD, PRAD, READ, STAD, and UCEC) were downloaded from the GDC data portal (https://portal.gdc.cancer.gov/, DR-7.0). The mutation files were initially collected as VarScan2 processed protected mutation annotation format (MAF) files. To eliminate low-quality and potential germline variants, we further processed the files according to the guidelines provided by the GDC portal (https://docs.gdc.cancer.gov/Data/File_Formats/MAF_Format/) to generate high-confidence somatic mutation files. For gene expression analysis, we obtained fragments per kilobase of exon per million mapped fragments (FPKM) data using the TCGAbiolinks19 R package (version 2.26.0). The gene expression values were then normalized to log2(FPKM+1).

The DepMap CRISPR/Cas9 screen dataset20 (https://depmap.org/portal/, DepMap Public 21Q2) was used to collect essential genes. Haploinsufficient genes were compiled from three sources: (1) Vinh T Dang et al.s study11, (2) ClinGen12 (https://clinicalgenome.org, genes with haploinsufficiency scores of 2 or 3, downloaded on January 20, 2021), and (3) DECIPHER13 (https://deciphergenomics.org, genes located in the top 5% probability of haploinsufficiency scores, version 3). Oncogenes were obtained from the COSMIC Cancer Gene Census9 (https://cancer.sanger.ac.uk/census, v94) data by applying the filter Somatic=yes and including genes with the role of oncogene in cancer. Hotspot mutations were annotated using data from the Cancer Hotspots portal3 (https://www.cancerhotspots.org, Hotspot Results V2).

To generate targetable SNVs and the corresponding sgRNA sequences from a given SNV list of a sample, we followed the following steps: First, we identified the SNVs located within essential or haploinsufficient genes. If an SNV was encoded by an essential gene, only homozygous SNVs were further analyzed. Next, we calculated the allele frequency (AF) threshold ({AF}_{cut}) using the following equation:

$${AF}_{cut}={AF}_{M}+MAD(hetAF)$$

(1)

where ({AF}_{M}) is the median of AFs of SNVs from the sample, and (MAD(hetAF)) is the median absolute deviation (MAD) of AFs of heterozygous SNVs from the patient or sample. SNVs with AF below the samples ({AF}_{cut}) were filtered out. We then considered the expression of the gene in which an SNV was located and retained SNVs where the gene expression (log2(FPKM+1)) was greater than 1.

To identify SNVs that generate a novel and specific targetable site for the CRISPR/Cas9 approach, we searched for a PAM sequence (NGG, where N represents any nucleotide) within a 12-base pair region around the SNV or checked if the SNV itself created a new PAM sequence. For the satisfying SNVs, a 20-nucleotide sgRNA sequence was obtained.

To obtain sgRNAs with precise knockout efficiency and low potential off-target effects, we calculated the on- and off-target scores and applied strict cutoffs as follows: First, on-target scores were calculated using the Azimuth 2.015 method implemented in the crisprScore21 R package (version 1.2.0). sgRNAs with on-target scores greater than 0.5 were examined for possible off-target sites using CasOFFinder16 (offline version 2.4). The UCSC human reference genome assembly (GRCh38) was used as a reference, and off-target sites with a maximum of three mismatches were searched. If an sgRNA was found to have off-target sites, the off-target score was calculated using the CFD15 method, which was also implemented in the crisprScore21 R package. If off-target sites with scores>0.175 were present, the sgRNA was filtered out to mitigate potential off-target risks. Finally, the SNVs were reported along with their corresponding sgRNAs, on-target scores, and off-target scores.

All cells were maintained at 37C in a 5% CO2 atmosphere. Human embryonic kidney 293T (HEK293T) cells were purchased from ATCC. HEK293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillinstreptomycin (Invitrogen, USA). Human colorectal cancer cell lines (SNUC4, SW620, and NCIH498) were also purchased from the Korean Cell Line Bank and cultured in RPMI-1640 medium (Gibco) supplemented with 10% FBS and 1% penicillinstreptomycin.

The lentiviral plasmids lentiCas9-Blast and lentiGuide-puro were purchased from Addgene USA (#52,962, #52,963). The sgRNA sequences were cloned following the lentiCRISPR v2 cloning protocol22,23. For transfection, 7.5105 HEK293T cells were seeded in 60-mm plates one day before transfection. Transfection was performed using Opti-MEM I Reduced Serum Medium (Gibco) with 1g of lentiviral plasmid, 0.25g of pMD2.G (#12,259; Addgene), 0.75g of psPAX2 (#12,260; Addgene), and 6 L of FuGENE (Promega, USA). The medium was changed after 16h of incubation at 37C under 5% CO2. Viral supernatants were collected 48 and 72h after transfection, filtered through a 0.45-m membrane (Corning, USA), and stored at -80C. Cells were transduced with lentivirus encoding lentiCas9-Blast to establish stable Cas9-expressing cells, followed by selection with blasticidin (10g/mL) (Invitrogen) for seven days.

Stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the RRP9 SNV of SNUC4 (sgRRP9-SNV). After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL, Invitrogen) for 72h, 1103 cells/well were seeded into six-well plates. The medium was replaced every 72h. After 14days, the medium was removed, and the cells were stained with 0.05% crystal violet solution in a 6% glutaraldehyde solution for 30min. The crystal violet solution was then removed, and the cells were washed with H2O and allowed to dry. Colonies comprising more than 50 cells were counted using the ImageJ software24.

Parental or stable Cas9-expressing SNUC4 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (SNUC4: 10g/mL, SW620: 2g/mL) for 72h, 1105 cells/well were seeded into six-well plates. After 3days, cells were trypsinized, stained with trypan blue (Bio-Rad, USA), and counted. All harvested cells were seeded onto 60-mm plates. After 3days of incubation, cells were trypsinized and counted with trypan blue again. The subculture was repeated once more using 100-mm plates. Growth curves were generated using cell counts obtained during the subculture.

Total RNA was extracted from SW620 cell line using the RNeasy Plus Mini Kit (QIAGEN, Germany) following the manufacturers instructions. cDNA was synthesized with PrimeScript RT Master Mix (Takara Korea Biomedical Inc, Korea), and full-length RRP9 cDNA was PCR amplified with CloneAmp HiFi PCR Premix (Takara Korea Biomedical Inc). The PCR-amplified RRP9 wild-type cDNA was cloned into pcDNA3 Flag HA (#10,792, Addgene) using In-Fusion HD Cloning Kit (Takara Korea Biomedical Inc). RRP9 sequence was confirmed by Sanger-sequencing.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRRP9-SNV. After selection with puromycin (10g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After a 24h incubation, 2g of empty or RRP9 plasmids were transfected with FuGene HD (Promega) according to the manufacturers protocol. Cell viability was assessed after 4days using Cell Titer Glo (Promega), and relative luminescence units (RLU) were measured using an EnVision plate reader (Perkin-Elmer, USA).

Stable Cas9-expressing NCIH498 and SW620 cells were transduced with a lentivirus encoding either control sgRNA (non-targeting sgRNA, GCGAGGTATTCGGCTCCGCG) or sgRNA targeting the SMG6 SNV of NCIH498 (sgSMG6-SNV). After selection with puromycin (NCIH498: 10g/mL, SW620: 2g/mL) for 72h, 3103 cells/well were seeded into 96-well plates. After 6days, cell viability was determined with Cell Titer Glo according to the manufacturers protocol, and RLU were measured using an EnVision plate reader.

Cells and tissues were harvested, washed with phosphate-buffered saline (PBS), and lysed on ice for 15min in a radioimmunoprecipitation assay buffer (R0278; Sigma, USA) supplemented with a protease and phosphatase inhibitor cocktail (GenDEPOT, USA). Cell lysates were centrifuged at 4C for 10min at 15,000rpm. Protein concentrations were determined using Bradford assay (Bio-Rad). Equal amounts of total protein were separated via sodium dodecyl sulfate gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad). The membranes were blocked with 5% skim milk for 1h at 22C and then incubated overnight at 4C with a primary antibody against the target protein in a buffer containing 0.1% Tween 20. Subsequently, the membranes were washed with Tween-PBS buffer three times for 10min each and incubated with a secondary antibody (anti-rabbit IgG or anti-mouse IgG) diluted in a blocking buffer containing 0.1% Tween 20 for 1h at 22C. The membranes were then washed with Tween-PBS three times for 10min each. The immunoreactive bands were visualized using Pierce enhanced chemiluminescence western blotting substrate (32,106; Thermo Fisher Scientific, USA). Mouse monoclonal anti-Cas9 (#14,697; Cell Signaling Technology, USA), rabbit polyclonal anti-RRP9 (#ab168845, Abcam, UK), rabbit polyclonal anti-FLAG (DYKDDDDK) (#2368; Cell Signaling Technology) and rabbit monoclonal anti-heat shock protein 90 (HSP90) (#4877, Cell Signaling Technology) and were used at a 1:1000 dilution. Anti-rabbit IgG (#111-035-144; Jackson ImmunoResearch, USA) was used at a 1:5000 dilution except for anti-FLAG which was used at a 1:10,000 dilution. Anti-mouse IgG (#115-035-146, Jackson ImmunoResearch) was used at a 1:10,000 dilution.

