Archive for the ‘Crispr’ Category

Crispr Therapeutics AG (CRSP) stock has gained 35.58% over the past week and gets a Bullish rating from InvestorsObserver's Sentiment Indicator.

In investing, sentiment generally means whether or not a given security is in favor with investors. It is typically a pretty short-term metric that relies entirely on technical analysis. That means it doesnt incorporate anything to do with the health or profitability of the underlying company.

Recent trends are a good indicator of current market sentiments. In its most basic form, stocks that are trending up are desirable by investors while stocks currently falling must be unattractive.

InvestorsObserver's Sentimental Indicator tracks both changes in price and volume to analyze the most recent trends. Typically an increase in volume indicates ongoing trends are getting stronger, while a decrease in volume usually signals an end to the current trend.

Available options can also represent current sentiments for a given stock. Since investors are able to bet on future trends of stocks using options, we consider the ratio of calls to puts when analyzing market sentiments .

Crispr Therapeutics AG (CRSP) stock is trading at $207.58 as of 10:53 AM on Friday, Jan 8, an increase of $13.15, or 6.76% from the previous closing price of $194.43. The stock has traded between $196.11 and $210.39 so far today. Volume today is below average. So far 1,482,585 shares have traded compared to average volume of 2,079,604 shares.

To see InvestorsObserver's Sentiment Score for Crispr Therapeutics AG click here.

CRISPR Therapeutics AG is a gene-editing company. It is engaged in the development of CRISPR/Cas9-based therapeutics. CRISPR/Cas9 is a technology that allows for precise, directed changes to genomic DNA. The company advanced programs target beta-thalassemia and sickle cell disease, two hemoglobinopathies that have a high unmet medical need.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

Go here to see the original:
What is the Market's View on Crispr Therapeutics AG (CRSP) Stock's Price and Volume Trends - InvestorsObserver

Three years ago, the Food and Drug Administration granted a landmark approval to the first gene therapy for an inherited disease, clearing a blindness treatment called Luxturna.

Since then, the regulator has approved one more gene therapy,the spinal muscular atrophy treatment Zolgensma, and given a green light for dozens of biotech and pharmaceutical companies to start clinical testing on others. Genetic medicines for a range of diseases, including hemophilia, sickle cell and several muscular dystrophies, appear in reach, and new science is galvanizing research.

But, entering 2021, the gene therapy field faces major questions after a series of regulatory and clinical setbacks have shaded optimism. "The ups and downs of adolescence are on full display" analysts at Piper Sandler wrote in September, summing up the state of gene therapy research.

Here are five questions facing scientists, drugmakers and investors this year. How they're answered will matter greatly to the patients and families holding out hope for one-time disease treatments.

The FDA was widely expected last year to approve a closely watched gene therapy for hemophilia A, the more common type of the blood disease. Instead, the agency in August surprisingly rejected the treatment, called Roctavian, and asked its developer, BioMarin Pharmaceutical, to gather more data.

The next day, Audentes Therapeutics reported news came a third clinical trial participant had died after receiving the biotech's experimental gene therapy for a rare neuromuscular disease. The tragedy brought flashbacks to past safety scares in gene therapy, although the current wave of treatments being tested have generally appeared safe.

A little less than five months later, the gene therapy field is grappling with two more setbacks. UniQure is exploring whether a study volunteer's liver cancer was caused by its gene therapy for hemophilia B. And Sarepta, one of the sector's top developers, faces significant doubts about its top treatment for Duchenne muscular dystrophy after disclosing a key study missed one of its main goals.

In each case, the drugmakers involved offered explanations and reasons for optimism. BioMarin still expects to obtain an approval; Audentes' trial is now cleared by the FDA to resume testing; UniQure thinks it's unlikely the cancer case is linked to treatment; and Sarepta argued its negative data were the product of unlucky study design.

But taken together, the developments are powerful reminders of both the stakes and uncertainty still facing gene therapy.

All four events also highlighted lingering worries about one-time genetic treatment. In rejecting Roctavian, for example, the FDA seemed to be concerned the impressive benefit hemophilia patients initially experienced may wane over time. The deaths in Audentes' study, meanwhile,renewed warnings about extremely high doses of gene therapy. Researchers have long watched for evidence that replacing or altering genes may cause cancer to develop in rare instances, particularly after four infants developed leukemia in a gene therapy study in the early 2000s.And Sarepta's negative findings were surprising because early signs of dramatic biological benefit that didn't seem to translate into clear-cut functional gains for all patients.

Experts are still confident gene therapy can deliver on its promise. Bu recent events suggest getting there may take a bit longer than some expected.

"The process is the product," is an often-used cliche about gene therapy, which are complex treatments with exacting manufacturing standards.

Most of the roughly 60,000 pages in Spark Therapeutics' application for approval of Luxturna, for instance, involved what's known in the industry as "chemistry, manufacturing and controls."

The therapeutic basis for gene therapy, by contrast, is much clearer for many of the rare, monogenic diseases that developers are targeting. If mutations in a single gene lead to disease, replacing or otherwise fixing that gene should have a large benefit.

"Genetic medicine is not industrialized serendipity," said Gbola Amusa, an analyst at Chardan, contrasting gene therapy with chemical-based drugs."It often is an engineering question."

In 2020, the FDA gave ample notice that it's watching gene (and cell) therapy manufacturing closely.Sarepta,Voyager Therapeutics,Iovance Biotherapeuticsand Bluebird biowere all forced to revise their development timelines after the agency asked for new details about production processes.

"The FDA is saying to companies that you've got to up your standards," Amusa added.

For their part, FDA officials have indicated the spate of data requests are a product of the sharply higher numbers of companies advancing through clinical testing.

While setbacks have piled up for therapies that seek to replace genes, 2020 was a "transformative year" for therapies designed to edit them, according to Geulah Livshits, an analyst at Chardan.

CRISPR gene editing, already widely recognized as a scientific breakthrough, gained further prestige with the awarding of the Nobel Prize in Chemistry to two early pioneers, Jennifer Doudna and Emmanuelle Charpentier.

But the year also brought important progress from early biotech adopters.Editas Medicine and Intellia Therapeutics, for example, notched CRISPR firsts with use of the editing technology inside the human body.

And CRISPR Therapeutics and partner Vertex showed their experimental therapy, which uses CRISPR to edit stem cells, worked exceptionally well in the first 10 patients with either sickle cell disease or beta thalassemia treated in two early studies.

The data are the most concrete sign yet that CRISPR's clinical use can live up to its laboratory promise. While all three companies' therapies are still in early stages, their advances have ginned up substantial investor enthusiasm.

Together, the market value of CRISPR Therapeutics, Editas and Intellia totals nearly $25 billion. Beam Therapeutics, a startup that uses a more precise form of gene editing, is worth nearly $6 billion.

"Gene therapy will have a big role to play," said John Evans, Beam's CEO. "But I do think in the last year or so there's a growing realization that, when possible, you'd probably rather edit than add an extra gene."

Clinical tests will prove that out but, until then, the large upswing in share price for gene editing companies may not be sustainable as valuations creep higher and higher. Some of the recent run-up, for instance,appears driven by money flowing from generalist investors through exchange-trade funds, rather than from investors experienced in handicapping preclinical- or early clinical-stage companies.

"They're overdue for some type of rationalization," predicted Brad Loncar, CEO of Loncar Investments, adding that many companies are targeting similar diseases, most commonly sickle cell and beta thalassemia.

Tasked with replacing faulty genes with functional ones, scientists for the most part have turned to two types of viruses to safely shuttle genetic instructions into cells. Adeno-associated viruses, or AAVs,are typically used for infused treatments, while researchers working on cells extracted from patients generally opt for lentiviruses.

Each virus class has advantages, but also notable drawbacks. AAVs, for instance, can trigger pre-existing immune defenses in some people, making those individuals ineligible or poor candidates for gene therapy. Lentiviruses, by contrast, are known to integrate their DNA directly into the genomes of cells they infect a useful attribute in some regards but limiting in others.

Over decades of gene therapy research, scientists have found ways to tweak and modify these viral vectors to better suit their needs, but the basic tools are the same. Jim Wilson, a gene therapy pioneer who ran the study that led to the death of teenager Jesse Gelsinger in 1999, told attendees at a STAT conference last fall that he's "somewhat disappointed" by slow progress in viral vector research.

And as more and more gene therapies enter clinical testing, the limitations of current viral vectors have become more apparent.

The pace of research might be picking up, however. Recently, a number of companies aiming to build better delivery tools have launched, including Harvard University spinout Dyno Therapeutics and 4D Molecular Therapeutics, which recently raised $222 million in an initial public offering.

Larger companies are interested, too. Roche, Sarepta and Novartis have all partnered with Dyno, for example.

In gene editing, meanwhile, researchers are developing new ways to cut DNA, while Beam and others are advancing different editing approaches altogether.

Billions of dollars have flowed from pharmaceutical companies into gene therapy over the past few years, leaving few large multinational drugmakers without a research presence.

2020 was no different, with sizable acquisitions inked by Bayer and Eli Lilly, as well as an array of smaller investments from Pfizer, Novartis, Johnson & Johnson, Biogen,and UCB. And CSL Behring, best known for its blood plasma products, spent nearly half a billion dollars to buy UniQure's most advanced gene therapy, a treatment for hemophilia B.

Over the past three years, there's been at least $30 billion spent on biotechs involved in gene or cell therapy. (Four deals account for the majority of that value.)

All of that dealmaking, while following promising and compelling science, is ultimately a bet that one-time genetic treatments can be scaled up and commercialized into a lucrative business.

Many of the acquired companies are working on therapies for very rare disorders affecting hundreds or thousands of people. A handful, however, are taking aim at more prevalent conditions, starting with still relatively uncommon diseases like hemophilia to ones affecting millions of people like Parkinson's.

"For gene therapy to meet our lofty expectations not just for investors, but for society it has to make the leap from these ultra-rare diseases," said Loncar.

Commercially, the track record for the few therapies on the market in the U.S. is mixed.Luxturna, now owned by Roche, is a niche product.Zolgensma has broader use and earned Novartis about $1 billion in the year and a half it's been commercially available.

Two cell therapies from Novartis and Gilead, meanwhile, have struggled to gain traction.

Gene therapy's biggest commercial test yet was supposed to come this year, with the expected approval of BioMarin's Roctavian in hemophilia A. The FDA's surprise rejection could mean a yearslong delay in the U.S., but the challenges of pricing, reimbursement and patient access in gene therapy remain dauntingly large.

Read this article:
5 questions facing gene therapy in 2021 - BioPharma Dive

This article was originally published here

Infection. 2021 Jan 3. doi: 10.1007/s15010-020-01554-w. Online ahead of print.

ABSTRACT

PURPOSE: CRISPR gene-editing technology has the potential to transform the diagnosis and treatment of infectious diseases, but most clinicians are unaware of its broad applicability. Derived from an ancient microbial defence system, these so-called molecular scissors enable precise gene editing with a low error rate. However, CRISPR systems can also be targeted against pathogenic DNA or RNA sequences. This potential is being combined with innovative delivery systems to develop new therapeutic approaches to infectious diseases.

METHODS: We searched Pubmed and Google Scholar for CRISPR-based strategies in the diagnosis and treatment of infectious diseases. Reference lists were reviewed and synthesized for narrative review.

RESULTS: CRISPR-based strategies represent a novel approach to many challenging infectious diseases. CRISPR technologies can be harnessed to create rapid, low-cost diagnostic systems, as well as to identify drug-resistance genes. Therapeutic strategies, such as CRISPR systems that cleave integrated viral genomes or that target resistant bacteria, are in development. CRISPR-based therapies for emerging viruses, such as SARS-CoV-2, have also been proposed. Finally, CRISPR systems can be used to reprogram human B cells to produce neutralizing antibodies. The risks of CRISPR-based therapies include off-target and on-target modifications. Strategies to control these risks are being developed and a phase 1 clinical trials of CRISPR-based therapies for cancer and monogenic diseases are already underway.

CONCLUSIONS: CRISPR systems have broad applicability in the field of infectious diseases and may offer solutions to many of the most challenging human infections.

PMID:33393066 | DOI:10.1007/s15010-020-01554-w

Read more from the original source:
CRISPR-based strategies in infectious disease diagnosis and therapy - DocWire News

Market research analysis is one of the finest options to resolve business challenges quickly by saving lot of time. The research work, market insights and analysis is carried out thoroughly in this report that puts forth marketplace clearly into the centre of attention. A transparent research method has been accomplished with the right tools and techniques to make this Plant Breeding and CRISPR Plants Market research report world-class. This business report gives an actionable market insight to the clients with which sustainable and profitable business strategies can be created. Analysis and discussion of important industry trends, market size, sales volume, and market share are also estimated in the report.

Competitive analysis conducted in this reliable Plant Breeding and CRISPR Plants report puts light on the moves of the key players in the Plant Breeding and CRISPR Plants industry such as new product launches, expansions, agreements, joint ventures, partnerships, and recent acquisitions. The industry analysis report puts forth an array of market insights which help with the more precise understanding of the market landscape, issues that may impose on the industry in the future, and how to position specific brands in the best way. The global Plant Breeding and CRISPR Plants Market research report offers market potential for each geographical region based on the growth rate, macroeconomic parameters, consumer preferences and buying patterns, market demand and supply scenarios.

Summary of the Report

The market would gain significant growth rate during the forecast period of 2020 to 2027 reaching a substantial market size by 2027. The market has been analyzed taking into considerations the different factors which includes the market drivers, restraints, opportunities, key competitor landscape, trend analysis, outlook, estimate and forecast factors.

Plant breeding and CRISPR plants market is expected to reach USD 21.78 billion by 2027 growing with the growth rate of 13.70% in the forecast period 2020 to 2027. Rising importance for sustainable crop production drives the growth of plant breeding and CRISPR plants market in the forecast period of 2020- 2027.

Get Free Sample Copy of the Report to understand the structure of the complete report @https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-plant-breeding-and-crispr-plants-market

Major Key Players of the Plant Breeding and CRISPR Plants Market

Bayer AG, KWS SAAT SE & Co. KGaA, DuPont, SGS SA, DLF Seeds Ltd, BioConsortia Inc., Hudson River Biotechnology., Pacific Biosciences of California, Inc, Eurofins Scientific, Syngenta, SGS SA, Land OLakes, Inc, Advanta Seeds Pty Ltd, J.R. Simplot Company among other domestic and global players.

Market Scope, Segments and Forecast of the Plant Breeding and CRISPR Plants Market

The Plant Breeding and CRISPR Plants Market is witnessing high demand due to the rise in demand of the product across different end-use areas. On the basis of product, geography and application the market is bi-furcated into different sub-segments as per the feasibility check and market estimation from 2020 to 2027 have been provided for these segments.