Genomic DNA was extracted using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Libraries were prepared with a two-step PCR reaction, in which the first step uses target-specific primers, and the second step utilizes primers containing unique barcodes and Illumina sequencing adaptor sequences. The primers used here are listed in Supplementary Data 4. PCR reactions were performed with KAPA HiFi HotStart Ready Mix (Roche Molecular Systems, Inc. USA). For the first PCR step, 100ng of genomic DNA was denatured at 95 for 5min, followed by 30 cycles of (98C at 20s, 61C for 15s, and 72C for 15s), and a final extension at 72C for 1min. Primers with unique barcodes and Illumina sequencing adaptor sequences were added to the PCR product from step 1 for the second PCR reaction, where denaturation at 95C for 5min was followed by 12 cycles of (98C at 20s, 61C for 15s, 72C for 15s), and a final extension at 72C for 1min. PCR products were verified with 2% agarose gel electrophoresis and extracted using the Zyomoclean Gel DNA Recovery Kit (Zymo Research, USA) according to the manufacturers instructions. The barcoded PCR products were pooled and subjected to paired-end sequencing (2150bp reads) on an Illumina NovaSeq-6000 instrument (Macrogen, Korea). InDel quantification was conducted using CRISPResso225 with default parameters.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Target regions were PCR-amplified with nTaq (Mg2+plus) (Enzynomics, Korea) with the following primers: sgRRP9-SNV region (Forward: 5-TCAAGGCCCTCGTTGATTCC-3, Reverse: 5-TTTTTGGGCTTTGTGGCTGC-3), sgSMG6-SNV region (Forward: 5-TCTGCATCGAAAGTGACACGA-3, Reverse: 5- CTATCAGCCTGGACGACGTTT-3). PCR products were purified with PureLink Quick PCR Purification Kit (Invitrogen). 200ng of purified PCR product were denatured at 95C for 10min, re-annealed at 2C per second temperature ramp to 85C, followed by a 1C per second ramp to 25C. 1l of T7E1 enzyme (Enzynomics) was added to the heterocomplexed PCR product and incubated at 37C for 15min. Products were electrophoresed on a 2% agarose gel using TAE buffer. Band intensities were measured with ImageJ, and the estimated non-homologous end joining (NHEJ) event was calculated with the following formula:

$$NHEJleft( % right) = 100 times left[ {1 - left( {1 - fraction; cleaved} right)^{{left( {frac{1}{2}} right)}} } right]$$

(2)

where the fraction cleaved is (frac{(Density; of; digested; products)}{(Density; of; digested; products,+,undigested; parental; band}).

All animal procedures were approved by the Institutional Animal Care and Use Committee of Yonsei University, Seoul, Korea (2021-0106). All methods were performed in accordance with the relevant guidelines and regulations for the care and use of laboratory animals. Six-week-old female BALB/c-nu Slc mice were purchased from Orient Bio (Korea) and SLC Inc. (Japan). The mice were housed in individual ventilation cages equipped with a computerized environmental control system (Techniplast, Italy). The animal room temperature was maintained at 222C with a relative humidity of 5010%. Before the experiments, the animals were acclimated for seven days under a 12-h lightdark cycle.

Stable Cas9-expressing SNUC4 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 10g/mL puromycin for 72h, 3106 cells were subcutaneously injected into the left (control sgRNA) or right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Similarly, stable Cas9-expressing SW620 cells were transduced with lentivirus encoding either the control sgRNA or sgRNA targeting the RRP9 SNV in SNUC4 cells. After selection with 2g/mL puromycin for 72h, 2106 cells were subcutaneously injected into the left (control sgRNA) and right (RRP9 SNV of SNUC4 sgRNA) flanks of 10 mice. Among the mice, we excluded those with no observable tumor growth in the left flank (control sgRNA) from further analysis.

Tumor sizes were measured using a caliper, and the volume was calculated using the formula: 0.5lengthwidth2. Mice were sacrificed when the largest tumor reached a volume of 1000 mm3. Each tumor was considered an experimental unit. The sample size was determined to be sufficient to identify statistically significant differences between groups.

Genomic DNA was extracted from colorectal cancer cell lines using the QIAamp DNA Mini Kit (QIAGEN) following the manufacturers instructions. Whole-exome capture was performed using the SureSelect Human All Exon V4 51Mb Kit (Agilent Technologies, USA). The captured DNA was then sequenced on the HiSeq 2500 platform (Illumina, USA), generating a minimum of 98.9 million paired-end sequencing reads of 100bp per sample.

The Burrows-Wheeler Alignment26 tool was used with the default parameters to align the paired-end reads to the UCSC human reference genome assembly (GRCh37/hg19). An average of 98.3% of the reads were successfully aligned to the human genome. Duplicate reads were removed using the Picard software package. The Genome Analysis Tool Kit (GATK) version 3.446 was used for read quality score recalibration and local realignment to identify short InDels using the HaplotypeCaller27 package. The variants were filtered using the GATK Best Practices quality control filters.

SNVs were identified using Mutect28, specifically the tumor-only option, with default parameters. Variants supported by at least five high-quality reads (Phred-scaled quality score>30) and detected with at least 20% AF were selected for further analysis. The detected SNVs and InDels were annotated using various databases, including the single nucleotide polymorphism (SNP) database (dbSNP29, build 147), 1000 Genomes Project30 (Phase 3), Korean dbSNP (build 20,140,512), and somatic mutations in TCGA colon adenocarcinoma (COAD), using the Variant Effect Predictor software31 (version 87). ANNOVAR32 was used to annotate regions of known germline chromosomal segmental duplications and tandem repeats.

Several steps were performed to filter variants. Patients with germline polymorphisms, chromosomal segmental duplications, or tandem repeats were excluded. The variants were then filtered to include known somatic mutations observed in at least one sample from TCGA COAD dataset. Additionally, nonsynonymous mutations observed in genes belonging to the Cancer Gene Census, as reported in at least ten samples in the COSMIC9 database (version 87), were included in the analysis.

Total RNA was extracted from colorectal cancer cell lines using the RNeasy Plus Mini Kit (QIAGEN) following the manufacturers instructions. The TruSeq RNA Sample Prep Kit v2 (Illumina) was used to generate mRNA-focused libraries. Libraries were sequenced on the HiSeq 2500 platform, generating at least 40 million paired-end reads of 100bp per sample.

The TopHat-Cufflinks33 pipeline was employed to align the reads to the reference genome and calculate normalized gene expression values in FPKM. TopHat was used to align and map the reads to the reference genome. The resulting alignments were then processed using Cufflinks, which estimates transcript abundance and calculates FPKM values, providing a measure of gene expression levels that takes the length of exons and the total number of mapped reads into account.

R (ver. 4.2.1) (R Foundation, Austria) and the ImageJ software were used to analyze the data.

The figures were generated using the R software, and statistical analyses were performed using RStudio software (version 2022.07.2+576). Specific statistical tests are identified in the figure legends for each experiment.

The study design, animal use and all experimental methods were conducted and reported in accordance with ARRIVE guidelines (https://arriveguidelines.org).

Go here to read the rest:
CRISPR/Cas9 targeting of passenger single nucleotide variants in haploinsufficient or essential genes expands cancer ... - Nature.com

The new Integrated Classifier Pipeline system uses genetic fingerprints to identify unintended bystander CRISPR edits. A confocal microscope image of an early blastoderm-stage nucleus in aDrosophila(fruit fly) embryo uses colorful fluorescent markers to highlight the homothorax gene undergoing transcription from two separate parental chromosomes (two distinct signal clusters). Credit: Bier Lab, UC San Diego

The ICP system can cleanly establish whether a given individual insect has inherited specific genetic components of the CRISPR machinery from either their mothers or fathers since maternal versus paternal transmission result in totally different fingerprints, said Bier, a professor in the UC San Diego School of Biological Sciences.

The ICP can help untangle complex biological issues that arise in determining the mechanisms behind CRISPR. While developed in insects, ICP carries vast potential for human applications.

There are many parallel applications of ICP for analyzing and following CRISPR editing outcomes in humans following gene therapy or during tumor progression, said study first author Li. This transformative flexible analysis platform has many possible impactful uses to ensure safe application of cutting-edge next-generation health technologies.

ICP also offers help in tracking inheritance across generations in gene drive systems, which are new technologies designed to spread CRISPR edits in applications such as stopping the transmission of malaria and protecting agricultural crops against pest destruction. For example, researchers could select a single mosquito from the field where a gene-drive test is being conducted and use ICP analysis to determine whether that individual had inherited the genetic construct from its mother or its father, and whether it had inherited a defective element lacking the defining visible markers of that genetic element.

The CRISPR editing system can be more than 90 percent accurate, said Bier, but since it edits over and over again it will eventually make a mistake. The bottom line is that the ICP system can give you a very high-resolution picture of what can go wrong.

In addition to Li and Bier, coauthors included Lang You and Anita Hermann. Prior Bier lab member Kosman also made important intellectual contributions to this project.

Funding for the study was provided primarily by an award from the Bill and Melinda Gates Foundation.

Competing interest disclosure: Bier has equity interest in two companies he co-founded: Agragene Inc. and Synbal Inc., which may potentially benefit from the research results. He also serves on Synbals board of directors and the scientific advisory boards for both companies.

Read this article:
New Genetic Analysis Tool Tracks Risks Tied to CRISPR Edits - University of California San Diego

Leadership change simultaneous to the Eclipse Cell Engineering platform spinout asEditCo Bio

REDWOOD CITY, Calif., March 27, 2024 /PRNewswire/ -- Synthego Corporation, a leading provider of genome engineering solutions, announced that Paul Dabrowski will step down as Chief Executive Officer, effective immediately. Craig Christianson has been appointed Chief Executive Officer following an extensive search process. Mr. Dabrowski, a co-founder of the company, will continue his role as a Board Director and advisor. Additionally, the company announces the divestiture of the Eclipse Cell Engineering platform as EditCo Bio, Inc., enablingSynthego's unique focus on therapeutic applications of CRISPR.

"Founding and growing Synthego the past 12 years has been the privilege of a lifetime," said Dabrowski. "Our team has transformed the CRISPR landscape by staying true to our values and providing everyone, from individual scientists to the world's leading biotechnology companies, with unprecedented access to advanced genome engineering. I'm confident Craig is an ideal fit to further our mission by building a robust commercial engine leveraging Synthego's platform - in addition to his impeccable track record, he embodies Synthego's culture of innovation and excellence. As the world enters the era of CRISPR based therapeutics, Synthego is now focused to be the premier supplier to hundreds of programs entering the clinic."

Christianson has a track record of spearheading global commercial strategies, business development and operations to build global life sciences and other businesses. He joins Synthego from Water Street Healthcare Partners, preceded by 12 years with global biotechnology company Promega Corporation where he led commercial operations, accelerating their growth to $700M+ in annual sales through profit-driven strategies and successful digital transformation.

"I am honored to join this pioneering organization which plays an important role in the impact CRISPR has on life science research and clinical development," said Christianson. "Paul is a visionary who has built a foundation upon which Synthego will become the best partner for clients in terms of co-development and regulatory compliance for the advancement of therapies and, ultimately, human health."

Christianson's appointment, along with the spinout of EditCo Bio, previously operating as Synthego's Eclipse platform, reinforces Synthego's commitment to provide CRISPR therapeutic developers with best-in-class guide RNAs. With its state-of-the-art GMP facility and extensive experience of producing leading products, Synthego is uniquely positioned to address escalating clinical requirements and changing regulatory frameworks. Bolstered by the FDA approval of the first CRISPR-based therapy, Synthego is more dedicated than ever to accelerating life-saving technologies for improved human health in its next chapter.

For more information, click here.

About Synthego:Synthego is a genome engineering company that enables the acceleration of life science research and development in the pursuit of improved human health. Based on a foundation of engineering and chemistry, Synthego leverages automation and machine learning to synthesize high-quality CRISPR reagents for science at scale. Synthego's mission is to enable agile life science research and development from discovery through clinical trials by providing scientists with comprehensive CRISPR solutions for each phase coupled with full technical and regulatory support from industry-leading experts. With its technologies cited in hundreds of peer-reviewed publications and utilized by thousands of commercial and academic researchers and therapeutic drug developers, Synthego is at the forefront of innovation, enabling the next generation of medicines by delivering genome editing at an unprecedented scale.

SOURCE Synthego

Read more:
Synthego Announces CEO Transition to Focus on Enabling CRISPR Therapeutics - PR Newswire

Figure 1: Total deal value by deal therapy area of licensing agreements for innovator drugs utilising the CRISPR system, globally, 2019-2024, year to date. Credit: GlobalData.

Licensing agreements for innovator drugs utilising clusteredregularly interspaced short palindromic repeats (CRISPR) technologies saw oncology, immunology, and central nervous system as the top three therapy areas by total deal value with a combined $21bn over the past five years.

Furthermore, haematological disorders saw almost three times more licensing agreement deal value in 2022 compared to 2020, reaching a total deal value of $1.8bn in the past five years (Figure 1), as reported by GlobalDatas Pharma Intelligence Center Deals Database.

This highlights the growing importance of advancements in CRISPR for haematological disorder therapies.

In December 2023, the US Food and Drug Administrations approval of Casgevy, the first CRISPR and CRISPR-associated protein 9 (Cas9) genome editing therapy developed by Vertex Pharmaceuticals and CRISPR Therapeutics for sickle cell disease and beta thalassemia represented a major milestone in gene therapy.

Casgevy precisely edits DNA in blood stem cells by utilising CRISPR/Cas9 technology, involving taking the patients bone marrow stem cells and enhancing their expression of fetal haemoglobin before reintroducing these edited stem cells back into the patient.

This restores healthy haemoglobin production in patients with sick cell disease and beta thalassemia, effectively alleviating the symptoms of these diseases.

Access the most comprehensive Company Profiles on the market, powered by GlobalData. Save hours of research. Gain competitive edge.

Your download email will arrive shortly

We are confident about the unique quality of our Company Profiles. However, we want you to make the most beneficial decision for your business, so we offer a free sample that you can download by submitting the below form

Country * UK USA Afghanistan land Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bonaire, Sint Eustatius and Saba Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos Islands Colombia Comoros Congo Democratic Republic of the Congo Cook Islands Costa Rica Cte d"Ivoire Croatia Cuba Curaao Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and McDonald Islands Holy See Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Isle of Man Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati North Korea South Korea Kuwait Kyrgyzstan Lao Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macao Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Runion Romania Russian Federation Rwanda Saint Helena, Ascension and Tristan da Cunha Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and The Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and The South Sandwich Islands Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syrian Arab Republic Taiwan Tajikistan Tanzania Thailand Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates US Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam British Virgin Islands US Virgin Islands Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe Kosovo

Industry * Academia & Education Aerospace, Defense & Security Agriculture Asset Management Automotive Banking & Payments Chemicals Construction Consumer Foodservice Government, trade bodies and NGOs Health & Fitness Hospitals & Healthcare HR, Staffing & Recruitment Insurance Investment Banking Legal Services Management Consulting Marketing & Advertising Media & Publishing Medical Devices Mining Oil & Gas Packaging Pharmaceuticals Power & Utilities Private Equity Real Estate Retail Sport Technology Telecom Transportation & Logistics Travel, Tourism & Hospitality Venture Capital

Tick here to opt out of curated industry news, reports, and event updates from Pharmaceutical Technology.

Submit and download

Figure 1 shows innovator drugs harnessing CRISPR systems saw 182% growth in total licensing agreement deal value from $5.6bn in 2020 to $15.8bn in 2022, according to GlobalDatas Pharma Intelligence Center Deals Database.

Oncology represented more than half of the total deal value for the top three therapy areas with $11.9bn, followed by immunology with $6.7bn, and central nervous system with $2.3bn, according to GlobalDatas Pharma Intelligence Center Deals Database.

Pharma giants such as Lily and Sanofi have recently partnered with companies developing CRISPR-based technologies.

Last year, Prevail Therapeutics, a subsidiary of Lily, secured exclusive rights to Scribe Therapeutics CRISPR X-Editing (XE) technologies for $1.65bn.

This licensing agreement, aimed at developing genetic therapies for neurological and neuromuscular diseases, stands as the largest CRISPR-based deal of the year.

Concurrently, Sanofi expanded its collaboration with Scribe in July 2023, with a deal worth up to $1.24bn, focusing on leveraging Scribes XE genome editing technologies for the development of in vivo therapies, particularly sickle cell disease and other genomic disorders.

Moreover, Lilys expertise in cardiometabolic diseases prompted the company to partner with Beam Therapeutics in October last year.

This agreement, valued at up to $600m, involved acquiring rights held by Beam in Verve Therapeutics, a gene-editing company focused on single-course gene editing therapies for cardiovascular disease.

This includes Verves programmes targeting PCSK9 and ANGPTL3, both set for clinical initiation this year.

CRISPR technology is revolutionising targeted gene therapies for various unmet diseases by precisely targeting diverse genomic sites.

This advancement in precision medicine offers hope for more tailored treatments and improved patient outcomes.

Furthermore, the growing number of CRISPR-based therapies in clinical trials is expected to fuel significant interest and drive further progress in this field.