Market Overview, Key Trends Market Dynamics

The market would gain significant growth rate during the forecast period, reaching a substantial market size by 2020. The market has been analyzed taking into considerations the different factors which includes the market drivers, restraints, opportunities, key competitor landscape, trend analysis, outlook, estimate and forecast factors. The impact of COVID -19 could be seen on the market; however, the Plant Breeding and CRISPR Plants Market would recover from this pandemic by end of the next year. We have also mentioned the key trends of the market that would impact the growth of the market at present and in the coming years as well.

Check Table of Contents of This Report @https://www.databridgemarketresearch.com/toc/?dbmr=global-plant-breeding-and-crispr-plants-market

Geographical Coverage of Plant Breeding and CRISPR Plants Market

Table of Contents

Do You Have Any Query Or Specific Requirement? Ask to Our Industry Expert@https://www.databridgemarketresearch.com/speak-to-analyst/?dbmr=global-plant-breeding-and-crispr-plants-market

Key Pointers of the Report

Additional Pointers of the Report:

Given below are some of the added key points of the report:

About Us:

Data Bridge Market Research set forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge Market Research provides appropriate solutions to the complex business challenges and initiates an effortless decision-making process.

Data Bridge adepts in creating satisfied clients who reckon upon our services and rely on our hard work with certitude.We are content with our glorious 99.9 % client satisfying rates.

Contact Us:

Data Bridge Market Research

Tel: +18883872818

corporatesales@databridgemarketresearch.com

See the original post:
Plant Breeding And CRISPR Plants Market Is Expected To Reach USD 21.78 Billion By 2027 | Top Companies- Bayer AG, KWS SAAT SE & Co. KGaA, DuPont,...

A rating of 80 puts Crispr Therapeutics AG (CRSP) near the top of the Biotechnology industry according to InvestorsObserver. Crispr Therapeutics AG's score of 80 means it scores higher than 80% of stocks in the industry. Crispr Therapeutics AG also received an overall rating of 64, putting it above 64% of all stocks. Biotechnology is ranked 30 out of the 148 industries.

Searching for the best stocks to invest in can be difficult. There are thousands of options and it can be confusing on what actually constitutes a great value. Investors Observer allows you to choose from eight unique metrics to view the top industries and the best performing stocks in that industry. A score of 64 would rank higher than 64 percent of all stocks.

These scores are not only easy to understand, but it is easy to compare stocks to each other. You can find the best stock in an industry, or look for the sector that has the highest average score. The overall score is a combination of technical and fundamental factors that serves as a good starting point when analyzing a stock. Traders and investors with different goals may have different goals and will want to consider other factors than just the headline number before making any investment decisions.

Crispr Therapeutics AG (CRSP) stock is trading at $180.75 as of 10:23 AM on Thursday, Jan 7, a rise of $16.90, or 10.32% from the previous closing price of $163.85. The stock has traded between $169.39 and $185.43 so far today. Volume today is light. So far 888,487 shares have traded compared to average volume of 1,989,285 shares.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

More here:
Where Does Crispr Therapeutics AG (CRSP) Stock Fall in the Biotechnology Field? - InvestorsObserver

CRISPR and CAS Gene Market witness to garner US$ 7,603.8 Million at a booming CAGR of +20% by the term of 2021-28.

CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome by removing, adding or altering sections of the DNA sequence. It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.

CRISPR is a tool that can be used to edit genes and, as such, will likely change the world. The essence of CRISPR is simple: its a way of finding a specific bit of DNA inside a cell. After that, the next step in CRISPR gene editing is usually to alter that piece of DNA.

When viruses infect bacteria, bacteria will produce this type of DNA and bind to virus DNAs; with working with one nuclease, called Cas, the Cas enzyme will cut the invaded DNA into pieces. Thus, CRISPR/Cas is a type of acquired immune defense mechanism for prokaryotes against virus.

Request a sample copy of report @ https://www.reportconsultant.com/request_sample.php?id=79563

The CRISPR and CAS Gene Market report gives the 360 degree perspective on the fundamentals of market, definitions, groupings, applications and industry chain review, industry arrangements and plans, item details, forms, cost structures and afterward on. At that point it examine the worlds primary district and economic situations, including the product value, benefit, limit, creation, limit usage, request and development pace of industry.

The investigator likewise centers around monetary and ecological variables, which impacts on the development of the business. Essential and auxiliary exploration methods have been utilized by analysts to get appropriate experiences into business. Requesting patterns and mechanical headways have been introduced in the examination report.

Key Players:

Caribou Biosciences Inc., CRISPR Therapeutics, Mirus Bio LLC, Editas Medicine, Takara Bio Inc., Synthego, Thermo Fisher Scientific, Inc., GenScript, Addgene, Merck KGaA (Sigma-Aldrich), Integrated DNA Technologies, Inc., Transposagen Biopharmaceuticals, Inc., OriGene Technologies, Inc., New England Biolabs, Dharmacon, Cellecta, Inc., Agilent Technologies, and Applied StemCell, Inc.

Highlights of the report:

The report covers the major driving factors influencing the revenue scale of the CRISPR and CAS Gene Market and details about the surging demand in this area. The report then highlights the latest trends and challenges that leading industry contenders could face. The significant applications and potential business areas are also added to this report. CRISPR and CAS Gene market research is provided for international markets as well as development trends, competitive landscape analysis and development status of key regions. Development policies and plans are discussed as well as manufacturing processes and analysis of cost structures. This report also shows import/export consumption, supply and demand, costs, prices, revenues and gross margins.

CRISPR and CAS Gene Market Report Segment: by product

CRISPR and CAS Gene Market Report Segment: by application

CRISPR and CAS Gene Market Report Segment: by end-user

CRISPR and CAS Gene Market Report Segment: by region

Get upto 40% Discount available on this Report @ https://www.reportconsultant.com/ask_for_discount.php?id=79563

The report provides major statistics of the industry and is a valuable source of guidance and direction for companies and individuals interested in the market. CRISPR and CAS Gene is explained in detail in various regions and various segments of the industry.

Table of Content:

About Us:

Report Consultant A worldwide pacesetter in analytics, research and advisory that can assist you to renovate your business and modify your approach. With us, you will learn to take decisions intrepidly by taking calculative risks leading to lucrative business in the ever-changing market. We make sense of drawbacks, opportunities, circumstances, estimations and information using our experienced skills and verified methodologies.

Our research reports will give you the most realistic and incomparable experience of revolutionary market solutions. We have effectively steered business all over the world through our market research reports with our predictive nature and are exceptionally positioned to lead digital transformations. Thus, we craft greater value for clients by presenting progressive opportunities in the global futuristic market.

Contact us:

Riaana Singh

(Report Consultant)

sales@reportconsultant.com

http://www.reportconsultant.com

Link:
CRISPR and CAS Gene Market 2021-2028 shooting revenue at US$ 7,603.8 Million with CRISPR Therapeutics, Mirus Bio, Caribou Biosciences, Editas...

CAMBRIDGE, Mass.--(BUSINESS WIRE)--The 221b Foundation, a nonprofit organization established by Sherlock Biosciences to address the global COVID-19 pandemic and diverse representation in STEM, today announced an initiative with the Ministry of Health and Population (MoHP) in Nepal to control the spread of SARS-CoV-2 throughout the country. With contributions from Sherlock Biosciences, Open Philanthropy, Integrated DNA Technologies and MoHP, The 221b Foundation will provide support to the country of Nepal through financial assistance and donations of equipment and Sherlock CRISPR SARS-CoV-2 kits, which the country has designated as an essential diagnostic test for combating the pandemic. The total value of the donations is $200,000.

Dr. Dig Bijay Mahat worked closely with Sherlock Biosciences and MoHP to introduce and facilitate the adoption of Sherlock CRISPR SARS-CoV-2 testing kits in Nepal. In addition to his work with the coalition, Dr. Mahat is also a research scientist in the lab of Nobel Laureate Phillip A. Sharp at the Koch Institute for Integrative Cancer Research at MIT.

According to MoHP, the daily COVID-19 positivity rate in Nepal is around 20-25%. Nepals capital, Kathmandu, and surrounding areas account for more than a third of all infections, raising concerns about the ability of hospitals to support the growing need for ventilators and intensive care.

When we established The 221b Foundation, we felt strongly that we needed to support efforts worldwide to confront COVID-19, said Rahul Dhanda, co-founder, president and CEO of Sherlock Biosciences and founding board member of The 221b Foundation. By establishing a strong coalition to support Nepal and its Ministry of Health, we are collectively working to provide a critical testing need to assist a region facing a surging challenge with this pandemic.

The testing will be supervised by MoHP with initial tests validated and run in the National Public Health Laboratory in Kathmandu. Initial efforts will support major cities, and the ramp up to support country-wide testing is expected to occur over the next few months. With infections increasing at alarming rates, a national testing strategy is the foundation of Nepals effort to manage the pandemic.

COVID-19 has become a severe threat to our national public health, and we have established a plan to contain its spread, which is built on a strong testing platform, said Dr. Jageshwor Gautam, the spokesperson for MoHP. Sherlocks CRISPR SARS-CoV-2 kit is ideally suited to address Nepals national diagnostic needs, and it represents one of many critical components in a broader plan that will successfully contain this pandemic.

The coalition members have each committed to addressing the pandemic through testing, tracing, providing equipment or supporting communities most severely affected by the pandemic. The Sherlock CRISPR SARS-CoV-2 kit should provide capacity for a single site to run thousands of tests per day on simple and accessible equipment.

The SHERLOCK diagnostic platform can achieve single molecule detection of nucleic acid targets; its name stands for Specific High Sensitivity Enzymatic Reporter unLOCKing. SHERLOCK utilizes CRISPR activity for smart amplicon detection and can be adapted for use with existing diagnostic instruments, improving time to result due to its significant multiplexing capacity. When a specific sequence of DNA or RNA is present, a CRISPR enzyme is activated and, much like a pair of scissors, starts cutting nearby genetic material, releasing a fluorescent signal that indicates a positive result. In May 2020, Sherlock received Emergency Use Authorization (EUA) from the U.S. Food and Drug Administration (FDA) for its Sherlock CRISPR SARS-CoV-2 kit, the first FDA-authorized use of CRISPR technology.

About The 221b Foundation

The 221b Foundation was founded with the dual mission to assist in the eradication of COVID-19, while supporting racial and gender diversity in STEM. By providing support and intellectual property that enables both non-profit and for-profit entities to develop CRISPR-based diagnostic testing, The 221b Foundation seeks to aid in the fight against the global COVID-19 pandemic while furthering access and diversity in STEM industries. Led by industry experts in the fields of diagnostic testing, STEM and diversity, The 221b Foundation envisions a world where advances in CRISPR technology fuel the innovations that will put an end to the COVID-19 pandemic. For more information, please visit: 221bfoundation.org.

About Sherlock Biosciences

Sherlock Biosciences is dedicated to providing global access to the simplest and most accurate tests that empower individuals to control their own healthcare. Through its Engineering Biology platforms, the company is developing applications of SHERLOCK, a CRISPR-based method for smart amplicon detection, and INSPECTR, a synthetic biology-based molecular diagnostics platform that is instrument-free. SHERLOCK and INSPECTR can be used in virtually any setting without complex instrumentation, opening up a wide range of potential applications in areas including precision oncology, infection identification, food safety, at-home tests and disease detection in the field. In 2020, the company made history with the first FDA-authorized use of CRISPR technology. For more information visit Sherlock.bio.

Continue reading here:
The 221b Foundation Establishes Coalition to Control the Spread of COVID-19 in Nepal - Business Wire

Watch this on-demand webinar to learn more about manipulating the genes within physiologically relevant human immune cells

In this on-demand SelectScience webinar, immunology expert Dr. Verena Brucklacher-Waldert, Horizon Discovery, shares successful strategies for the manipulation of genes within physiologically relevant human immune cells. A number of case studies are presented to highlight the techniques used in a variety of applications employed for gene interrogation, including CRISPRko, RNAi and more.

Read on for highlights from our Q&A session that followed the live webinar with Ryan Donnelly, Senior Product Manager for Gene Editing at Horizon Discovery.

RD: We've spoken to a lot of customers who do what we call orthogonal studies for hit follow-up. Say you run a CRISPR knockout screen, and you get a handful of hits back, you can then see what reagents are available, maybe via traditional RNAi methods, so siRNA or shRNA. You can then run those to see if you can replicate some of the phenotypes that you saw in your knockout screen for those specific hits. The thought is, if you see a positive correlation, you now have stronger evidence that that hit was actually real, since you've now generated a similar phenotype by targeting both DNA, with your CRISPR knockout screen, as well as the RNA with those traditional kinds of RNAi methods.

In essence, you've generated a similar phenotype by targeting two different sections of the central dogma. One of the nice things about Horizon is we have readily available reagents, all genome-wide for both CRISPR knockout, CRISPR activation, siRNA and shRNAs. So, most combinations that you would be looking at for validation, we can support.

RD: There are a few. But the first one that comes to mind is when working with primary immune cells, the availability and variability of the cell type. We can extract those cells from blood samples, but there's usually a limited amount of those types of cells that we can extract from each donor. We then need to keep in mind that there can be specific variability between donors. The complexities that come along with trying to stimulate immune cells, like T cells, also need to be considered.

Another challenge that we usually see is just in the biological differences between immune cell types. We talked a lot about proliferating cell types. Some cell types lose the ability to proliferate once they've been extracted from blood.

Lastly, is a variable that we look at routinely that also comes down to cell type: cells that are in suspension versus adherent cells. This can make screening protocols quite different, depending on whether your cell types are in suspension or if they're stuck down in the bottom of a well. Those are the three main considerations when looking to conduct screening experiments within immune cells.

RD: In principle, we usually suggest a minimum of three donors, but this is all cell type dependent. Functional assays can show a high degree of variability when using cell types such as natural killer cells. But if you shift into myeloid cells, that variability in functional assays is much more limited. Another thing to keep in mind is that donor variability is not necessarily a bad thing. By mixing donors, you spread a wider vision on things like the ethnicity of those donors, sex, age, and genetics that make up the donor pool. Since they're randomized, it will give you good insight into how a variety of donors would respond and can give you higher confidence in the performance characteristics of the target that you've identified within your screen.

RD: Controls, and multiple types of controls, are absolutely critical when doing this type of work. Without them, it's really impossible to check the efficiencies in large, arrayed screens.

At Horizon, we use multiple different types of controls, and for anybody that is taking these projects on, we would recommend a similar approach. For checking the transduction efficiency, we use a combination of both lethal controls and essential genes. This will give us a nice viability readout. In essence, the more cells that die, the higher the rate of transduction efficiency.

We also incorporate non-targeting controls, and a ROSA26 guide RNA. The non-targeting control won't cut the DNA, so incurs no DNA damage. The ROSA26 guide RNA will cut, but it cuts without a functional impact to the cell. This will give us insights into the potential for DNA damage, as well as a cutting efficiency control. Lastly, we would pick a positive control based on the cell type of interest. For example, in T cells, we target CD3, as it's consistently expressed as part of the T cell receptor complex.

By doing this, we have the ability to monitor across donors, across plates, and across replicates, to look at assay performance as a whole, with the screening experiment.

Q: How does pooled screening differ from arrayed screens? And what are the advantages?

RD: The main advantage of performing a pooled screen over an arrayed screen is really the ability to scale up and analyze the whole genome with a reasonably small amount of resources. Mining the whole genome is very important when we're looking to understand new biology without any preconceived ideas. It's really a discovery approach.

Thinking about using a pool versus an arrayed screen comes down to the biological question you're attempting to answer. If it's a simple, black and white question, such as "Do my cells survive a particular stimulus?", a pooled screen is a really nice way to go. If, however, the screen needs to assess multiple different types of outcomes that use different techniques so maybe combining FACS and HTRF assays for looking at more than one parameter, arrayed screens are what you would need to use.

Learn more about modulating gene function in primary immune cells: Watch this webinar on demand here>>

SelectScience runs 10+ webinars a month across various scientific topics, discover more of our upcoming webinars>>

See original here:
Strategies and applications for CRISPRko, RNAi and beyond - SelectScience

Abstract

Hepatitis C virus (HCV) remains a major human pathogen that requires better understanding of virus-host interactions. In this study, we performed a genome-wide CRISPR-Cas9 screening and identified TRIM26, an E3 ligase, as a critical HCV host factor. Deficiency of TRIM26 specifically impairs HCV genome replication. Mechanistic studies showed that TRIM26 interacts with HCV-encoded NS5B protein and mediates its K27-linked ubiquitination at residue K51, and thus promotes the NS5B-NS5A interaction. Moreover, mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection. In conclusion, we identified TRIM26 as a host factor for HCV replication and a new determinant of host tropism. These results shed light on HCV-host interactions and may facilitate the development of an HCV animal model.

Hepatitis C virus (HCV) is an enveloped, single-stranded RNA virus belonging to the family Flaviviridae. The HCV RNA genome is 9.6 kb in length and consists of a single open reading frame (ORF) flanked by highly conserved 5 and 3 untranslated regions (UTRs). The ORF encodes a single polyprotein of over 3000 amino acids, which is cleaved by cellular and viral proteases into structural proteins (core, E1, and E2) and nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B). NS5B, an RNA-dependent RNA polymerase (RdRp), together with other nonstructural proteins NS3, NS4A, NS4B, and NS5A, forms intracellular membraneassociated replication complex and catalyzes viral genomic RNA replication. HCV infects over 71 million people worldwide (1). Among this infected population, about 80% develop persistent infection, leading to severe liver diseases, such as liver cirrhosis and hepatocellular carcinoma (HCC). Recently developed direct-acting antiviral agents (DAAs) targeting viral NS3 protease, NS5A and NS5B polymerases are highly effective in curing patients with HCV. However, global eradication of HCV remains challenging due to lack of an HCV vaccine, potential drug-resistant mutations, severe liver disease progression in DAA-cured patients, and other newly emerging problems (2). Better understanding of viral life cycle and virus-host interactions is still imperative for the prevention and control of HCV infection.

The tripartite motif (TRIM) family that consists of more than 70 members in human plays roles in multiple cellular processes including intracellular signaling, development, apoptosis, protein quality control, innate immunity, autophagy, and carcinogenesis (3). An increasing number of studies have focused on the roles of TRIM family proteins in host responses to virus infection. TRIM5 recognizes retroviral capsids to induce premature core disassembly and inhibits reverse transcription of the viral genome (4, 5). TRIM69 restricts dengue virus (DENV) replication by ubiquitinating viral NS3 (6). TRIM22 and TRIM41 inhibit influenza A virus infection by targeting nucleoprotein for degradation (7, 8). TRIM56 suppresses Zika virus (ZIKV) replication through sequestration of its genomic RNA (9).

As an E3 ligase, TRIM26 contains an N-terminal RING domain, B-box domain, coiled-coil domain, and a C-terminal SPRY domain. One study showed that TRIM26 promotes interferon regulatory factor 3 (IRF3) degradation and thus suppresses interferon- (IFN-) signaling (10), while another showed that TRIM26 promotes the interaction between the kinases TBK1 and NEMO, leading to activation of IFN signaling (11). In this study, we identified TRIM26 as a critical host factor of HCV by genome-wide CRISPR screening. A mechanistic study demonstrated that TRIM26 mediates NS5B ubiquitination and enhances its interaction with NS5A, which is crucial for HCV genome replication. Furthermore, we showed that mouse TRIM26 does not support HCV replication because of its unique sixamino acid insert that prevents its interaction with NS5B, providing new evidence for understanding the genetic basis underlying the exceptionally narrow host tropism of HCV infection. Ectopic expression of human TRIM26 in a mouse hepatoma cell line that has been reconstituted with other essential HCV host factors promotes HCV infection, providing clues for the development of an HCV animal model.

Taking advantage of the NIrD (NS3-4A inducible rtTA-mediated dual-reporter) reporter system to monitor HCV infection in real-time and live-cell fashion (12), we performed a genome-wide CRISPR-Cas9 screening to identify host factors essential for HCV infection (13) (Fig. 1A). Huh7.5 cells harboring the NIrD reporter showed red fluorescence (mCherry) upon cell culture-derived HCV (HCVcc) infection in the presence of doxycycline. The reporter cells transduced with a CRISPR single guide RNA (sgRNA) library targeting human proteincoding genes were infected with HCVcc at multiplicity of infection (MOI) of 0.1, and mCherry-negative cells were enriched by cell sorting. The abundance of each sgRNA in the enriched mCherry-negative cells was measured through deep sequencing and analyzed with the RIGER (RNAi Gene Enrichment Ranking) algorithm (tables S1 and S2). Many host factors were identified from this screening (Fig. 1B). Among the top candidates, CD81, occludin (OCLN), and claudin 1 (CLDN1) are the well-defined HCV entry factors (1416). Peptidylproly isomerase A (PPIA), also known as cyclophilin A (CypA), has been shown critical for HCV replication (17). ELAV-like RNA binding protein 1 (ELAVL1) interacted with HCV 3UTR and enhanced HCV replication (18). These positive results validated our CRISPR screening. Except for these previously described hits, TRIM26 is a top hit from our screening and was also identified in a previous screening (19). To investigate the role of TRIM26 in HCV infection, we silenced TRIM26 expression in Huh7 cells through CRISPR interference (CRISPRi) (20). Two TRIM26 sgRNAs (sg1 and sg2) that efficiently reduced the TRIM26 expression (Fig. 1C), which had no effect on cell viability (Fig. 1D), were selected for the following experiments. TRIM26 knockdown cells were infected with HCVcc at MOI of 0.1, and the intracellular HCV RNA, NS3 protein levels, and extracellular HCV titer were measured at the indicated time points after HCVcc infection. As shown in Fig. 1 (E to G), TRIM26 knockdown reduced the HCV RNA level, NS3 protein expression, and extracellular HCV titer. We further reconstituted wild-type TRIM26 and the RING domaindeleted mutant (TRIM26R) in the TRIM26 knockdown and control cells. The expression of TRIM26 and TRIM26R in these cells was verified by Western blot (fig. S1A). As shown in fig. S1 (B to D), exogenous expression of wild-type TRIM26, but not TRIM26R, restored HCV infection in the TRIM26 knockdown cells.

(A) Schematic of whole-genome scale CRISPR screening. (B) The hits identified in CRISPR screening were shown after RIGER analysis. Top hits in the screening were marked by the gene symbols with different colors. (C) Western blot analysis of TRIM26 expression in three TRIM26 knockdown Huh7 cells. (D) Effect of TRIM26 knockdown on cell viability. (E to G) Control and TRIM26 knockdown Huh7 cells were infected with HCVcc at MOI of 0.1 for the indicated time points, and intracellular HCV RNA (E), extracellular HCV titer (F), and NS3 protein (G) were determined. HCV RNA was expressed as values relative to the actin mRNA level. The error bars represent SDs from two independent experiments. FFU, focus-forming units. One-way ANOVA was used for statistical analysis. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control cells.

To further confirm the role of TRIM26 in HCV infection, we generated Huh7.5.1 TRIM26 knockout cells (fig. S2, A and B). We then infected Huh7.5.1 TRIM26 knockout and control cells with HCVcc at MOI of 0.1. Consistently, TRIM26 knockout reduced the HCV RNA level, NS3 expression, and extracellular HCV titer (fig. S2, C to E). Together, these results demonstrated that TRIM26 plays an important role in HCV infection.

Previous studies showed that TRIM26 is involved in IFN signaling (10, 11). To examine the potential effect of IFN signaling in TRIM26 knockdown cells on HCV infection, Huh7-TRIM26 knockdown and control cells were infected with HCVcc at MOI of 0.1. IFN- and IFN-stimulated gene (ISG) mRNA levels were determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR). As shown in fig. S3, no difference was observed between the TRIM26 knockdown and control cells after HCV infection, suggesting that involvement of TRIM26 in HCV infection is not mediated by its potential action on host IFN signaling.

To investigate in which step of the HCV life cycle TRIM26 is involved, we used HCVE1 that lacks the E1 region in viral genome and only undergoes single-round infection in Huh7 cells (21). Huh7-TRIM26 knockdown and control cells were infected with the HCVE1 virus at MOI of 0.1, and HCV RNA level was determined. As shown in Fig. 2A, TRIM26 knockdown reduced HCVE1 RNA level for about sevenfold at 72 hours after infection, suggesting that TRIM26 may contribute to HCV entry or genome replication. Next, we used the pseudotyped HCV particles (HCVpp) that harbor HCV envelope glycoproteins and serve as a surrogate model for HCV entry (22). Huh7-TRIM26 knockdown cells and control cells were infected with HCVpp. As shown in Fig. 2B, no substantial difference was observed between the TRIM26 knockdown and control cells, suggesting that TRIM26 has no effect on HCV entry. To assess the potential effect of TRIM26 on HCV polyprotein cleavage and translation, the TRIM26 knockdown and control cells were transfected with plasmids expressing nonstructural proteins NS3-5B or an RdRp-deficient HCV genome (JFH1-GND-Rz) that recapitulates internal ribosomal entry site (IRES)dependent viral protein translation and polyprotein cleavage. As shown in fig. S4, TRIM26 knockdown had no effect on HCV polyprotein cleavage and translation. Last, we examined the impact of TRIM26 on HCV genome replication using HCV subgenomic replicon that serves as a surrogate model for viral genome replication (23). The JFH1 subgenomic replicon cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. HCV RNA and NS3 protein levels were analyzed by RT-qPCR and Western blot, respectively. As shown in Fig. 2 (C and D), TRIM26 knockdown reduced both HCV RNA and NS3 protein levels. Together, these results demonstrated that TRIM26 is likely involved in HCV genome replication.

(A) Control and TRIM26 knockdown Huh7 cells were infected with the single-round infectious HCVE1 for the indicated time points. The HCV RNA level was detected by RT-qPCR. (B) Control and TRIM26 knockdown Huh7 cells were infected with HCVpp. The infectivity was quantified by luciferase assay. (C and D) JFH1-SGR cells were transduced with sgEGFP or sgTRIM26 for the indicated time points. HCV RNA (C) and NS3 protein levels (D) were determined by RT-qPCR and Western blot, respectively. The error bars represent SDs from two independent experiments. One-way ANOVA (A and B) and t test (C) were used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as values relative to control.

Next, we determined whether TRIM26 is required for the replication of other HCV genotypes. Con1 (genotype 1b) (23) and PR87 (genotype 3a) (24) subgenomic replicon-harboring cells were transduced with lentiviruses expressing TRIM26-sgRNA or control EGFP-sgRNA. As shown in fig. S5 (A to D), TRIM26 knockdown reduced Con1 and PR87 viral RNA and NS5A protein expression. Furthermore, we showed that TRIM26 knockdown inhibited the infection of PR63cc, another genotype 2a HCVcc strain (fig. S5E) (25). Collectively, these results demonstrated that TRIM26 contributes to replication of HCV from multiple genotypes.

Next, we examined whether TRIM26 functions in infection of other flaviviruses, such as DENV and ZIKV. Huh7-TRIM26 knockdown and control cells were infected with DENV or ZIKV at MOI of 0.1. Intracellular viral RNA (fig. S6, A and D), extracellular viral titer (fig. S6, B and E), and DENV E protein level (fig. S6C) were measured. The results showed that TRIM26 knockdown had no effect on DENV and ZIKV infection.

To elucidate the underlying mechanism by which TRIM26 promotes HCV replication, we determined the interactions of TRIM26 with HCV-encoded proteins. Plasmids expressing TRIM26 and FLAG-tagged HCV proteins were cotransfected into human embryonic kidney (HEK) 293T cells to perform coimmunoprecipitation (co-IP) assays. As shown in fig. S7 (A to H), TRIM26 was coimmunoprecipitated with NS5B, but not with core, E1, E2, NS2, NS3, NS4B, or NS5A. Conversely, NS5B was coimmunoprecipitated with hemagglutinin (HA)tagged TRIM26 (Fig. 3A). We further confirmed the colocalization of NS5B and TRIM26 by confocal microscopy (fig. S7I). To verify the TRIM26-NS5B interaction in the context of HCV infection, Huh7 cells ectopically expressing FLAG-tagged TRIM26 were infected with HCVcc at MOI of 1 for 48 hours, and co-IP assay was performed. Consistently, NS5B, but not NS3, was coimmunoprecipitated with TRIM26 (Fig. 3B). This interaction was also confirmed in JFH1 subgenomic replicon cells (Fig. 3C).