View original post here:
CRISPR drug licensing deals secure $21bn in top three therapy areas over five years - Pharmaceutical Technology

ICP: an integrated pipeline for classifying CRISPR/Cas9 induced mutant alleles

We developed an integrated bioinformatic tool ICP (Integrated Classifier Pipeline), to parse complex DSB repair outcomes induced by CRISPR/Cas9 and automatically call for experimental errors generated during NGS library preparation and sequencing: 1) a Nucleotide Position Classifier (NPClassifier), and 2) a Single Allele-resolution Classifier (SAClassifier). We employed these two complementary sequence analysis modules in tandem to enable in-depth interpretation of deep sequencing data at single allele resolution (Fig.1ac, see Methods section for detailed description of ICP tools). In line with the unique DNA signatures generated by distinct DSB repair pathways, we categorized the repair products into four major categories. Alleles with a deletion only on the PAM-distal side (PAM-proximal side was protected by Cas9 protein after cleavage), a common category, were termed as PEPPR class mutations (PAM-End Proximal Protected Repair, PEPPR)41,42. While single strand cleavage by the Cas9 RuvC domain can also nick the non-complementary strand at locations beyond the canonical site between the 6th and 7th nucleotide upstream of the PAM sequence, we restrict our analysis here to the majority cases wherein Cas9 cleavage generates blunt DSB ends to simplify the robust classification scheme developed in this study43,44,45. Mutant alleles judged to be generated by directly annealing 2bp microhomology sequences spanning the gRNA cleavage site were assigned into MMEJ class (again acknowledging that such alleles can also be generated with 1bp microhomology sequence, which however, are not readily amenable to the semi-automated analysis we developed)46,47,48, while pure deletion alleles not belonging to either the PEPPR or MMEJ categories were classified as DELET class mutations. Remaining alleles that include insertions-only and indels (deletion plus insertion) were categorized as insertion class (INSRT) mutations (Fig.1b).

The process of DSB repair pattern profiling consists of preparing a NGS library (a), classifying the resulting parsed alleles (b) and displaying processed alleles by rank order and class of mutations (c). a NGS library preparation: Genomic DNA from F1 test flies carrying both Cas9 and gRNA expressing cassettes either maternally (dark blue bars) or paternally (red bars, or progeny from other designated crosses) are subjected for targeted PCR amplification with primers containing Illumina compatible adapters at the 5 terminal to detect somatic indels. The gray rectangle represents a short region of genomic DNA containing a Cas9/gRNA target: purple circle depicts Cas9 protein and sky-blue line is gRNA. b Classification: Raw NGS data are subjected to the NPClassifier to parse alleles into specific primary categories required for building allelic dictionaries used by the SAClassifier. Four major indel groups are categorized: PEPPR (PAM-End Proximal Protected Repair, sky-blue), MMEJ (Microhomology Mediated End-Joining, dark pink), DELET (deletion, any deletions do not belong to PEPPR and MMEJ, orange) and INSRT (insertion, including the alleles only with inserted nucleotides or had deletions and insertions, purple). The 24-nt short PEPPR, MMEJ and DELET dictionaries are used for a more accurate classification and error calling by binning together all alleles with the same seed region that match primary allelic entries in the SAClassifier dictionaries. c DSB repair pattern visualization: intuitive rendering of the processed raw sequence data as an output of rank ordered classes of alleles. Allelic classes derived from NGS sequencing of individual flies or mosquitoes are displayed by their ranked frequency (allele landscape) and repair pattern fingerprints (color-coded by categories).

Briefly, raw reads generated from deep sequencing were subjected to a preliminary categorization using the NPClassifier, which recognizes the relative positions of editing start- and end-points flanking Cas9 cleavage site and then generates a collection of priori alleles for each category. These primary outputs (MMEJ and DELET) were used for building full-length standard comprehensive dictionaries listing all observed mutations and derived 24-nt short dictionaries (with the same seed region flanking the Cas9 cleavage site) as inputs of the SAClassifier. In addition, a synthetic PEPPR dictionary was built by iteratively increasing the length of deletions by a single nucleotide distal to the PAM site, excluding alleles belonging to the MMEJ category. By fishing the raw reads with 24-nt dictionaries, we were able to automatically recognize reads that also contained experimentally generated errors (e.g., from PCR amplification), which usually are located outside of the narrow 24-nt short dictionary window, thereby assigning such composite alleles to correctly matched root alleles (Fig.1b). These dual iteratively employed ICP classification tools provide a robust and precise classification of CRISPR/Cas9 induced DSB repair outcomes. Next, we developed an evocative user-friendly interface to visualize processed allelic category information in the form of rank ordered allelic landscape plots and repair pattern fingerprints (color-coded DSB repair categories), both of which are sorted by read frequency (Fig.1c). These intuitively accessible data outputs are far more informative and discriminating than the unprocessed primary DNA sequence reads (e.g., compare the seemingly idiosyncratic raw lesions depicted in Fig.2a to the obviously unique processed and concordant replicate patterns shown Fig.2b, c). The ICP was thus employed to visualize results in all the following experiments.

a Examples of the top five somatic indels from individual flies derived from split-drive crosses in which the Cas9 transgene is inherited either maternally (Maternal-S, left) or paternally (Paternal-S, right), but separately from a cassette carryingthe gRNAtransmittedby the other parent. Purple stars indicate the color codes for mutation categories (dark pink: MMEJ, sky-blue: PEPPR, orange: DELET, purple: INSRT) and dark green star indicates the separate raw sequence color coded for the four nucleotides A, T, G, and C. The red bar indicates Paternal-S crosses while dark blue bar represents Maternal-S crosses. b Landscapes of top 50 alleles ranked by reads ratio. All six sequenced individual flies are plotted together, with dark blue lines plotting the data from Maternal-S crosses and the red lines from Paternal-S crosses. The y-axis presents the fraction of reads for a given allele and the x-axis depicts the top 50 alleles according to rank order by read frequency. c DSB repair fingerprints for three representative sequenced individual flies from each cross. The x-axis is the same as depicted in panel b. Both panels show the top 50 ranked alleles. d. Bar plots of Class Fraction for top 50 alleles. Color codes for classes are as in panels a and c. Correlation analysis of two out of three replicates from Maternal-S cross (e) or Paternal-S (f) cross. r2 values and p-values are indicated. Source data for panels b, d, e and f are provided as a Source Data file.

Since DSB repair outcomes have been found to vary considerably as a function of Cas9 or gRNA source and level49,50, we employed the ICP platform to parse somatic indels generated by co-expressing Cas9 and gRNAs in somatic cells of fruit flies (Drosophila melanogaster) and mosquitoes (Anopheles stephensi) in various configurations associated with gene-drive systems. We first applied ICP analysis to a split gene-drive system inserted into the Drosophila pale (ple)gene that is designed to detect copying of a gene cassette in somatic cells. This element, referred to as a CopyCatcher (pleCC), carries a gRNA targeting the first intron of Drosophila ple locus49. In this current study, we make use of low-level ectopic somatic Cas9 expression (which is substantial and broad for vasa-Cas9) to analyze DSB repair patterns across diverse cell types in F1 progeny carrying both Cas9 and gRNAs51,52,53. Because cells actively undergoing meiosis make up only a small fraction of dividing cells in an adult fly, the mutational effects of Cas9/gRNA cleavage in such F1 individuals largely reflect the somatic action of these nuclease complexes. We thus conducted several alternative crossingschemes to assess the somatic mutagenic activity of vasa-Cas9 and gRNA components when transmitted to F1 individuals in various configurations from their F0 parents: 1) Maternal Split (Maternal-S, females carrying vasa-Cas9 crossed with males carrying pleCC); 2) Paternal Split (Paternal-S, males carrying vasa-Cas9 crossed with females carrying pleCC); and 3) Maternal Full (Maternal-F, females carrying both the pleCC and vasa-Cas9 transgenes); or Paternal Full (Paternal-F, males carrying both the pleCC and vasa-Cas9 transgenes)49. Comparative ICP analysis revealed several striking and consistent differences between the prevalent somatic mutations generated in individual progeny in each of these different crossing schemes. In the case of Paternal-S crosses, the resulting mutations were dominated by PEPPR alleles (4 out of top 5 alleles in Fig.2a, Fig. S1a, and 70% of the top 50 alleles as rendered in rank ordered allelic landscapes and color coded DSB repair fingerprints in Fig.2c). In contrast, Maternal-S crosses primarily generated MMEJ and INSRT indels (4 out of top 5 alleles were MMEJ, and at least 50% of the top 50 alleles were INSRT mutations, Fig.2a, c, Supplementary Fig. S1a). These differences were also evident in the steeper allelic landscape curves that were generated from the Maternal-S versus Paternal-S crosses (Fig.2b) as characterized by the initial portion of the curve depicting the 5 most frequent alleles (i.e., the dark blue lines in Fig.2b are all above the red lines for the 5 most frequent alleles). We further quantified differences in allelic profiles between crosses by bar plots displaying the summed proportions of the different allelic classes (summing the percentages of all alleles from each category) which we termed as Class Fraction (Fig.2d). This analysis revealed that INSRT alleles were generated at a significantly higher frequency in Maternal-S crosses, while the PEPPR class dominated among the top 50 alleles in the reciprocal Paternal-S crosses (Fig.2d).