(A) HEK293T cells were transfected with plasmids expressing HA-tagged TRIM26 and FLAG-tagged NS5B. The co-IP assay was performed with an anti-HA antibody. IB, immunoblot; IP: immunoprecipitation. (B) Huh7 cells transfected with FLAG-tagged TRIM26 for 24 hours were infected with HCVcc for another 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (C) JFH1 subgenomic replicon cells were transfected with FLAG-tagged TRIM26 for 48 hours, and the cell lysates were immunoprecipitated with anti-FLAG antibody. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, or TRIM26R together with HA-tagged ubiquitin for 48 hours. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and TRIM26 along with HA-tagged ubiquitin or ubiquitin mutants. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (F) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26 along with HA-tagged ubiquitin. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (G) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and analyzed by indicated antibodies. (H) Control and TRIM26 knockdown Huh7 cells were electroporated with in vitro transcribed JFH1 or JFH1-K51R subgenomic RNA. After G418 selection, the subgenomic replicon cells were harvested for detecting HCV RNA level by RT-qPCR. The error bars represent SDs from two independent experiments. t test was used for statistical analysis. ns, P > 0.05; **P > 0.01. The protein levels were quantified by ImageJ, normalized against TRIM26 input protein level, and expressed as values relative to FLAG IP protein level.

Next, we sought to map the key domains that are indispensable for TRIM26-NS5B interaction. We constructed TRIM26 mutants with a deletion in the N-terminal RING domain (TRIM26R) or the C-terminal SPRY domain (TRIM26SPRY) (fig. S8A), as well as NS5B mutants with a deletion in the N-terminal finger domain (NS5BN), the central palm domain (NS5B188-371), or the C-terminal thumb domain (NS5BC) (fig. S8B). The co-IP assays showed that the SPRY domain of TRIM26 and the C-terminal region of NS5B were required for the interaction (fig. S8, A and B).

As the function of TRIM26 in HCV replication requires its RING domain that is known to be responsible for ubiquitinating its substrates (fig. S1, B to D), we next examined whether TRIM26 mediates NS5B ubiquitination. HEK293T cells were cotransfected with plasmids expressing wild-type or RING-deleted TRIM26, FLAG-tagged NS5B, and HA-tagged ubiquitin, and then, NS5B was immunoprecipitated and its ubiquitination was analyzed by Western blot. As shown in Fig. 3D, wild-type, but not the RING-deleted TRIM26, promoted the ubiquitination of NS5B. Ubiquitin is known to link to substrate protein through its internal lysine residues at position 6, 11, 27, 29, 33, 48, or 63 (26); therefore, we constructed a series of ubiquitin mutants with the lysine (K)toarginine (R) change at each of these positions. We found that ubiquitin with the K27R mutation significantly reduced the TRIM26-mediated NS5B ubiquitination (Fig. 3E), suggesting that K27 is likely the ubiquitin lysine residue linked to NS5B.

Next, we sought to identify critical lysine residues of NS5B targeted by TRIM26. There are 30 lysine residues in NS5B of JFH1. We analyzed the conservation for these individual lysine residues among different HCV genotypes and their positions in the three-dimensional structure of NS5B (Protein Data Bank ID: 2XYM) (fig. S9A) (27). Given that TRIM26 is involved in the replication of HCV genotypes 1, 2, and 3, we selected 11 lysine residues that are highly conserved among the three genotypes (conservation, >90%) and located on the surface of NS5B structure (highlighted red in fig. S9A). As shown in Fig. 3F and fig. S9C, the K51R mutation in NS5B significantly reduced TRIM26-mediated NS5B ubiquitination, suggesting that TRIM26 promotes K27-linked ubiquitination of NS5B at the residue of K51.

Next, we investigated whether the K51R mutation in NS5B affects its interaction with TRIM26. Plasmids expressing TRIM26 and either wild-type or K51R-mutated NS5B were cotransfected into HEK293T cells to perform a co-IP experiment. As shown in Fig. 3G, the K51R mutation did not impair the interaction between NS5B and TRIM26.

Last, we assessed the effect of K51R mutation on HCV replication. The wild-type or NS5B-K51R mutant JFH1 subgenomic replicon was established in wild-type and TRIM26 knockdown Huh7 cells. As shown in Fig. 3H, NS5B K51R mutation reduced HCV replication in wild-type cells but not in the TRIM26 knockdown cells. Together, these results demonstrated that the TRIM26-mediated ubiquitination of NS5B at the K51 residue is critical for HCV replication.

To investigate how TRIM26-mediated NS5B ubiquitination enhances HCV replication, we examined the interaction of NS5B with other nonstructural proteins involved in the viral replication complex. Huh7-TRIM26 knockdown and control cells were transfected with the plasmid expressing the NS3-5B polyprotein. As shown in Fig. 4A, TRIM26 knockdown reduced the interaction between NS5B and NS5A but had little effect on the interaction between NS5B and NS3. Consistently, TRIM26 overexpression specifically enhanced the interaction between NS5B and NS5A (Fig. 4, B and C).

(A) Control and TRIM26- knockdown Huh7 cells were transfected with plasmids expressing NS3-5B-3 FLAG. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (B and C) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B, TRIM26, and NS3 (B) or NS5A (C). The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (D) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B and NS5A together with TRIM26 or TRIM26R. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (E) HEK293T cells were transfected with plasmids expressing FLAG-tagged NS5B or NS5B K51R and NS5A together with TRIM26. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The NS3 and NS5A protein levels were quantified by ImageJ, normalized against their input protein levels, respectively, and expressed as values relative to FLAG IP protein levels.

To assess whether TRIM26-mediated NS5B ubiquitination affects NS5B-NS5A interaction, FLAG-tagged NS5B, NS5A, and TRIM26 or TRIM26R expression plasmids were cotransfected into HEK293T cells to perform a co-IP assay. As shown in Fig. 4D, deletion of RING domain in TRIM26 reduced the interaction of NS5B and NS5A. To further confirm it, HEK293T cells were cotransfected with plasmids expressing wild-type or K51R-mutated NS5B, together with NS5A and TRIM26. As shown in Fig. 4E, NS5B K51R mutation reduced the NS5B-NS5A interaction. Together, these results demonstrated that TRIM26 mediates ubiquitination of NS5B and promotes its interaction with NS5A.

TRIM26 is expressed in a wide range of animals and highly conserved among different species (fig. S10 and Fig. 5A). Next, we determined whether TRIM26 from different species supports HCV replication. We cloned TRIM26 from mouse that does not efficiently support HCV replication and from tupaia (tree shrew) that has been reported to moderately support HCV replication (28). Human, mouse, and tupaia TRIM26, designated hTRIM26, mTRIM26, and tTRIM26, respectively, were stably expressed in control and TRIM26 knockdown Huh7 cells (Fig. 5B). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (C and D), ectopic expression of hTRIM26 and tTRIM26 in the TRIM26 knockdown cells restored HCV replication, whereas ectopic expression of mTRIM26 did not restore HCV replication in the TRIM26 knockdown cells or exert a dominant-negative effect on HCV infection in Huh7 cells.

(A) Alignment of TRIM26 protein of different species. (B) Western blot analysis of reconstituted TRIM26 of different species in control and Huh7-TRIM26 knockdown cells. (C and D) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV NS3 protein expression (C) and RNA level (D) were analyzed at 48 hours after infection. (E) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. (F) Western blot analysis of reconstituted mTRIM26-del expression in control cells and Huh7-TRIM26 knockdown cells. (G and H) The reconstituted TRIM26 cells were infected with HCVcc at MOI of 0.1 for the indicated time points. HCV RNA level (G) and NS3 protein expression (H) at 48 hours after infection were analyzed. (I) Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, or mTRIM26-del were transfected with plasmids expressing FLAG-tagged NS5B. The cell lysates were immunoprecipitated with anti-FLAG antibody and then immunoblotted by indicated antibodies. The error bars represent SDs from two independent experiments. One-way ANOVA was used for statistical analysis. ns, P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. The protein levels were quantified by ImageJ, normalized against internal actin, and expressed as relative to control (C and H) or normalized against TRIM26 input protein level and expressed as values relative to immunoprecipitated FLAG-tagged protein level (E and I).

Next, we performed a co-IP assay to determine the interaction of NS5B and TRIM26 of different species. Huh7-TRIM26 knockdown cells reconstituted with hTRIM26, mTRIM26, and tTRIM26 were transfected with FLAG-tagged NS5B. As shown in Fig. 5E, NS5B interacted with hTRIM26 and tTRIM26, while it had very weak interaction with mTRIM26. The amino acid sequence alignment showed that there is a unique insert of six amino acids in mTRIM26 (located at 257262) but not in TRIM26 of human, chimpanzees, rhesus monkey, or tupaia (Fig. 5A and fig. S10). To determine whether this sixamino acid insert within mTRIM26 influences its function in HCV infection, we deleted it in mTRIM26 (designated mTRIM26-del) and stably expressed it in control and TRIM26 knockdown Huh7 cells (Fig. 5F). The resulting cells were infected with HCVcc at MOI of 0.1, and HCV RNA level and NS3 protein expression at 48 hours after infection were measured. As shown in Fig. 5 (G to H), in contrast to the full-length mTRIM26, mTRIM26-del reconstitution in TRIM26 knockdown cells partially restored HCV replication. Consistently, mTRIM26-del acquired the ability to interact with NS5B (Fig. 5I). Collectively, these results demonstrated that TRIM26 not only plays a role in HCV replication but also contributes to viral host tropism.

Last, we examined whether human TRIM26 can enhance HCV replication in murine hepatocytes that normally do not support HCV infection. For this purpose, we used a previously reported murine hepatoma cell line Hep561D7A7 that had been reconstituted with CD81, SRBI, CLDN1, OCLN, SEC14L2, and miR122, which are host factors essential for HCV infection (29). Hep561D7A7 and its parental control Hep561D cells were first transfected with hTRIM26 or mTRIM26 for 24 hours and then infected with Gluc-labeled HCVcc (JC1-Gluc) that can secret Gluc into culture supernatants upon infection. The expression of hTRIM26 and mTRIM26 was verified by Western blot (Fig. 6A). The culture supernatants at days 0, 1, 2, 3 after infection were harvested for the luciferase assay. As shown in Fig. 6B, hTRIM26 expression enhanced about eightfold HCV infection in Hep561D7A7 cells but not in Hep561D cells, while mTRIM26 had no effect in the both cells. To confirm this, we established Hep561D7A7 cells that stably express hTRIM26 by lentiviral transduction (designated Hep561D7A7-hTRIM26). The expression of hTRIM26 was identified by Western blot (Fig. 6C). Next, Hep561D7A7 and Hep561D7A7-hTRIM26 cells were infected with HCV and then analyzed by NS5A immunofluorescence staining. As shown in Fig. 6D, although the infection in the both cells was not very efficient, there were more HCV-positive cells in Hep561D7A7-hTRIM26 cells. Consistently, flow cytometry analysis showed that HCV infection was more efficient in hTRIM26-transduced Hep561D7A7 cells, and this increased HCV infection was more evident in the hTRIM26high expressing Hep561D7A7 cells (Fig. 6E). Together, these data suggested that hTRIM26 reconstitution enhances HCV infection in murine hepatocytes.

(A) Western blot analysis of hTRIM26 and mTRIM26 expression in Hep561D and Hep561D7A7 cells. (B) Hep561D and Hep561D7A7 cells transfected with hTRIM26 or mTRIM26 as well as Huh7 cells were infected with JC1-Gluc for the indicated time points. The culture supernatants were harvested for the luciferase assay. The error bars represent SDs from two independent experiments. RLU, relative light units. (C) Western blot analysis of hTRIM26 expression in Hep561D7A7 and Hep561D7A7-hTRIM26 cells. (D) Parental and hTRIM26-transuced Hep561D7A7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody (red) for immunofluorescence microscopy. ZsGreen coexpressed in the same lentiviral vector with hTRIM26 was labeled green. The error bars represent SDs from the number of NS5A-positive cells in three wells from one representative experiment. t test was used for statistical analysis. ns, P > 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. (E) Parental, hTRIM26-transuced Hep561D7A7 cells, or Huh7 cells were infected with HCVcc for 72 hours and then stained with anti-NS5A antibody for flow cytometry analysis of HCV-positive cells. Meanwhile, ZsGreen-positive hTRIM26-transuced Hep561D7A7 cells (2.8% of total) were also analyzed.

Host factors participate in each step of the HCV life cycle. In this study, we performed a genome-wide CRISPR-Cas9 screen to uncover host factors crucial for HCV replication. A variety of host factors were identified from this screen, including the well-defined HCV entry factors CD81, OCLN, and CLDN1 (1416). PPIA has been shown to be critical for HCV replication and as a druggable target for HCV (17). ELAVL1 binds the 3 ends of the HCV RNAs and protects viral RNAs from degradation (18). The aforementioned candidates were also identified from a previous CRISPR-based screen, which was also performed in a hepatoma cell line (19). Besides, CSNK1A1 is responsible for NS5A hyperphosphorylation and crucial for viral production (30). DNA methyltransferase 1 (DNMT1), a key factor involved in establishing and maintaining DNA methylation, is also required for HCV propagation (31). Collectively, our CRISPR screening results are highly consistent with previous findings.

We found that TRIM26 is a critical host factor for efficient HCV replication. This conclusion is supported by multiple lines of evidence. First, deficiency of TRIM26 reduces replication of HCV from multiple genotypes (Fig. 2 and fig. S5). Second, TRIM26 specifically interacts with viral polymerase NS5B (Fig. 3 and fig. S7). Third, TRIM26 promotes K27-linked ubiquitination of NS5B at residue K51, which enhances its binding to NS5A, a critical interaction for assembly of viral replication complex (Figs. 3 and 4). The role of TRIM26 in HCV replication seems virus specific, as it is not involved in the life cycle of other closely related flaviviruses such as DENV and ZIKV (fig. S6). It is important to point out that TRIM26 knockout greatly diminishes HCV replication but does not completely abolish it. This implies that a possible redundant host function may compensate the TRIM26 deficiency.

Previous studies showed that TRIM26 plays a role in the regulation of antiviral IFN response (10, 11). Our results showed that neither IFNs nor ISGs were induced significantly in HCV-infected Huh7 cells (fig. S3). This observation was consistent with many previous studies demonstrating that HCV has multiple strategies to antagonize host innate immune responses (3234). There was no difference in the levels of IFNs or ISGs between the TRIM26 knockdown and control cells upon HCV infection, which further rules out the possibility that TRIM26 contributes to HCV replication via regulation of IFN signaling. In addition, TRIM26 was reported to function as a tumor suppressor of HCC, as TRIM26 knockdown promotes cell proliferation and metastasis (35). We found that TRIM26 knockdown had no effect on the cell viability of Huh7, a human HCC cell line (Fig. 1D).

Together with host factors, HCV nonstructural proteins form a membrane-associated replication complex, which is required for HCV genome replication. In this study, we found that TRIM26 binds NS5B, which requires both the SPRY domain of TRIM26 and the C-terminal region of NS5B (fig. S8). TRIM26-mediated ubiquitination of NS5B at residue K51 enhances the interaction between NS5B and NS5A and, in turn, enhances HCV genome replication (Figs. 3 and 4). As shown in fig. S9A, K51 is highly conserved among all HCV genotypes. In addition, we found K51 is 99.8% conserved among 2045 HCV sequences in the ViPR-HCV database, highlighting a critical role of this residue in the biological function of NS5B. NS5B functions as an RdRp, which that contains finger, palm, and thumb subdomains (3638). While the C-terminal thumb domain is required for the NS5B-TRIM26 interaction, residue K51 is located at the base of a finger loop, which is not essential for the interaction. However, there is an extensive interaction between the finger and thumb subdomains, leading to an encircled catalytic active site located in the central palm subdomain (3638). Therefore, we speculate that the finger and thumb interaction also serves as a platform for TRIM26-mediated ubiquitination of NS5B at residue K51. A cocrystal structure of NS5B and uridine 5-triphosphate (UTP) showed that K51 is adjacent to the triphosphate moiety of UTP and makes an electrostatic interaction with UTP (39). In addition, NS5B K51 has been shown to be a contacting residue with nascent RNA during RNA synthesis (40). Our result demonstrated that ubiquitination of NS5B at residue K51 is required for its interaction with NS5A (Fig. 4E). Future studies will be needed to investigate whether the NS5B K51 ubiquitination affects its contact with RNA substrates.

Humans are the sole known natural host for HCV infection. Although chimpanzees can be experimentally infected by HCV, it has become ethically difficult to use it as an in vivo model to study the virus and evaluate HCV vaccine candidates. In recent years, much progress has been made to develop small-animal models supporting HCV infection. Tupaia (also called tree shrew), a nonrodent small mammal, moderately supports HCV infection. However, its application for HCV animal model has been impeded by its outbred genetic background. Mice are excellent animal model for its inbred genetic background and related research tools but are not naturally permissive for HCV infection because of lack of critical HCV host factors (41). Reconstitution of human HCV entry factors in mice renders limited HCV infection (16, 42), raising a possibility that mice may still lack other HCV host factors. In our study, we found that human and tupaia TRIM26 are capable of supporting HCV replication, while mouse TRIM26 is not (Fig. 5B). Consistently, NS5B interacts with human and tupaia TRIM26, but not with mouse TRIM26 that contains a mouse specific sixamino acid insert. Deletion of this insert restores at least partially the ability of mouse TRIM26 to bind NS5B and to support HCV replication (Fig. 5, G and H). Although this sixamino acid insert (257262) is not located within the SPRY domain (294539) of TRIM26 that is required for its interaction with NS5B, its relative close proximity to the SPRY domain suggests that this extra insert may interfere with access of NS5B to the binding site of TRIM26. A more detailed structural analysis of the NS5B-TRIM26 complex is needed.

Expression of hTRIM26 can further boost HCV infection in Hep561D7A7 cells that have already been reconstituted with six critical human factors for HCV entry and replication (Fig. 6). This raises a possibility that introduction of hTRIM26 into a previously developed transgenic mouse model that expresses human HCV entry factors CD81, SR-B1, CLDN1, and OCLN (42) may further increase its permissiveness to HCV infection, an important step to develop a fully permissive small-animal model for HCV infection.

This study aimed to identify host factors essential for HCV infection by genome-wide CRISPR-Cas9 screening. Among the top candidates, TRIM26 was identified as a novel host factor for HCV infection. We then analyzed at which step of the HCV life cycle TRIM26 is involved and deciphered the underlying mechanism by which TRIM26 promotes HCV replication. Last, we compared the role of TRIM26 from different species in HCV infection and explored its potential roles in contribution to host tropism.

HEK293T and Huh7 cells were obtained from the Cell Bank of Shanghai Institute of Biological Sciences, Chinese Academy of Sciences. Huh7.5.1 cells were obtained from F. Chisari at Scripps Research Institute. Hep561D and Hep561D7A7 cells were obtained from A. Ploss at Princeton University. The cells were maintained in complete Dulbeccos modified Eagles medium (DMEM) (Invitrogen) supplemented with 10% fetal bovine serum, 10 mM Hepes, 2 mM l-glutamine, 100 U of penicillin/ml, and 100 mg of streptomycin/ml. All cells were cultured in humidified air containing 5% CO2 at 37C.

The coding sequences of human, mouse, and tupaia TRIM26 were amplified by PCR/RT-PCR from an hTRIM26-containing plasmid (provided by J. Han at Xiamen University), murine L929 cells, and tupaia liver tissue, respectively, using the following primers: hTRIM26 (forward: CGAAAATATCGAACGCCTCAAGGTGGACAAGGGCAGGC; reverse: GAGGCGTTCGATATTTTCGACCAGGCTGGCCAGTTGC), mTRIM26 (forward: GCGCTCGAGATGGCAGTGTCAGCCCCCTTGAGGAG; reverse: GCGTCTAGATCAGGGTCTCAGCAGAAGGCGTGCTC), and tTRIM26 (forward: GCGCTCGAGATGGCCACGTCAGCCCCTCTGCG; reverse: GCGTCTAGATCAGGGTCTCAGCAGGAGGCGTG). The amplified PCR products were cloned into pLVX-IRES-Puro vector or pLVX-IRES-zsGreen vector (Fig. 6, C to E). The plasmids expressing core, NS2, NS3, NS4B, NS5A, and NS5B contain a FLAG tag at the N terminus. The E1- and E2-expressing plasmids contain a signal peptide at the N terminus and a FLAG tag at the C terminus. The mutant TRIM26 and NS5B plasmids were made by homologous recombination using a Gibson assembly cloning kit [New England Biolabs (NEB), USA]. All the constructs were verified by DNA sequencing.

The amino acids of NS5B of different HCV genotypes were downloaded from the HCV database site map, and the number of the sequences from each genotype is listed in fig. S9. The conservation and location of NS5B lysine residues among different HCV genotypes were analyzed by Vector NTI and PyMOL, respectively.

The human whole-genome sgRNA library that consists of approximately 180,000 sgRNAs that target 19,271 genes was designed. sgRNA oligos were synthesized (CustomArray), and the sgRNA-coding DNA fragments were amplified with PCR from the synthesized oligos with primers flanking the sgRNA target sequences. The amplified sgRNA-coding DNA fragments were purified (DNA Clean & Concentrator TM-5 Kit, Zymo Research) and ligated into the lentiviral vector expressing green fluorescent protein (GFP) by Golden Gate Assembly. The plasmids were transformed into trans1-T1 competent cells. The plasmid library was packaged into pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and VSV-G (glycoprotein of vesicular stomatitis virus) plasmids. Huh7.5-NIrD, a reporter cell line described in (12), was transduced with lentiviral vectors at MOI of 0.3, and GFP-expressing cells were enriched by fluorescence-activated cell sorting (FACS) (BD FACSAria III), which were ready for the following screening experiments after cell culture for 2 weeks.

The cell library was equally divided into two parts: the reference and experimental groups. The genomic DNA from the reference group was extracted, and the sgRNA-coding sequences integrated into chromosomes were amplified by PCR, followed by next-generation sequencing (Illumina HiSeq 2500). The cells of the experimental group were infected with HCVcc at MOI of 0.1 for 30 days, during which most cells died due to HCV replication. After that, mCherry-negative cells were enriched again by FACS in the presence of doxycycline (1 g/ml). The sgRNA sequences from the mCherry-negative cells were decoded by deep sequencing. Comparison of sgRNA abundance between the experimental group and the reference group was analyzed by the RIGER algorithm. The low count reads (less than 10) were filtered out.

The following three sgRNA sequences were used for the TRIM26 knockdown via CRISPRi (43) (sg1: GCGGCACCCCTCCTCTCTCA; sg2: GGAATAGCCGGGAGATTACG; sg3: GCTCGTGCAGGAGCGGGACC). The sgRNA targeting AAVS1 transcription start site (TSS) region was used as control (AAVS1 sg: CGGAACCTGAAGGAGGCGGC). The sgRNAs were cloned into a lentiviral vector expressing GFP and later packaged into VSV-G pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and pVSV-G plasmids into HEK293T cells. Meanwhile, the KRAB-dCas9-P2A-mCherry (Addgene, #60954) vector was also packaged by cotransfection with pCMVR8.74 and pVSV-G plasmids. Huh7 cells were then transduced with both pseudotyped lentiviral vectors that express sgRNA and KRAB-dCas9-P2A-mCherry. Three days after transduction, the GFP and mCherry double-positive cells were sorted by FACS and further cultured. The knockdown efficiency of TRIM26 was measured by Western blot.

Oligonucleotides (TRIM26 oligo F: ACCGTGTGGCAACTGGCCAGCCTGG and TRIM26 oligo R: AAACCCAGGCTGGCCAGTTGCCACA) of TRIM26 sgRNA were synthesized (Ruibiotech) and annealed in 50 l of TransTaq HiFi Buffer II at a final concentration of 9 M. The annealed oligos were ligated into a lentiviral vector bearing a puromycin selection marker with Golden Gate Assembly (NEB). The ligation products were then transformed into Trans1-T1 competent cells (Transgen, CD501). Pseudotyped lentiviral vectors expressing sgRNA were generated by cotransfection of a vector expressing the VSV-G, pCMVR8.74 (containing lentiviral gal/pol), and the lentiviral vector expressing sgRNAs. Huh7.5.1 cells were transduced with the pseudotyped lentiviral vectors expressing sgRNA and selected with puromycin (1 g/ml). The single-cell clones resistant to puromycin were selected. Genomic DNA were extracted from the single-cell clones, and the insertions and deletions (indels) caused by sgRNA/Cas9 in each cell clone were confirmed by Sanger sequencing after PCR amplification.

The protocols and sequences of primers for quantifying HCV RNA, human IFN-, MxA, ISG56, and actin were described previously (34). The cells were lysed in TRIzol (Tiangen), and RNA was isolated according to the manufacturers protocol. The cDNA was synthesized using the ReverTra Ace qPCR RT kit (Toyobo). RT-qPCR was performed using quantitative PCR SYBR green RT-PCR master mix (Toyobo). The sequences of the primers targeting DENV and ZIKV were as follows: ZIKV, CAACTACTGCAAGTGGAAGGGT (forward) and AAGTGGTCCATATGATCGGTTGA (reverse); DENV, ACAAGTCGAACAA CCTGGTCCAT (forward) and GCCGCACCATTGGTCTTCTC (reverse). The expression of target genes was normalized to actin.

The JC1-GLuc virus was constructed as previously described (44). The GLuc gene and an autocleaving peptide 2A were inserted between p7 and NS2 of the JC1 cDNA clone. HCVcc, ZIKV, and DENV preparation and titration were as previously described. Briefly, 1 105 Vero cells were seeded in a 24-well plate for 24 hours, then washed with phosphate-buffered saline (PBS), and infected with the serially diluted ZIKV for 1 hour. Viral inoculations were replaced with 1.2 ml of DMEM containing 1.5% fetal bovine serum and 1% carboxymethyl cellulose sodium salt. Viral plaques were developed at day 4 after infection. Huh7.5.1 (1 104) cells were seeded in a 96-well plate and infected with serially diluted DENV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against DENV envelope protein (clone D1-4G2-4-15; Millipore) followed by incubation with Alexa Fluor 488conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HCVpp were generated as previously described (22). HEK293T cells were cotransfected with plasmids expressing HCV envelope glycoproteins, retroviral core packaging component, and luciferase. Supernatants were collected 72 hours later and filtered through 0.45-M pore size membranes. For infection, targeted cells were seeded in 96-well plates and infected with HCVpp. At 72 hours after infection, the firefly luciferase activity was measured by luciferase assay according to the manufacturers instructions (Promega).

HEK293T cells were cotransfected with indicated plasmids and lysed in NP-40 buffer containing 50 mM tris-HCl (pH 7.5), 150 mM NaCl, and 0.5% NP-40, with protease inhibitor (Sigma-Aldrich) at 48 hours after transfection. The cell lysates were centrifuged at 10,000g at 4C for 10 min, and supernatants were transferred to new tubes and incubated with normal immunoglobulin G (Santa Cruz Biotechnology) as well as protein A/G agarose beads at 4C for 30 min to eliminate nonspecific binding proteins. After centrifugation at 1000g at 4C for 5 min to remove the protein A/G agarose beads, the supernatants were incubated overnight with specific primary antibody at 4C and then with protein A/G agarose beads for an additional 2 hours. The samples were collected by centrifugation at 1000 g at 4C for 5 min, washed with NP-40 buffer for four times, and then resuspended in 40 l of loading buffer for Western blot.

The protocol was as described previously (34). The following antibodies were used: anti-FLAG (Sigma-Aldrich); anti-HA and anti-actin (Abmart); anti-TRIM26 antibody, goatanti-mouse horseradish peroxidase (HRP) antibody, and goatanti-rabbit HRP antibody (Santa Cruz Biotechnology); monoclonal antibodies against HCV NS3 and NS5A (generated by J. Zhongs laboratory); and anti-DENV E protein (D1-11, Abcam).

The protocol was as described previously (45). A BioLux Gaussia luciferase assay kit (NEB) was used to measure the GLuc activity.

Hep561D7A7 cells (1 104) were seeded in a 96-well plate and infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody and Hoechst 33258. The stained cells were analyzed by fluorescence microscopy.

HEK293T cells transfected with the indicated plasmids were seeded on 14-mm-diameter glass coverslips for 48 hours. The cells were washed with PBS and fixed with paraformaldehyde for 1 hour. Then, the cells were incubated with the primary antibody for 1 hour followed by incubation with the secondary antibody conjugated with Alexa Fluor 488 (Invitrogen) or Alexa Fluor 555 (Invitrogen). Images were acquired with an Olympus FV1200 laser scanning confocal microscope (Olympus, Tokyo, Japan) and analyzed using ImageJ software. Pearsons coefficiency functioned as the indicator of colocalization.

Huh7 and Huh7-TRIM26 knockdown cells were seeded in a 96-well plate for 72 hours. Then, luminescent signal was acquired for cell viability analysis using the CellTiter-Glo 2.0 assay.

Hep561D7A7, Hep561D7A7-hTRIM26, and Huh7 cells were infected with HCV for 72 hours. The cells were fixed with 4% paraformaldehyde and incubated with permeabilization buffer. Next, the cells were incubated with a monoclonal antibody against HCV NS5A followed by incubation with Alexa Fluor 555conjugated secondary antibody. The cells were analyzed by flow cytometry. For each staining, at least 5000 events were collected for analysis. The FlowJo software was used for HCV-positive cell analysis.

Statistical analysis was performed using GraphPad Prism 8 software. Students t test was used for analyzing the difference between two groups, and one-way analysis of variance (ANOVA) followed by Tukey post hoc test was used for analyzing the differences among groups of more than three. Not significant (ns), P > 0.05; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001.