A striking feature of the highly divergent DSB repair signatures generated from maternally versus paternally inherited Cas9 sources was the remarkable reproducibility of their DSB repair fingerprints observed across three individual replicates from each cross (Fig.2e, f). We performed a correlation analysis within replicates by extracting 23 common alleles across all six sequenced flies and plotted the resulting allelic profiles together relative to an arbitrarily chosen Paternal-S replicate as reference (bold red line, Supplementary Fig. S1b). We observed that the frequency distributions of these 23 common alleles were much more similar to each other within intra-cross comparisons than between inter-crosses (Supplementary Fig. S1b). This trend was also revealed by higher correlation coefficients for intra-cross comparisons than for inter-cross comparisons based on allelic read ratios (Supplementary Fig. S1cg). Conspicuous defining differences between the Maternal-S and Paternal-S fingerprints were also evident based on the Class Fraction index (Fig.2d). In summary, a variety of differing statistical measurements all underscore the robust consistent similarities shared among allele profiles generated from individual replicates of same cross and clearly distinctive DSB repair pattern fingerprints generated by maternal versus paternal Cas9 inheritance.

We extended our ICP analysis of mutant allele profiles generated in the ple locus to the more extreme Maternal-F (dark blue lines) and Paternal-F (red lines) cross schemes to assess the role of inheritance patterns when both the source of vasa-Cas9 and gRNA originated from a single parent49. Again, we observed highly dominant alleles in the Maternal-F crosses, clearly evident in allelic landscapes, that deviated markedly from those produced by the Paternal-F crosses, which produced more evenly distributed spectra of alleles spread across a broad range of allelic frequencies (Fig.3a, b). As expected based on these large differences, the repair pattern fingerprints generated from different crosses produced clearly distinguishable patterns of mutation classes, which was particularly evident when considering the Class Fraction (Fig.3e). Cumulatively, these data suggest that the developmental timing and/or levels of Cas9 expression (maternal, early zygotic, or late zygotic) are likely to play a key role in determining which particular DSB repair pathway or sub-pathway is engaged in resolving DSBs.

ad Unique DSB repair signatures obtained using different Cas9 sources are displayed with the top 20 alleles (landscapes and DSB repair pattern fingerprints). NGS sequencing was performed on pools of 20 adults. a vasa-Cas9 inserted in the X chromosome and the pleCC element carrying the gRNA were both carried by either female or male parents, mimicking a full-drive configuration (Maternal-F and Paternal-F crosses with vasa-Cas9). b vasa-Cas9 split crosses wherein the Cas9 transgene was transmitted either maternally (Maternal-S) or paternally (Paternal-S) and the pleCC gRNA bearing cassette was carried by the other parent. Same Maternal-S versus Paternal-S crosses as in panel b, but using either actin-Cas9 (c) or nanos-Cas9 (d) sources. e Class Fraction Index for crosses in panels ad. Bars are shaded according to allelic class color codes. f UMAP embedding for visualizing a common set of 59 alleles shared between the four split crosses with actin-Cas9 and vasa-Cas9. Dots represent single alleles, and the colors indicate the allelic category. g Distribution of top 20 alleles generated from single flies derived from across between parents carrying theSpo11 gRNA and vasa-Cas9elements (Paternal-S cross: red lines and Maternal-S cross: dark blue lines). The top plot shows the allelic landscape for the top 20 alleles from all six sequenced single flies and the bottom shows three examples of the classification fingerprints (with all allelic classes condensed into single rows) color coded for the allele categories. h Class Fraction Index for Spo11 gRNA crosses. i, j Correlation analysis between two replicates from each cross. Dark blue is Maternal-S and red is for Paternal-S. r2 values and p-values are indicated. Source data are provided as a Source Data file.

Previous studies have shown that the relative frequencies of NHEJ versus HDR events depend on the source of Cas9 both in terms of timing and level of expression49,50,54. We thus wondered whether ICP analysis would similarly reveal distinct DSB repair outcomes for two additional Cas9 sources (actin-Cas9 and nanos-Cas9, expressing level of Cas9: actin-Cas9>vasa-Cas9>nanos-Cas9) inserted at the same locus with vasa-Cas9 (Fig.3c, d)49.

As was observed for the vasa-Cas9 source, the actin-Cas9 and nanos-Cas9 sources both generated differing allelic landscapes and repair pattern fingerprints when transmitted maternally versus paternally, which also were readily distinguishable from each other (Fig.3bd). Mirroring results with the vasa-Cas9 source, significant differences between the proportions of PEPPR versus MMEJ class among the top 20 alleles were observed in Maternal-S versus Paternal-S crosses for actin-Cas9. For the nanos-Cas9 source, both the MMEJ and INSRT categories were particularly reduced in Paternal-S crosses, although this latter sex-based difference was not as dramatic as for the other Cas9 sources (presumably due to its more germline restricted expression, Fig.3d)55,56. Overall, the general trend once again indicated that maternally inherited Cas9 sources biased somatic DSB repair outcomes in favor of MMEJ and INSRT classes over PEPPR alleles, while paternal transmission of Cas9 generated mutant alleles dominated by PEPPR class alleles (Fig.3e).

Based on the overall similarities of the DSB repair outcomes observed for actin-Cas9 and vasa-Cas9 crosses, we extracted a set of 59 shared alleles that appeared in all sequenced samples and performed UMAP (Uniform Manifold Approximation and Projection) analysis to cluster these common alleles, condensing them into 5 distinct clouds (Fig.3f). Clouds 1, 2, 3, and 4 were dominated by alternative subsets of PEPPR alleles distinguished primarily by the length of deletion (the average deletion sizes were 24bp, 40bp, 31bp for PEPPR Mini, Midi-I and Midi-II cluster, and it was longer than 55bp for PEPPR Maxi cluster), while cloud 5 was predominantly comprised of MMEJ alleles. We reviewed raw sequences for the few trans-cloud assigned alleles and discovered that some of these alleles could be interpreted as having been generated from a second round of repair using one of the core alleles from the same cloud as a repair template. For example, we inferred that allele 58 was actually a PEPPR deletion with several nucleotides potentially having been back-filled. This result is consistent with the previous report that alleles with insertions or complex repair outcomes would be generated from several rounds of synthesis following the generation of a primary deletion event57,58. Assessing the impact of such potential complexities, which we ignore here for simplicity, will require additional future scrutiny. The remainder of these alleles, such as allele 44, could be accounted for variability in the exact Cas9 cleavage site (between the 6th and 7th nucleotidescounting from the PAMside), with an extra nucleotide being deleted on the PAM-proximal side of the gRNA cleavage site (Fig.3f)43,59,60. Since both of these outcomes were rare, we hypothesized second-order origins for such outlier alleles further validate the robust nature of our ICP platform in recognizing core primary categories of DNA repair outcomes. We also analyzed the common 59 alleles by plotting their read frequencies and observed that the differences between the allelic landscapes for the two reciprocal crosses per each Cas9 source mirrored the trend in Fig.3ad described above (Supplementary Fig. S2a, b). Cumulatively, these concordant findings support a key role for theparental origin of Cas9 servingas a major determinant of the DSB repair outcome.

Another obvious determinant of DSB repair outcome is the local genomic DNA context. We assessed the general applicability of theICP by employing it to classify alleles generated by gRNAs targeting four other loci: prosalpha2 (pros2), Rab11, Spo11 and Rab5 using the vasa-Cas9 source61. Paralleling our findings from the ple locus, we observed divergent allelic profiles between Paternal-S and Maternal-S crosses with distinct dominant mutation categories based on the specific target site. For example, the predominant allelic classes generated at the Spo11, pros2 and Rab11 loci were PEPPR and INSRT alleles, while PEPPR and MMEJ alleles were most prevalent for the Rab5 targets (Fig.3g, h, Supplementary Figs. S36). Among these four targets, Spo11 displayed the greatest divergence in the prevalence of top alleles generated from Maternal-S and Paternal-S crosses (reminiscent of the fine distinctions parsed for the ple locus, Fig.3g). We nonetheless still observed high correlation coefficients between two replicates within the same cross and significantly lower correlation coefficients associated with inter-cross comparisons between maternal versus paternal Cas9 inheritance (averaged r2=0.33, Fig.3i, j, Supplementary Fig. S3). We also observed distinctive sex-specific DSB repair patterns for Cas9 transmission at the pros2 and Rab11 gRNAs targeting sites (Supplementary Figs. S4 and S5), although these differences were less pronounced than for ple and Spo11 gRNAs, while for Rab5, the allelic patterns were similar for both maternal and paternal crosses (Supplementary Fig. S6, see Supplementary Discussion Section). In summary, these data support the broad utility of the ICP pipeline to deliver unique discernable locus-specific fingerprints associated with distinct parental inheritance patterns of Cas9 that generalize to other genomic targets.