Acknowledgments: Funding: This study was supported by the grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB29010205, to J.Z.); the National Natural Science Foundation of China (31670172, to J.Z.; 31930016, to W.W.; 31670169, to Z.Z.; and 31770189, to Y.T.); the support from Beijing Municipal Science and Technology Commission (Z181100001318009), the Beijing Advanced Innovation Center for Genomics at Peking University, and the Peking-Tsinghua Center for Life Sciences to W.W.; the West Light Foundation of the Chinese Academy of Sciences (xbzg-zdsys-201909) to J.Z.; and the Natural Science Foundation of Guangdong Province (2019A1515110668) to G.Z. Author contributions: J.Z., W.W., and G.Z. conceived and designed the study. Y.L., G.Z., and Q.L. designed, performed, and analyzed the experiments. L.H. and Y.X. contributed to the DENV and ZIKV infection experiments. Y.G. and G.Z. performed the bioinformatics analysis. X.H., X.Z., and Q.D. contributed to the establishment of murine hepatoma cells. W.T., M.G., T.G., Y.T., and Z.Z. participated in data analysis. Y.L. and G.Z. drafted the manuscript. All authors contributed to and revised the final version of the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the original post:
TRIM26 is a critical host factor for HCV replication and contributes to host tropism - Science Advances

It goes without saying that 2020 was a challenging year for the food industry. A worldwide pandemic that wreaked havoc on food supply chains, forced the permanent closure of thousands of restaurants worldwide, and pushed millions of people deeper into food insecurity showed us just how fragile the systems that keep us nourished and fed are.

But its also the recognition of this fragility thats led to an increasing sense of urgency to invest in the future of food. The good news is the timing couldnt be better. We are at a culmination point in the fields of bioengineering, chemistry and food science where decades of hard work and progress have allowed ideas that once seemed the domain of science fiction to leap into the labs and, now and in the not-to-distant future, onto our plates.

And while 2020 was a year of unprecedented progress across our food system, I expect 2021 to be even more impactful. Below are four predictions for some of what we could see this year.

Cultured Meat Milestones Will Accelerate

Throughout 2020, announcements of milestones for cultured meat flowed with increasing regularity. New prototypes of practically every type of meat ranging from chicken to beef to kangaroo debuted, heads of state and other famous folks got their first tastes of lab-grown meat, and at the end Eat Just announced the first regulatory approval and retail sale of cultured chicken in Singapore.

And well see even more milestones this year. Investment will grow and excitement will build as more companies move out of the labs and into early pilot production facilities for their cultured meat products. Other countries will follow Singapores lead and give regulatory green light for the sale of cultured meat. And finally, well see the debut of more cultured meat products in high-end cuisine as chefs look to achieve similar firsts for their restaurants. We may even see the rollout of cultured meat in some select experiential, high-end retail.

Fermentation Powers Growth in Exciting New Consumer-Facing Products

One of the of most exciting areas in the future of food is microbial fermentation. High-volume production of interesting new biomass proteins such as mycelium-based meat replacements and the arrival of animal-free proteins, fats and other compounds created using precision fermentation helped illustrate why the Good Food Institute called fermentation the third leg of the alternative protein market.

Looking forward, you can expect lots of new products to debut powered by precision fermentation in 2021. MeliBio, a maker of bee-free honey, expects to debut their first product in 2021, while Clara Foods plans to release its animal-free egg this year as well, and I expect to see more companies like Brave Robot rise up and offer new products built around precision fermented food platforms created by companies like Perfect Day.

CRISPR and Gene-Edited Food See Accelerated Product Pipelines

There was big news in the CRISPR and gene-edited food realm in December when the USDA proposed a change in the regulatory oversight of gene-edited animals for human consumption. The organization proposed that they take over oversight responsibility for approving gene-edited animal products from the FDA which, in 2018, famously declared that gene-edited animals should be regulated in the same manner as drugs.

Under a new USDA regulatory framework, the organization is proposing a fairly light regulatory approach to animals compared to the previous oversight of the FDA, which in turn could speed up time to market for new products. While there has been lots of focus on CRISPR-derived future food innovation, I expect changes to US regulatory oversight of gene-edited animal products to create a wave of new interest in developing CRISPR-based product lines from both startups and established food product companies.

Finally, the US may not be the only market to see a change in oversight for gene-edited food. The UK is looking to extract itself from the heavier-handed oversight of the EU post-Brexit, and some in Europe are suggesting that the EUs classification of all gene-edited food as GMO might be overbroad and need adjusting.

3D Food Printing Moves Beyond the Cake

While 3D food printing has largely been relegated to the world of confections and cake decorating, a world with food replicators from the pages of science fiction novels seems to be inching closer to reality.

Companies like Redefine Meat are making high-volume plant-based meat printers and plan to have meat in supermarkets in a year, while others like Meat-Tech are showing off prototypes of cultured meat printers. One of the challenges for food printing will be scaling the technology to make it quicker, something Novameat is working on as it begins to enter commercial rollout phase of its plant-based meat printing technology. On the consumer front, while I dont expect the food printers to start printing out Jamie Oliver recipes this year, companies like Savoreat are working on commercializing products for the professional space with the end-goal of eventually creating a home consumer food printer like the one you might see in a show like Upload.

Finally, these advances and technologies do not happen in a vacuum. The future of food is reliant on a multitude of new innovations and technologies. CRISPR, precision fermentation and 3D food printing are just some of the tools being interwoven and utilized together to help bring innovative new products to cultured, plant-based and other emerging food markets.

While we dont know what 2021 will hold for us with any certainty, what we can be certain of is that progress in these important building blocks for the future of food will continue to march forward.

Related

Read more:
Four Predictions for the Future of Food in 2021 - The Spoon

What happened

CRISPR gene-editing stocks are being hit hard by a broader biotech sell-off on Tuesday. Shares of CRISPR Therapeutics (NASDAQ:CRSP) were down 9.1% as of 12:05 p.m. EST. Editas Medicine (NASDAQ:EDIT) stock had declined 13.7%, while Intellia Therapeutics (NASDAQ:NTLA) shares had slumped 11.4%.

There wasn't a clear reason behind today's rout of biotech stocks. The biggest negative story in the biopharmaceutical industry centered on Arcturus Therapeutics' disappointing early-stage results for its single-dose COVID-19 vaccine candidate.

Image source: Getty Images.

CRISPR Therapeutics, Editas, and Intellia tend to be more volatile than most stocks. None of the companies have products on the market yet. Their valuations are based solely on investors' optimism about their future prospects. When that optimism wanes, the stocks sink.

It's important to keep in mind, though, that nothing has actually changed about the prospects for any of these three gene-editing biotechs. In many ways, those prospects are as strong as they've ever been.

CRISPR Therapeutics and its big partner, Vertex Pharmaceuticals, reported encouraging new data earlier this month for experimental gene-editing therapy CTX001 in treating rare genetic blood disorders beta-thalassemia and sickle cell disease. Editas also announced positive preclinical data for its candidate targeting the same diseases a few weeks ago and filed for U.S. regulatory clearance to begin a phase 1 clinical study in treating sickle cell disease. Intellia presented promising preclinical data in early December for its experimental gene-editing therapies targeting acute myeloid leukemia (AML) and rare genetic disease alpha-1 antitrypsin deficiency.

Each of these stocks is falling today based on no news directly related to their businesses or pipelines. That creates a buying opportunity for investors who remain confident about each company's direction.

What really matters for these three biotechs is the clinical progress for their respective pipeline candidates. And key developments are on the way for all three companies.

CRISPR Therapeutics expects to report additional data from early-stage studies of immuno-oncology candidates CTX110, CTX120, and CTX130 in 2021. Editas hopes to begin a phase 1 study evaluating EDIT-301 in treating sickle cell disease and continue patient enrollment in a phase 1 study of EDIT-101 in treating eye disease Leber congenital amaurosis type 10 (LCA10) in the new year. Intellia anticipates submitting for regulatory clearance to begin early-stage studies of NTLA-5001 in treating AML and for NTLA-2002 in treating hereditary angioedema next year.

View original post here:
Why CRISPR Therapeutics, Editas Medicine, and Intellia Therapeutics Stocks Are Sinking Today - The Motley Fool

The 65 rating InvestorsObserver gives to Crispr Therapeutics AG (CRSP) stock puts it near the top of the Biotechnology industry. In addition to scoring higher than 80 percent of stocks in the Biotechnology industry, CRSPs 65 overall rating means the stock scores better than 65 percent of all stocks.

Searching for the best stocks to invest in can be difficult. There are thousands of options and it can be confusing on what actually constitutes a great value. Investors Observer allows you to choose from eight unique metrics to view the top industries and the best performing stocks in that industry. A score of 65 would rank higher than 65 percent of all stocks.

This ranking system incorporates numerous factors used by analysts to compare stocks in greater detail. This allows you to find the best stocks available in any industry with relative ease. These percentile-ranked scores using both fundamental and technical analysis give investors an easy way to view the attractiveness of specific stocks. Stocks with the highest scores have the best evaluations by analysts working on Wall Street.

Crispr Therapeutics AG (CRSP) stock is down -4.15% while the S&P 500 is higher by 0.12% as of 10:57 AM on Tuesday, Dec 29. CRSP is down -$7.01 from the previous closing price of $168.93 on volume of 2,016,389 shares. Over the past year the S&P 500 has risen 16.09% while CRSP is higher by 161.84%. CRSP lost -$3.25 per share the over the last 12 months.

Click Here to get the full Stock Score Report on Crispr Therapeutics AG (CRSP) Stock.

Subscribe to our daily morning update newsletter and never miss out on the need-to-know market news, movements, and more.

You May Also Like

View original post here:
Should Crispr Therapeutics AG (CRSP) be in Your Portfolio? - InvestorsObserver

Here with your Southeast Regional Ag Report, Im Tim Hammerich.

Its nearly impossible to talk about the Florida citrus industry in 2020, without at least mentioning citrus greening disease. Otherwise known as huanglongbing, citrus greening is spread by the asian citrus psyllid which serves as a vector for the disease.

Citrus greening has done enormous damage to the Florida citrus industry despite years of research to try to develop effective management tools. Scientists are now hopeful that CRISPR can help. The tool for editing genomes, allows breeders to select for very specific traits, and iterate more quickly.

And they have a roadmap to follow. CRISPR has been used to develop resistant varieties to citrus canker. A program started in 2013 was able to identify the citrus canker susceptibility gene in 2014, and through CRISPR found a way to knock out this susceptibility gene. They have now made, this year, citrus varieties that are resistant to citrus canker.

Dr. Nian Wong, professor at the Citrus Research at Education Center for the University of Florida IFAS at Lake Alfred, says they were able to make progress on citrus canker much quicker than traditional breeding, and he hopes this can also be applied to citrus greening.

While there can be no guarantees on timing, Dr. Wong hopes that progress can be made on citrus greening on a similar timeline to what theyve been able to do these past seven years with citrus canker.

Original post:
Can CRISPR Save Florida Citrus? - AG INFORMATION NETWORK OF THE WEST - AGInfo Ag Information Network Of The West

Apart from new findings on coronavirus every single day, the year was also filled with stories from outer space, archeology and anatomy

The year 2020 also termed as the year of the pandemic, social distancing, work from home, was also the year of research at breakneck speed. Virologists, immunologists, computational biologists, epidemiologists, and medical professionals across the globe turned into superheroes without capes.

Quick sequencing of the whole genome of the novel coronavirus (SARS-CoV-2) helped develop various test kits. We now have not one or two, but multiple COVID-19 vaccines that have succeeded in human clinical trials. Moderna's and Pfizer-BioNTechs vaccines that use messenger RNA have reported efficacy of about 95%, and the United Kingdom, the United States and the United Arab Emirates have already launched mass vaccinations.

Apart from new findings on coronavirus every single day, the year was also filled with stories from outer space, archeology and anatomy. Here is a list of a few of them in random order

In October, NASA confirmed, for the first time, water on the sunlit side of the Moon indicating that water may be distributed across the moons surface, and not limited to the cold and shadowed side.

Researchers from the Netherlands Cancer Institute announced in October that they have discovered a new pair of salivary glands hidden between the nasal cavity and throat. The team proposed the name tubarial glands and noted that this identification could help to explain and avoid radiation-induced side-effects such as trouble during eating, swallowing, and speaking.

In September, an international scientific team announced that they have spotted phosphine gas on Venus. On Earth, microorganisms that live in anaerobic (with no oxygen) environments produce phosphine. Massachusetts Institute of Technology molecular astrophysicist and study co-author Clara Sousa-Silva said in a release, This is important because, if it is phosphine, and if it is life, it means that we are not alone. It also means that life itself must be very common, and there must be many other inhabited planets throughout our galaxy.

Read our detailed explainer here.

In March, a person suffering from Leber congenital amaurosis, a rare inherited disease that leads to blindness, became the first to have CRISPR/Cas-9-based therapy directly injected into the body.

In June, two patients with beta-thalassemia and one with sickle cell disease had their bone marrow stem cells edited using CRISPR techniques.

Click here to read our explainer on the genome-editing tool that won this years Nobel Prize for Chemistry.

The year 2020 marks 100 years of discovery of Indus Valley Civilisation, and a new study showed that dairy products were being produced by the Harappans as far back as 2500 BCE.

Another study found the presence of animal products, including cattle and buffalo meat, in ceramic vessels dating back about 4,600 years.

Chinas Change-5 probe brought back about 1,731 grams of samples from the moon becoming the third country to bring moon samples after the U.S and Soviet Union.

Also, Japans Hayabusa 2 brought back the first extensive samples from an asteroid. The spacecraft, launched from Japan's Tanegashima space centre in 2014, took four years to reach the asteroid Ryugu before taking a sample and heading back to Earth in November 2019.

Mars rover Perseverance blasted off for the red planet on July 30 to bring the first Martian rock samples back to Earth. If all goes well, the rover will descend to the Martian surface on February 18, 2021.

You have reached your limit for free articles this month.

Find mobile-friendly version of articles from the day's newspaper in one easy-to-read list.

Enjoy reading as many articles as you wish without any limitations.

A select list of articles that match your interests and tastes.

Move smoothly between articles as our pages load instantly.

A one-stop-shop for seeing the latest updates, and managing your preferences.

We brief you on the latest and most important developments, three times a day.

Support Quality Journalism.

*Our Digital Subscription plans do not currently include the e-paper, crossword and print.

Excerpt from:
2020: The year science took centre-stage - The Hindu

For obvious reasons, 2020 will not go down as a good year. At the same time, it has brought more scientific progress than any year in recent memory and these advances will last long after COVID-19 as a major threat is gone.

Two of the most obvious and tangible signs of progress are the mRNA vaccines now being distributed across America and around the world. These vaccines appear to have very high levels of efficacy and safety, and they can be produced more quickly than more conventional vaccines. They are the main reason to have a relatively optimistic outlook for 2021. The mRNA technology also may have broader potential, for instance by helping to mend damaged hearts.

Other advances in the biosciences may prove no less stunning. A very promising vaccine candidate against malaria, perhaps the greatest killer in human history, is in the final stages of testing. Advances in vaccine technology have created the real possibility of a universal flu vaccine, and work is proceeding on that front. New CRISPR techniques appear on the verge of vanquishing sickle-cell anemia, and other CRISPR methods have allowed scientists to create a new smartphone-based diagnostic test that would detect viruses and offer diagnoses within half an hour.

It has been a good year for artificial intelligence as well. GPT-3 technology allows for the creation of remarkably human-like writing of great depth and complexity. It is a major step toward the creation of automated entities that can react in very human ways. DeepMind, meanwhile, has used computational techniques to make major advances in protein folding. This is a breakthrough in biology that may lead to the easier discovery of new pharmaceuticals.

One general precondition behind many of these advances is the decentralized access to enormous computing power, typically through cloud computing. China seems to be progressing with a photon method for quantum computing, a development that is hard to verify but could prove to be of great importance.

Computational biology, in particular, is booming. The Moderna vaccine mRNA was designed in two days, and without access to COVID-19 itself, a remarkable achievement that would not have been possible only a short while ago. This likely heralds the arrival of many other future breakthroughs from computational biology.

It also has been a good year for progress in transportation.

Driverless vehicles appeared to be stalled, but Walmart will be using them on some truck deliveries in 2021. Boom, a startup that is pushing to develop feasible and affordable supersonic flight, now has a valuation of over $1 billion, with prototypes expected next year. SpaceX achieved virtually every launch and rocket goal it had announced for the year. Toyota and other companies have announced major progress on batteries for electric vehicles, and the related products are expected to debut in 2021.

All this will prove a boon for the environment, as will progress in solar power, which in many settings is as cheap as any relevant alternative.

In previous eras, advances in energy and transportation typically have brought further technological advances, by enabling humans to conquer and reshape their physical environments in new and unexpected ways. We can hope that general trend will continue.

Finally, while not quite meeting the definition of a scientific advance, the rise of remote work is a real breakthrough. Many more Zoom meetings will be held, and many business trips will never return. Many may see this as a mixed blessing, but it will improve productivity significantly.

Without a doubt, it has been a tragic year. Alongside the sadness and failure, however, there has been quite a bit of progress. Thats something worth keeping in mind, even if we cant quite bring ourselves to celebrate, as we look back on 2020.

Tyler Cowen is a syndicated columnist.

Follow this link:
2020 was a tough year, but there is a silver lining - Boston Herald

Researchers in California aim to develop a new CRISPR-based test for COVID-19 that can be read anytime, anywhereby turning a basic smartphone camera into a microscope capable of detecting the coronavirus genetic material.

The team consists of scientists from the University of California, San Francisco, UC Berkeley, and the Gladstone Institutesincluding a collaboration with Jennifer Doudna, president of the Innovative Genomics Institute, and winner of the 2020 Nobel Prize in Chemistry for co-discovering CRISPR-Cas genome editing, the technology that underpins the test.

"It has been an urgent task for the scientific community to not only increase testingbut also to provide new testing options," said Melanie Ott, director of the Gladstone Institute of Virology and one of the leaders of a study evaluating the test, published in Cell. "The assay we developed could provide rapid, low-cost testing to help control the spread of COVID-19."

Benefits of 5KL When Outsourcing Late-phase Biologics Drug Substance Manufacturing

During this webinar, attendees will learn about Thermo Fisher Scientifics new 5KL bioreactor and how it benefits clients who outsource late-phase biologics drug substance manufacturing. An introduction of the 5KL bioreactor will be provided, as well as application data around performance and scalability, process economy comparison with traditional stainless steel bioreactors, and decision criteria that could be helpful in choosing between different cell culture strategies. Register Today!

The smartphone diagnostic aims to provide a positive or negative result in less than 30 minutes, as well as gauge the amounts of SARS-CoV-2 virus present in a nasal swab sample.

"When coupled with repeated testing, measuring viral load could help determine whether an infection is increasing or decreasing," said UC Berkeley bioengineer Daniel Fletcher, a Chan Zuckerberg Biohub investigator. "Monitoring the course of a patient's infection could help health care professionals estimate the stage of infection and predict, in real time, how long is likely needed for recovery."

RELATED: Jennifer Doudna's new CRISPR company will tackle disease detection

Most current molecular tests for COVID-19 are based on PCRa method that requires the virus RNA to be converted into DNA before the diagnostics can work. It also needs to amplify that DNA, by repeatedly making copies to capture a detectable signal, which calls for specialized chemical reagents and laboratory equipment.

Alternatively, the researchers approach uses CRISPR proteins designed to hunt directly for the virus RNA, skipping the conversion and amplification steps.

"One reason we're excited about CRISPR-based diagnostics is the potential for quick, accurate results at the point of need," said Doudna, whose CRISPR-focused company Mammoth Biosciences was tapped earlier this year by GlaxoSmithKline to develop an over-the-counter COVID-19 test.

"This is especially helpful in places with limited access to testing, or when frequent, rapid testing is needed. It could eliminate a lot of the bottlenecks we've seen with COVID-19," she said.

The new test uses a Cas13 protein tagged with a molecule that glows once its cut, as part of the genetic-snipping that occurs when it matches up with a specific piece of RNA. When more of the virus genome is present, more cuts occurcreating a brighter glow that can be picked up by a smartphone camera used with a darkened box.

RELATED: Stanford develops CRISPR 'lab on a chip' for detecting COVID-19

The team of researchers had originally been pursuing the quick testing method as a potential diagnostic for HIV, but pivoted to the coronavirus as the pandemic began to spread this year.

"We knew the assay we were developing would be a logical fit to help the crisis by allowing rapid testing with minimal resources," co-first author Parinaz Fozouni, a UCSF graduate student working in Ott's lab at Gladstone. "Instead of the well-known CRISPR protein called Cas9, which recognizes and cleaves DNA, we used Cas13, which cleaves RNA."

The study also found that samples with high concentrations of the virus produced a signal much faster, with positive results for someone who potentially more likely to be contagious delivered in under 5 minutes.

"Recent models of SARS-CoV-2 suggest that frequent testing with a fast turnaround time is what we need to overcome the current pandemic," said Ott. "We hope that with increased testing, we can avoid lockdowns and protect the most vulnerable populations."

In addition to being widely available and cheaper compared to lab equipment, smartphones could also make use of their GPS and digital connectivity to help track the spread of infections in various regions.

"We hope to develop our test into a device that could instantly upload results into cloud-based systems while maintaining patient privacy, which would be important for contact tracing and epidemiologic studies," Ott said. "This type of smartphone-based diagnostic test could play a crucial role in controlling the current and future pandemics."

See the rest here:
Pairing CRISPR with a smartphone camera, this COVID-19 test finds results in 30 minutes - FierceBiotech

Identifying and isolating individuals who may be contagious with the coronavirus is key to limiting the spread of the disease. But even months into the pandemic, many patients are still waiting days to receive COVID-19 test results.

Scientists at UC Berkeley and Gladstone Institutes have developeda new CRISPR-based COVID-19 diagnostic testthat, with the help of a smartphone camera, can provide a positive or negative result in 15 to 30 minutes. Unlike many other tests that are available, this test also gives an estimate of viral load, or the number of virus particles in a sample, which can help doctors monitor the progression of a COVID-19 infection and estimate how contagious a patient might be.

Monitoring the course of a patients infection could help health care professionals estimate the stage of infection and predict, in real time, how long is likely needed for recovery and how long the individual should quarantine, said Daniel Fletcher, a professor of bioengineering at Berkeley and one of the leaders of the study.

The technique was designed in collaboration with Dr. Melanie Ott, director of the Gladstone Institute of Virology, as well as Berkeley professor Jennifer Doudna, who is a senior investigator at Gladstone, president of the Innovative Genomics Institute and a Howard Hughes Medical Institute investigator. Doudna recently won the 2020 Nobel Prize in Chemistry for co-discovering CRISPR-Cas genome editing, the technology that underlies this work.

Most COVID-19 diagnostic tests rely on a method called PCR, short for polymerase chain reaction, which searches for pieces of the SARS-CoV-2 viral RNA in a sample. These PCR tests work by first isolating the viral RNA, then converting the RNA into DNA and then amplifying the DNA segments making many identical copies so that the segments can be more easily detected.

The new diagnostic test takes advantage of the CRISPR Cas13 protein, which directly binds and cleaves RNA segments. This eliminates the DNA conversion and amplification steps and greatly reduces the time needed to complete the analysis.

One reason were excited about CRISPR-based diagnostics is the potential for quick, accurate results at the point of need, Doudna said. This is especially helpful in places with limited access to testing or when frequent, rapid testing is needed. It could eliminate a lot of the bottlenecks weve seen with COVID-19.

In the test, CRISPR Cas13 proteins are programmed to recognize segments of SARS-CoV-2 viral RNA and then combined with a probe that becomes fluorescent when cleaved. When the Cas13 proteins are activated by the viral RNA, they start to cleave the fluorescent probe. With the help of a handheld device, the resulting fluorescence can be measured by the smartphone camera. The rate at which the fluorescence becomes brighter is related to the number of virus particles in the sample.

Recent models of SARS-CoV-2 suggest that frequent testing with a fast turnaround time is what we need to overcome the current pandemic, Ott said. We hope that with increased testing, we can begin to reopen economies and protect the most vulnerable populations.

Now that the CRISPR-based assay has been developed for SARS-CoV-2, it could be modified to detect RNA segments of other viral diseases, like the common cold, influenza or even human immunodeficiency virus. The team is currently working to package the test into a device that could be made available at clinics and other point-of-care settings and that one day could even be used in the home.

The eventual goal is to have a personal device, like a mobile phone, that is able to detect a range of different viral infections and quickly determine whether you have a common cold or SARS-Cov-2 or influenza, Fletcher said. That possibility now exists, and further collaboration between engineers, biologists and clinicians is needed to make that a reality.

See the original post here:
New CRISPR-based COVID-19 test uses smartphone cameras to spot virus RNA - University of California

A solid clinical trial update convinced several Wall Street analysts to raise their price targets for CRISPR Therapeutics (NASDAQ:CRSP) on Thursday. Those new expectations include a bold $170 target from investment bank Needham -- about 16% higher than the biotech's closing price Wednesday.

The candidate generating all this enthusiasm is CTX001, an experimental therapy for two hemoglobin-based disorders: beta-thalassemia and sickle cell disease. CRISPR Therapeutics is developing it in partnership with Vertex Pharmaceuticals (NASDAQ:VRTX). This single-application treatment involves reengineering a patient's own stem cells to produce fetal hemoglobin once they've been reinfused, and it appears to work as intended.

Image source: Getty Images.

At the latest update, seven beta-thalassemia patients had been under post-therapy observation for least three months, and so far, none have required transfusions. Among three patients with sickle cell disease who also have been observed for at least three months, none have experienced a vaso-occlusive crisis since undergoing the therapy.

CRISPR Therapeutics has also administered CTX001 to 10 patients who hadn't had their three-month observations in time for their data to be included in the company's recent presentation. In the summer of 2021, though, we should know if CTX001 has a shot at competing against LentiGlobin, an experimental treatment from bluebird bio (NASDAQ:BLUE).

LentiGlobin aims to treat the same limited groups of patients as CTX001, and it's been in development longer. Recently, bluebird bio published results from BCL11A, a treatment that more closely resembles CTX001, and the early data looks competitive.

There is a good chance that CTX001 and experimental cancer treatments rolling through CRISPR Therapeutics' pipeline will drive the stock to $170 and beyond. However, based on the potential for competition from bluebird bio, and considering the usual issues that clinical-stage biotechs must navigate, the company faces significant risks. Investors who buy this stock should only do so within a well-diversified portfolio.

Read more:
Is CRISPR Therapeutics Heading for $170? - The Motley Fool

Demonstrates modularity of Intellias in vivo liver insertion technology to durably restore protein, compared to traditional gene therapy

Single-course administration of genome editing system provides potentially curative approach to AAT deficiency

CAMBRIDGE, Mass., Dec. 12, 2020 (GLOBE NEWSWIRE) -- Intellia Therapeutics, Inc. (NASDAQ:NTLA), is presenting the first demonstration of physiological protein levels of human alpha-1 antitrypsin (AAT) in non-human primates (NHPs) following a single administration. Compared to traditional adeno-associated virus (AAV) gene therapy, Intellias targeted liver gene insertion technology has the ability to achieve therapeutic levels of protein expression, in a stable and durable manner, after a single course of treatment. The company is presenting these data today at the Alpha-1 Foundations 20th Gordon L. Snider Critical Issues Workshop: The Promise of Gene-Based Interventions of Alpha-1 Antitrypsin Deficiency.

Our new data reinforce the promise for Intellia to potentially cure a variety of rare genetic diseases requiring the restoration of a functional protein in the liver with a single-course therapy, said Intellia President and Chief Executive Officer John Leonard, M.D. Weve now demonstrated our platforms modularity and translatability to multiple targets of interest by inserting genes to durably produce unprecedented levels of protein in NHPs for hemophilia B and AAT deficiency. In parallel with advancing to the clinic treatments for other severe diseases, we will continue preclinical studies that further validate our wholly owned, CRISPR-based AAT deficiency treatment strategies for achieving normal AAT protein levels.

Presentation Details

Title: CRISPR/Cas9-Mediated Targeted Gene Insertion of SERPINA1 to Treat Alpha-1 Antitrypsin DeficiencySession: Gene EditingTime: 3:15 p.m. ETPresenting Author: Sean Burns, M.D., senior director of Intellias Disease Biology and Pharmacology group

Intellia is advancing multiple genome editing strategies that may treat both lung and liver manifestations of AAT deficiency (AATD), which occur due to mutations in the SERPINA1 gene. The normal human AAT protein levels Intellia achieved following targeted insertion of the human SERPINA1 gene remained stable through 11 weeks in an ongoing NHP study. The observed levels of human AAT protein produced from the liver may be therapeutically sufficient to restore protease inhibition to protect the lungs and liver from improperly regulated neutrophil elastase activity. The NHP data build on previous resultsshowing that consecutive in vivo genome editing (knockout plus insertion) achieved therapeutically relevant results in an AATD mouse model.