Given the strong Cas9 inheritance-dependent distinctions observed for allelic profiles resulting from maternal versus paternal Cas9/gRNA-induced DSBs in Drosophila, we wondered whether similar DSB repair pattern fingerprints could be discerned in mosquitoes carrying a linked full gene-drive in which the Cas9 and gRNA transgenes are carried together in a single cassette62,63,64,65. We examined this possibility using the transgenic An. stephensi Reckh drive,which is inserted into the kynurenine hydroxylase (kh) locus63. Because of the Cas9 and gRNA linkage, the Reckh drive behaves as the Maternal-F and Paternal-F cross configurations described above in which all CRISPR components are carried by a single parental sex63.

Consistent with our observations in flies, the Reckh Maternal-F crosses generated a high proportion of indels that were dominated to a remarkable extent by single mutant alleles with read percentages exceeding 85% for each of the three single mosquitoes sequenced, followed by a long distributed tail of lower frequency alleles. The highly biased nature of the replicate allelic distributions is readily revealed by a virtual step-function in their rank-ordered allelic landscapes (Fig.4a). In striking contrast, over 50% alleles recovered from the Paternal-F crosses were wild-type (WT), which presumably reflects alleles that either remained uncut or DSB ends that were rejoined accurately without further editing. The highly predominant WT allele was followed by a very shallow tail distribution of low frequency mutant alleles in the paternal rank-ordered allelic landscapes (Fig.4a). This dramatic difference in allelic profiles between Maternal-F versus Paternal-F crosses was also clearly displayed by the class-tally bars color coded for the different fractions of each class (black = WT) located beneath each landscape (Fig.4a). Here, the Class Fraction Index measure indicated that Maternal-F crosses generated a greater proportion of INSRT alleles in the first two samples, while Paternal-F crosses produced a high frequency of PEPPR alleles (Fig.4b). As in the case of allelic profiles recovered at the ple and Spo11 loci in flies, common sets of highly correlated mutant DSB repair fingerprints were observed across all three replicates of the Paternal-F Reckh crosses (Supplementary Fig. S7). A similar comparison of allelic distributions in the maternal crosses was precluded by virtue of the single highly dominant alleles and corresponding paucity of lower frequency events, the nature of which varied greatly between replicates. We conclude that the high-resolution performance of the ICP platform in Drosophila can be generalized to other insects such as An. stephensi to robustly discern sex-dependent CRISPR transmission patterns resulting in distinct DSB repair outcomes.

a Rank-ordered landscapes of the top 50 alleles generated from NGS analysis of single mosquitoes. Colored bars with red dots indicate mutated alleles, and black bars with black dots indicate an unmutated WT allele. Middle panels: allelic class fingerprints color coded as in previous figures. Bottom bars: fraction of each allelic class, including WT (black), PEPPR (sky-blue), MMEJ (deep pink), DELET (orange) and INSRT (purple). Numbers indicate the percentage of the corresponding class. b Class Fraction Index for single mosquito sequencing data in panel a. c Developmental time-points for sample collections. d Kinetics of Cas9 mutagenesis generated by the Reckh gRNA. Lines represent the summed fraction of mutant alleles at each time-point. Dark-blue lines indicate maternal (Maternal-F) crosses and red lines paternal (Paternal-F) crosses. e DSB repair fingerprints at different timepoints. Samples were collected at the time points shown in panel c and 20 eggs, larvae, pupae or adults were pooled together for genomic DNA extraction and deep sequencing. The far left and far right panels indicate the Class percentages including WT alleles (black), displaying the proportion of each class at single time-points. Source data are provided as a Source Data file.

Given the dramatic differences we observed in the frequency and nature of somatic alleles generated in maternal versus paternal-sourced Cas9 in both flies and mosquitoes, we wondered whether the developmental timing of Cas9/gRNA expression (maternal=early? and paternal=late?) was the key determinant for these highly reproducible DSB repair fingerprints. We tested this hypothesis by assessing whether DSB repair fingerprints varied as a function of developmental progression using a series of narrowly timed sample collections of F1 mosquitoes produced from crosses of Reckh parents to WT and assayed DSB repair spectra using the ICP pipeline at 12 different developmental stages (Fig.4c. Note: as homozygous Reckh transgenic mosquitoes were crossed to WT, all F1 progeny carried one Reckh allele and one WT receiver allele, the latter of which was amplified for DSB repair analysis). We tracked a diminishing proportion of WT (presumably uncut) alleles and a corresponding increase in mutant alleles of various classes at each of the time points (Fig.4d). Strikingly, nearly half of the target alleles were edited in embryos by 30minutes post-oviposition for both the Maternal-F and Paternal-F Reckh crosses, which corresponds to early pre-blastoderm stages prior to the maternal-to-zygotic transition, suggesting a very early activity of Cas9 in mosquito embryos driven either by maternally inherited Cas9/gRNA complexes or potentially by very early zygotic expression of the Cas9 and gRNA components (Fig.4d)66. We also observed similarly frequent indels being generated as early as 30min in flies expressing Cas9 (either maternally or paternally) with a gRNA targeting the pros2 locus, although the dynamics of Cas9 production are distinct in these two organisms (Supplementary Fig. S8a). Following this initial surge in target cleavage, we observed divergent trajectories in the accumulation of mutant alleles between maternal versus paternal lineages. As an overall trend, mutant alleles accumulated progressively in the Maternal-F lineage until virtually no WT alleles remained, while in Paternal-F lineage, even at the endpoint of adulthood, approximately 60% of WT alleles persisted, in line with our single time point experiments (Fig.4a, d, Supplementary Fig. S8b). As observed in the final distributions of adult alleles, progeny from Maternal-F crosses tended to be enriched for INSRT alleles over the entire developmental time course, while PEPPR alleles were more common in Paternal-F crosses with pronounced accumulation of such alleles during later stages (Fig.4e). A finer scale analysis of the categories of mutant alleles generated over time revealed dynamic patterns of prevalent alleles during mosquito developmental stages (Fig.4e). For example, the proportion of MMEJ alleles peaked at the 2-hour and 4-hour time points (Fig.4e). Similarly, a split-drive expressing a gRNA targeting the Drosophila pros2 locus generated distinct temporal profiles of cleavage patterns in crosses from female versus male parents carrying the drive element (Supplementary Fig. S9).

One unexpected feature of the developmental variations in allelic composition we observed was that the proportion of WT alleles increased at certain time points (e.g., 1-hour in maternal cross and 12-hour - day 1=24h in paternal cross). These temporal fluctuations were also observed in flies expressing Cas9 and a pros2 gRNA at two hours after oviposition (Supplementary Figs. S8a and S9), revealing that this phenomenon might reflect a generally relevant form of clonal selection for WT cells during pre-blastoderm stages. The latter clonal selection might arise if mutant cells experienced negative selection at certain development stages. In the case of paternal transmission, one strong line of evidence supporting this WT clonal selection hypothesis is that in adults, the Reckh element is transmitted to over 99% of F1 progeny, indicating that nearly all target alleles in the germline must be WT. This high frequency of paternal germline transmission is also consistent with the high prevalence of WT alleles tallied at 12h in embryos derived from the paternal crosses (Fig.4e, see Supplementary Discussion Section for more in-depth consideration of this point). We analyzed the developmental distributions of 21 common alleles that were generated at all time-points (Supplementary Fig. S10ae). Most of these common alleles belonged to the PEPPR class, while only five were INSRT alleles, despite the INSRT class overall being the most prevalent for both crosses, again suggesting that INSRT alleles have a higher diversity than other mutation categories (Supplementary Fig. S10a). Overall, this analysis is in line with our previous observation that Maternal-F crosses produced more INSRT alleles while Paternal-F crosses generated a preponderance of PEPPR alleles (Supplementary Fig. S10b).

Given the strong influence of maternal versus paternal origin of Cas9 on the resulting distributions of alleles characterized above by ICP analysis, we wondered whether such allelic signatures could be exploited for lineage tracing in randomly mating multi-generational population cages. We first examined ICP outputs from a controlled crossing scheme carried out over three generations with pleCC and Reckh gRNAs to derive allelic fingerprints distinguishing parents of origin by identifying both somatic alleles in the F1 generation as well as assessment of which of those alleles might be transmitted through the germline to non-fluorescent progeny (i.e., those not inheriting the pleCC or Reckh element) at the F2 generation (Fig.5ad, Supplementary Fig. S11). As anticipated, in both pleCC and Reckh Maternal-F crosses, single dominant somatic alleles were observed in the F1 generation, with the top single allele representing more than 50% of all alleles (Fig.5a, c). Furthermore, all such predominant somatic mutant alleles, which precluded gene-cassette copying of the pleCC or Reckh drive elements in those F1 individuals, were transmitted faithfully through the germline to non-fluorescent F2 progeny with approximately 50% frequency. Furthermore, we observed marked differences in the other half of total reads in F2 progeny depending on the origin of Cas9/gRNA complexes. Thus, a distribution of multiple diverse low frequency mutations were generated when crossing F1 pleCC+ or Reckh+ females with WT males (presumably derived from F1 drive females having deposited Cas9/gRNA complexes maternally that then acted on the paternally sourced WT allele somatically in F2 individuals). In the reciprocal male cross, however, approximately 50% of all alleles remained WT (Fig.5b, d, Supplementary Fig. S12af). These findings support the hypothesis that the top somatic indels derived from maternal Cas9 sources were generated at very early developmental stages (possibly at the point of fertilization or shortly thereafter during the first somatic cell division), resulting in a single mutant allele being initially produced and then transmitted to every descendent cell including all germline progenitor cells49. With the paternal-sourced Cas9 and gRNA, arrays of variable somatic mutations were recovered with the most prominent alleles accounting for fewer than 10% of the total alleles in F1 progeny (Fig.5b). Accordingly, paternally generated F1 somatic alleles were more randomly transmitted via the germline of individuals that failed to copy the gene cassette for either the pleCC or Reckh elements. As a result of this diversity of somatic F1 alleles, only occasionally were the most prevalent alleles also transmitted through germline (e.g., individuals 1, 4 and 5 in Fig.5b, Supplementary Fig. S12gl).

Primary DNA sequences of top single alleles and their percentages of the total alleles from six individual sequenced flies derived from ple gRNA Maternal-F (a) and Paternal-F (b) crosses. Gray bars indicate the location of the gRNA protospacer and red arrowheads are the associated PAM sites. The first row depicts the reference sequence covering the expected DSB cleavage site. Colored squares in the right column indicate the class to which a given allele belongs to. The tables shown on the right of each allele show its frequency among all reads. Left columns of the table indicate frequencies of the somatic allele, and the right columns are the top germline mutant allele frequency obtained by sequencing F2 non-fluorescence progeny derived from same F1 individuals whose top somatic allele is displayed in the left column (excluding WT alleles). Colored dots indicate different alleles with the same color shared between two columns indicating that the same allele appeared as both top 1 somatic and germline indels from the same F0 founders. c, d Allele profiles generated by Reckh parents and progeny generated with the same crossing scheme as for the pleCC. c Tabulation of the Maternal-F cross. d Tabulation of the Paternal-F cross. e Crossing scheme forthe Reckh cage trials. Three individual cages were seeded with 10 homozygous Reckh females, 90 WT females and 100 WT males for the maternally initiated lineage, while the paternally initiated cages were seeded with 10 homozygous Reckh males, 90 WT males and 100 WT females. At each of the following three generations, 10 Reckh+ females and 10 Reckh+ males were randomly collected for single mosquito deep sequencing. f Biased inheritance of Reckh was observed in the maternally seeded cages at generations 2 and 3, but not for the paternally seeded cages. Pink bars denote the fraction of sequenced individual mosquitoes inheriting Reckh from female parents, and cyan colored bars represent Reckh inheritance from the males. Source data are provided as a Source Data file.

The Reckh element in mosquitoes performed similarly to the fly pleCC, however, Reckh F1 individuals displayed less frequent zygotic cleavage and a corresponding reduction in the diversity of resulting somatically generated mutations (>50% WT alleles remained, Paternal-F cross). Consistent with this limited number and array of somatic mutations in the F1 generation from Paternal-F cross, NHEJ mutations were only rarely transmitted to the F2 generation, probably due to more germline-restricted expression of vasa-Cas9 in mosquitoes as compared to flies (Fig.5c, d). These results again suggest that cleavage and repair events were generated later during development in paternal crosses resulting in a stochastic transmission of F1 somatic alleles to the germline, which were largely uncorrelated with the most prevalent allele present somatically in the F1 parent49. Taken together, these highly divergent sex-dependent DSB repair signatures suggested that such genetic fingerprints could be used to track parental history in the context of randomly mating multi-generation population cages.

Based on the highly dominant mutant indels (Maternal-F) versus WT (Paternal-F) alleles generated by Reckh genetic element described above, we evaluated inheritance patterns of indels in multi-generational cages initiated by a 5% introduction of Reckh into WT populations either through maternal or paternal lineages in the F0 generation (Fig.5e). We randomly selected at least 20 fluorescence marker-positive mosquitoes (10 females and 10 males) for NGS analysis at generations 2 and 3, when the Reckh allele was still present at relatively low frequencies in the population and random mating was more likely to have taken place between Reckh/+ heterozygous and WT mosquitoes. Thus, we envisioned that the source of Reckh allele could be tracked back to a male versus female parent of origin by examining whether a dominant WT allele was present (inherited paternally) or not (inherited maternally) (Fig.5e, f). Following this reasoning, we inferred a strong bias for progeny inheriting the Reckh element from a Reckh+ males mating with WT females during generations 2 and 3 than the reverse (i.e., female transmission of Reckh alleles) in the maternally seeded lineage. Indeed, in one maternally seeded replicate (cage 2, generation 3), 100% of the progeny had inherited the Reckh element from their fathers (Fig.5f). In contrast to the striking sex-specific transmission bias observed in maternally seeded cages, progeny from paternally seeded cages displayed more evenly distributed stochastic parental inheritance patterns (Fig.5f). These highly reproducible parent of origin signatures demonstrate the utility of ICP in allelic lineage tracking, which could be of great potential utility in evaluating alternative initial release strategies for gene-drive mosquitoes as well as post-release surveillance of gene-drives as they spread through wild target populations (see Discussion).

Another important challenge for deciphering DSB repair outcomes is to track both NHEJ and gene-cassette mediated HDRevents within the same sample. Such a comprehensive genetic detection tool could have broad impactful applications (see Discussion). For example, one important and non-trivial application is to follow the progress of gene-drives in a marker free fashion as they spread through insect populations. Such dual tracking capability would address the potential concern that mutations eliminating a dominant marker for the gene-drive element could evade phenotype-based assessments of the drive process. Accordingly, we devised a three-step short-amplicon based deep sequencing (200400bp) strategy based on tightly linked colony-specific nucleotide polymorphisms distinguishing donor versus receiver chromosomes to detect copying of two CopyCatcher elements, pleCC and hthCC, from their chromosomes of origin (donor chromosome) to WT homologous (receiver chromosome) targets (Fig.6a)49. Notably, this strategy only amplified the inserted gene cassette on the donor chromosome and or the cassette if it copied onto the receiver chromosome. Thus, the measured allelic frequencies indicate the relative proportions of gene cassettes copied to the receiver chromosome versus those residing on the donor chromosome (Fig.6b displays the inferred somatic HDR frequency quantified from the three-step NGS sequencing protocol as well as Indels quantified by our standard 2-step NGS sequencing protocol - see Methods section for additional details).

a Scheme for tracking gene-drive copying using NGS. Gray bars: genomic DNA, pink oval: Cas9 protein, sky-blue line: gRNA, colored asterisks: polymorphisms. Color coded rectangles represent four nucleotides. Four possible recombinants listed are generated by resolving Holliday junctions at different sites marked with black crosses. b NGS sequencing-based quantification of somatic HDR generated by pleCC in F1 progeny. Areas delineated by dotted lines indicate patches of cells in which somatic HDR copying events have taken place either under bright field (upper) or RFP fluorescent filed (middle). Bottom bars are the summary of the inferred frequency for the somatic HDR (orange), indels (green) and WT alleles (black) derived from the deep sequencing data using the same samples photographed above. More than three flies from each cross were imaged and used for analysis. Scale bars indicate 200 pixels. c Somatic HDR profile with ple gRNA. The red line is for Maternal-F cross and dark blue line for the Paternal-F cross. d Diagram of the hthCC. Black double arrow: recoded hth cDNA, blue rectangles: exon 1, light green rectangles: exons 2-14, and colored lines underneath represent probes used for detection. e In situ images with embryos laid from hthCC-vasa-Cas9 females crossed with WT males. Blue=exon 1, green=WT exons 2-14, red=recoded cDNA for exons 2-14. Insets are magnified single nuclei indicated by colored arrows. This experiment has been repeated at least three times. Scale bars stand for 10m. f Temporal profiles for somatic HDR-mediated copying of the hthCC element assessed by NGS as described for the pleCC in panels c and f. Y-axis tabulates the percentage of HDR at a given time point. Table at the bottom quantifies the HDR fraction at given time points for both the Paternal-F and Maternal-F crosses. Source data are provided as a Source Data file.

In our first set of experiments, we analyzed editing outcomes by examining F1 progeny derived from Maternal-S and Paternal-S pleCC crosses. We compared the rates of somatic HDR measured by NGS analysis to those evaluated by image-based phenotypes associated with copying of the CopyCatcher element. As summarized previously, CopyCatchers such as the pleCC are designed to permit quantification of concordant homozygous mutant clonal phenotypes (e.g., pale patches of thoracic cuticle and embedded sectors ofcolorless bristles), with underlying DsRed+ fluorescent cell phenotypes49. Individual flies in which imaging-based analysis had been conducted were then subject toseparate NGS HDR-fingerprinting and INDELs-fingerprinting resulting in a comprehensive quantification of HDR, NHEJ, and WT alleles within the same sample (Fig.6b, libraries for HDR-fingerprinting and INDELs-fingerprinting were prepared from the same individual fly, but with different DNA preparation and sequencing protocols as detailed description in Methods). For these experiments, F1 flies were genotyped and those carrying both Cas9 and pleCC gRNA were used for NGS analysis (data shown here are the inferred frequencies of somatic HDR, NHEJ events, and WT alleles). This dual integrated analysis revealed that HDR in the Maternal-S crosses resulted in ~15% somatic HDR-mediated cassette copying events on average based on sequencing, and that such cassette copying was yet more frequent in Paternal-S crosses, producing ~25% somatic HDR. The nearly two-fold greater HDR-mediated copying efficiency detected by sequencing in Paternal-S crosses mirrors phenotypic outcomes wherein maternally inherited Cas9 similarly results in a lower frequency of cassette copying detected by fluorescence image analysis in somatic cells than for paternally inherited Cas9 (Fig.6b)49.

Our genetic analysis of stage-dependent differences in DSB repair pathway activity in this study is consistent with a commonly held view in the gene-drive field based on a variety of indirect genetic transmission data that HDR-mediated cassette copying does not occur efficiently during early embryonic stages50,51,63,67,68,69,70. This inference, however, has not yet been verified experimentally. We thus sought to provide direct evidence supporting this key supposition using NGS-based HDR-fingerprinting to track the somatic HDR events across a range of developmental stages in both Maternal-F and Paternal-F crosses in which the Cas9 and gRNA transgenes are transmitted together either maternally or paternally using our validated NGS sequencing protocol. Notably, we collected samples at 9 timepoints and pooled 20 F1 progeny together for pooled sequencing to prime the developmental profile of somatic HDR with pleCC (samples were thus collected without genotyping since it is impractical to genotype individual embryos and young larvae). Because of the limitations imposed by embryo pooling we were unable to use the same samples collected here for also quantifying the generation of somatic NHEJ alleles (i.e., only half of the F1 progeny carried the vasa-Cas9 transgene on the X chromosome and those embryos lacking this transgene were not suitable for generating mutations - note that such an analysis was possible in the case of the viable Reckh drive shown in Fig.4e as well as for a viable split-drive allele inserted into the essential prosalpha2 locus shown in Supplementary Fig. S9). Indeed, NGS analysis detected only very rare examples of somatic HDR events in early embryos derived from both crosses (Fig.6c). Notably, HDR in the Paternal-F cross detected by this sequencing protocol increased substantially to 35.9% during adult stages, a period coinciding with the temporal peak of the pale expression profile (note that in this experiment we employed the actin-Cas9 rather than vasa-Cas9 source, which has higher level of Cas9 expression in somatic cells and generates a correspondingly higher frequency of somatic HDR)49.

We extended our sequencing-based strategy to quantify somatic HDR using a second CopyCatcher element (hthCC) designed specifically to identify even rare copying events in early blastoderm-stage embryos. The hthCC is inserted into the homothorax (hth) gene and was engineered to visualize HDR-mediated copying of the gene cassette by fluorescence in situ hybridization (FISH) using discriminating fluorescent RNA probes complementary to specific endogenous versus recoded cDNA sequences (Fig.6d, e). In this system, copying of the transgene from the donor chromosome to the receiver chromosome would be indicated by the presence of two nuclear dots of red fluorescence detected by the hth recoded cDNA-specific probe (indicating two copies of recoded hth cDNA). In contrast, cells in which no copying occurred should contain only a single nuclear red dot signal (from the donor allele). Such in situ analysis detected no clear case of gene cassette copying in any of the ~5000 blastoderm stage cells examined across ~500 embryos (with the caveat that some mitotic nuclei generate ambiguous signals depending on their orientation). This qualified negative result assessed by in situ analysis was consistent with the very low estimates of HDR frequency during the same early blastoderm-stage developmental window based on NGS analysis in staged time-course experiments, although the latter sequencing method did detect very low levels of somatic HDR at ~3hours after egg laying from the Paternal-F crosses (and no copying until day three of larvae with the maternal cross Fig.6df). The very low levels of somatic HDR observed in early embryos for the hthCC construct either by in situ hybridization or by NGS sequencing parallel the results summarized above for the pleCC element (Fig.6c, f). The maximal somatic HDR frequency observed for the hthCC Maternal-F crosses (0.06% at day 3 after egg laying) was somewhat lower than that for the similar cross for pleCC (0.35% at adult stage), consistent with the predominance of single mutant alleles being generated at very early stages following fertilization in Maternal-F crosses. In contrast to the exceedingly rare copying of the hthCC element detected in early embryos for either the Maternal-F or Paternal-F crosses, the same element frequently copied to the homologous chromosome during later developmental stages in Paternal-F crosses as assessed by NGS sequencing. The hthCC elementagain copied with somewhat lower efficiency than the pleCC element (e.g., 15.2% for hthCC versus 35.9% for pleCC tabulated in adults), presumably reflecting differing genomic cleavage rates or gene conversion efficiencies generated by their respective gRNAs (including total cleavage levels and temporal features). In aggregate, these two examples of quantitative analysis of copying frequencies based on both NGS and in situ analysis demonstrate that ICP and NGS-based quantification of gene conversion events can be successfully integrated for a comprehensive analysis of DSB repair outcomes, including both NHEJ and HDR events as a function of developmental stage. These powerful tools also could be applied for following gene-drive spread through freely mating populations in a marker-free manner as well as for a variety of other applications including gene therapy (see Discussion).

View post:
Developmental progression of DNA double-strand break repair deciphered by a single-allele resolution mutation ... - Nature.com

CRISPR Therapeutics AG (CRSP) Outperforms Broader Market: What You Need to Know  Yahoo Finance

Read more here:
CRISPR Therapeutics AG (CRSP) Outperforms Broader Market: What You Need to Know - Yahoo Finance

Engineering the Microbiome: CRISPR Leads the Way  The Scientist

Read the rest here:
Engineering the Microbiome: CRISPR Leads the Way - The Scientist

NICE not sold on Vertex, CRISPR's groundbreaking sickle cell gene therapy Casgevy without more data  FiercePharma

See the article here:
NICE not sold on Vertex, CRISPR's groundbreaking sickle cell gene therapy Casgevy without more data - FiercePharma

Searching for Data in DNA with CRISPR - UConn Today  University of Connecticut

More here:
Searching for Data in DNA with CRISPR - UConn Today - University of Connecticut

Is It Too Late to Buy CRISPR Therapeutics Stock?  The Motley Fool

Originally posted here:
Is It Too Late to Buy CRISPR Therapeutics Stock? - The Motley Fool

Vertex Resolves To Reverse English Funding Rejection For CRISPR Sickle Cell Gene Therapy  Pink Sheet

Link:
Vertex Resolves To Reverse English Funding Rejection For CRISPR Sickle Cell Gene Therapy - Pink Sheet

Crispr Therapeutics CFO sells shares worth over $256k By Investing.com  Investing.com

Go here to read the rest:
Crispr Therapeutics CFO sells shares worth over $256k By Investing.com - Investing.com

CRISPR gene editing applications are expanding dramatically in agriculture. Here are the latest advances  Genetic Literacy Project

See more here:
CRISPR gene editing applications are expanding dramatically in agriculture. Here are the latest advances - Genetic Literacy Project

Crispr Therapeutics CEO sells over $1.4m in company stock By Investing.com  Investing.com

The rest is here:
Crispr Therapeutics CEO sells over $1.4m in company stock By Investing.com - Investing.com

What's the Latest in CRISPR Gene-Editing Technology?  Technology Networks

Read the original here:
What's the Latest in CRISPR Gene-Editing Technology? - Technology Networks

In vivo genome-wide CRISPR screening identifies CITED2 as a driver of prostate cancer bone metastasis | Oncogene  Nature.com

Read more here:
In vivo genome-wide CRISPR screening identifies CITED2 as a driver of prostate cancer bone metastasis | Oncogene - Nature.com