The findings being presented today reinforce recent data showing the use of the same proprietary insertion technology for targeted gene insertion ofFactor 9 resulted in circulating human Factor IX, a blood-clotting protein that is missing or defective in hemophilia B patients, that ranged from normal levels (50-150%)1 to supratherapeutic levels in a six-week NHP study. Intellia and Regeneron, the lead party, are co-developing potential hemophilia A and B CRISPR/Cas9-based treatments using their jointly developed targeted transgene insertion capabilities. Intellia is continuing to develop its proprietary platform to advance its wholly owned research programs, such as AATD. Click here to register for the Alpha-1 Foundations virtual workshop and here to view Intellias presentation on the companys website.

____________________________1 National Hemophilia Foundation

About Alpha-1 Antitrypsin Deficiency and Intellias Genome Editing Treatment Approach

The SERPINA1 gene normally encodes the alpha-1 antitrypsin (AAT) protein produced in the liver that is then secreted to protect the lungs. SERPINA1 mutations can cause AAT deficiency (AATD), a rare, genetic disease that commonly manifests in lung dysfunction, as well as in liver disease in some patients. Intellias targeted in vivo insertion platform uses a hybrid delivery system combining a non-viral lipid nanoparticle (LNP), which encapsulates CRISPR/Cas9 components, with an adeno-associated virus (AAV) carrying a donor DNA template to enable therapeutic protein production. One of the editing strategies Intellia is studying as a potential single-course AATD treatment is using the companys SERPINA1 gene insertion approach to restore normal human AAT protein levels. Intellia also is investigating a consecutive genome editing approach, in which the PiZ allele, the most prevalent disease-causing mutation of SERPINA1, is knocked out and the normal human SERPINA1 gene is inserted.

AboutIntellia TherapeuticsIntellia Therapeuticsis a leading genome editing company, focused on the development of proprietary, potentially curative therapeutics using the CRISPR/Cas9 system. Intellia believes the CRISPR/Cas9 technology has the potential to transform medicine by both producing therapeutics that permanently edit and/or correct disease-associated genes in the human body with a single treatment course, and creating enhanced engineered cells that can treat oncological and immunological diseases. Intellias combination of deep scientific, technical and clinical development experience, along with its leading intellectual property portfolio, puts it in a unique position to unlock broad therapeutic applications of the CRISPR/Cas9 technology and create new classes of therapeutic products. Learn more aboutIntellia and CRISPR/Cas9 atintelliatx.com. Follow us on Twitter@intelliatweets.

Forward-Looking Statements This press release contains forward-looking statements of Intellia Therapeutics, Inc. (Intellia or the Company) within the meaning of the Private Securities Litigation Reform Act of 1995. These forward-looking statements include, but are not limited to, express or implied statements regarding Intellias beliefs and expectations regarding its: plans to advance and complete preclinical studies, including any necessary non-human primate studies, for its hemophilia A, hemophilia B, and other in vivo and ex vivo research and development programs, such as its AATD research program; development of a proprietary LNP/AAV hybrid delivery system, as well as its modular platform to advance its complex genome editing capabilities, such as gene insertion, as well as knockout editing capabilities; advancement and expansion of its CRISPR/Cas9 technology to develop human therapeutic products, as well as its ability to maintain and expand its related intellectual property portfolio; ability to demonstrate its platforms modularity and replicate or apply results achieved in preclinical studies, including those in its hemophilia A and hemophilia B programs and its AATD research program, in any future studies, including human clinical trials; ability to develop other in vivo or ex vivo cell therapeutics of all types using CRISPR/Cas9 technology; expectations of the potential impact of the coronavirus disease 2019 pandemic on strategy, future operations and timing of its clinical trials or IND submissions; ability to optimize the impact of its collaborations on its development programs, including but not limited to its collaborations with Regeneron, including its co-development programs for hemophilia A and hemophilia B; statements regarding the timing of regulatory filings regarding its development programs; use of capital, expenses, future accumulated deficit and other 2020 financial results or in the future; and ability to fund operations at least through the next 24 months.

Any forward-looking statements in this press release are based on managements current expectations and beliefs of future events, and are subject to a number of risks and uncertainties that could cause actual results to differ materially and adversely from those set forth in or implied by such forward-looking statements. These risks and uncertainties include, but are not limited to: risks related to Intellias ability to protect and maintain its intellectual property position; risks related to Intellias relationship with third parties, including its licensors and licensees; risks related to the ability of its licensors to protect and maintain their intellectual property position; uncertainties related to the authorization, initiation and conduct of studies and other development requirements for its product candidates; the risk that any one or more of Intellias product candidates will not be successfully developed and commercialized; the risk that the results of preclinical studies or clinical studies will not be predictive of future results in connection with future studies; and the risk that Intellias collaborations with Regeneron or its other collaborations will not continue or will not be successful. For a discussion of these and other risks and uncertainties, and other important factors, any of which could cause Intellias actual results to differ from those contained in the forward-looking statements, see the section entitled Risk Factors in Intellias most recent annual report on Form 10-K as well as discussions of potential risks, uncertainties, and other important factors in Intellias other filings with the Securities and Exchange Commission. All information in this press release is as of the date of the release, and Intellia undertakes no duty to update this information unless required by law.

Intellia Contacts:

Media:Lynnea OlivarezDirectorExternal Affairs & Communications+1 956-330-1917lynnea.olivarez@intelliatx.com

Investors:Lina LiAssociate DirectorInvestor Relations+1 857-706-1612lina.li@intelliatx.com

Follow this link:
Intellia Therapeutics Achieves Normal Human Alpha-1 Antitrypsin Protein Levels in Non-Human Primates Through Targeted Gene Insertion for the Treatment...

Called de-extinction, the resurrection of lost species is one of the many applications to be revolutionized by the new gene-editing technology CRISPR-Cas9.

[A]ll scientists need are organic remnantssuch as pieces of bonethat contain fragments of DNA. Those fragments allow geneticists to discover the complete genome of the extinct animal (a process scientists refer to as sequencing). Once they have this recipe for the extinct species, CRISPR enables scientists to edit the DNA of its closest living relative to create a genome that, as edited, approximates the genetic code of the extinct species. Think of the living animals DNA as version 2.0 of a piece of software: the goal is to get back to version 1.0. You compare all of the millions of lines of code to spot differences, and then painstakingly edit the lines with differences to restore the code to its original state.

Once the DNA has been edited to reintroduce the key traits of the extinct plant or animal, the edited DNA is inserted into the nucleus of a reproducing cell. The resulting individual may not be genetically identical to the extinct species, but the key traits that made the extinct species unique are reintroduced.

Read the original post

Link:
De-extinction: Why CRISPR gene editing might be the most revolutionary development in science ever - Genetic Literacy Project

Bacteria readily acquires a sequence of other species DNA into their own, in specific areas that we now call CRISPR. In the lab, CRISPR was synthesized by linking together two guide RNA sequences into a format that would provide the target information and allow us to edit multiple genes simultaneously.

Cancer is a genetic disease, it works by creating certain changes to genes that control the way our cells function, especially how they grow and divide. Some rare cancers, sarcomas in particular, have been treated using CRISPR, which is why the gene-editing tool seems like a good diagnostic and therapeutic tool in the future of cancer treatments.

Obtaining rare cancerous tumors for research is difficult, but luckily organizations such as Pattern.org and the Rare Cancer Research Foundation (RCRF) come into play. These sister groups perform a matching program that enables patients to directly donate their tumor tissue and medical data to research. All the data generated by the project is freely available to the research community and is dedicated to open science.

Using Pattern.org, the Broad Institute of MIT and Harvard has created over 40 next-generation de-identified cancer models, Ms. Barbara Van Hare, Director of Foundation partnerships at RCRF said, These models and associated data will be shared within the worldwide research community.

After procuring these rare disease samples, Dr. Jesse Boehm from Eli and Edythe L. Broad Institute might have the answer to decipher the genetic landscape of cancer cells and use that to our advantage. Dr. Boehm is the scientific director of the Broad Institutes Cancer Dependency Map Initiative where he works on the cancer cell line factory project and the cancer dependency map.

Cancer samples are broken apart into cell models and are coaxed into growing in different conditions over a year-long time period. The data from these new cell models are then shared broadly with the world. This is a pipeline activity called the cell line factory. It is a part of an international effort to create a large reference data set, that is called the cancer dependency map.

The cancer dependency map has a two-pronged approach, first by testing cell lines against drugs and then pooled CRISPR screening. First, all cell lines are systematically tested against all drugs developed for any disease. Some known drugs have shown to be effective against certain cancers, clinical trials are swift as these are existing therapies.

There are 20,000 proteins in the human genome and only 6000 drug therapies. Only five percent of human genes can be targeted with drugs. The cancer dependency Map is completed with the help of CRISPR, Dr Boehm said.

Pooled CRISPR screening is used and 100,000 CRISPRs target every gene in the genome. Every cell is challenged with all these CRISPRs and at the end of the experiment, the abundance is compared to the beginning of the experiment.

CRISPR is used to snip genes,the DNA repairs creating a broken gene. Cells that are required for viability die and drop out of the population. CRISPRs are bar coded, so if by the end of the experiment the CRISPR is absent, it targets the gene that the cell needed to survive. The genes that drop out are good drug targets, most of these make way for drug discovery projects right away.

CRISPR is such a sharp tool, it inspires a lot more confidence than its predecessors, Dr Boehm said. He uses the analogy of Google Maps for this project: It needs to tell clinicians what to do and where to go, but for it to be relevant-the data needs to be dense enough in that area.

An additional therapy for cancers involves making four genetic modifications to T cells (immune cells that can kill cancer). It basically adds genes to T cells to fight cancer. One of these is a synthetic gene that gives the T cells a protein that can identify cancer cells better. CRISPR is also used to mute three genes that limit the cells cancer-killing abilities (Stadtmauer et al. 2020). With these limiting genes removed, the T cells are less inhibited to fight cancer.

These therapeutics and the Cancer dependency map will take a few decades to develop but will prove to be a very sharp tool in our arsenal against rare cancers when complete.

References:

Read the original post:
How CRISPR could help us discover and treat rare cancers - ZME Science

THURSDAY, Dec. 10, 2020 (HealthDay News) -- Use of the ex vivo CRISPR-Cas9-based gene-editing platform to edit the erythroid enhancer region of BCL11A in hematopoietic stem and progenitor cells, producing CTX001, results in increased hemoglobin (Hb) among patients with transfusion-dependent -thalassemia (TDT) and sickle cell disease (SCD), according to a study published online Dec. 5 in the New England Journal of Medicine to coincide with the annual meeting of the American Society of Hematology, held virtually from Dec. 5 to 8.

Haydar Frangoul, M.D., from the Sarah Cannon Center for Blood Cancer at the Children's Hospital at TriStar Centennial in Nashville, Tennessee, and colleagues presented safety and efficacy results from patients with at least three months of follow-up from two first-in-human studies of CTX001 for TDT and SCD. Data were included for seven patients with TDT and three with SCD.

The researchers found increases in total Hb and fetal Hb among all patients over time. Patients with TDT stopped receiving packed red blood cell transfusions soon after CTX001 infusion; the first patients with TDT who received CTX001 remained transfusion-free for more than 15 months. Since CTX001 infusion, the patients with SCD have had no vaso-occlusive crises (VOCs); the first patient to receive CTX001 remained VOC-free for more than one year. The safety profile after CTX001 infusion was generally consistent with busulfan myeloablation in all 10 patients. One patient with TDT had four serious adverse events related or possibly related to CTX001.

"By gene editing the patient's own stem cells we may have the potential to make this therapy an option for many patients facing these blood diseases," Frangoul said in a statement.

Several authors disclosed financial ties to pharmaceutical companies, including CRISPR Therapeutics and Vertex Pharmaceuticals, which sponsored the trial.

Press Release

Abstract

NEJM Brief Report (subscription or payment may be required)

More Information

The rest is here:
ASH: CRISPR-Cas9 Gene Editing Promising in TDT, SCD - HealthDay News

We cannot rewind the tape of life to see how we might have been and whether humans are inevitable products of evolutionary processes, but as Kevin Davies states in his lively and enthralling Editing Humanity: [The CRISPR Revolution and the New Era of Genome Editing], our unprecedented ability to engineer genomes rapidly and efficiently offers humankind the possibility of contemplating what we might become.

Benefiting from his presence at some of the key moments in gene-editing history, and armed with humor and an enthusiastic writing style, Davies provides a compelling account of CRISPRs discovery and the shenanigans accompanying its meteoric ascendance. These include the formation of biotechs, patent disputes, fallouts and disagreements over the limits of responsible editing.

All this culminated in the untimely and unethical use of CRISPR by the scientist He Jiankui to edit the germline DNA of human embryos, an irresponsible and cavalier act that affected the heredity of two girls forever. Daviess account of this sobering episode in CRISPRs short and turbulent history reminds us of the inherent dangers of genome editing and of the ease with which technologies may be subverted for totalitarian ends. Fortunately, many essential human characteristics, including free will, do not reduce to individual genes.

Read the original post

Read more:
Kevin Davies' 'Editing Humanity' explores the CRISPR revolution and the ethical dilemmas that await us - Genetic Literacy Project

It was a bumper year at the annual American Society of Hematology (ASH) meeting, with a slew of new data presented across the board. Here is a round-up of some of the key data presented.

Gilead eyes new first-line indication for CAR T Yescarta

Gileads Kite division presented new phase 2 data for its CAR T therapy Yescarta at ASH 2020 in relapsed or refractory high-risk large B-cell lymphoma (LBCL), a potential new indication.

In the phase 2 ZUMA-12 study, after a single infusion of Yescarta (axicabtagene ciloleucel), 85% of LBCL patients achieved a response, while 74% of patients achieved a complete response.

After a median follow-up of 9.5 months, the median progression-free survival, median overall survival and median duration of response were not yet reached.

Yescarta has already presented four-year survival data in patients with third-line refractory LBCL and we are now excited for what these ZUMA-12 results signal for its potential in earlier lines of treatment, said Ken Takeshita, global head of clinical development, Kite.

Yescarta was first approved by the US Food and Drug Administration (FDA) for the treatment of adult patients with relapsed or refractory large B-cell lymphoma after two or more lines of systemic therapy.

Eli Lilly and Loxos BTK inhibitor shows blood cancer promise

Eli Lillys Loxo Oncology revealed some promising early-stage results for its Brutons tyrosine kinase (BTK) inhibitor LOXO-305 in patients with chronic lymphocytic leukaemia (CLL) and small lymphocytic lymphoma (SLL).

LOXO-305, an oral BTK inhibitor, is designed to address acquired resistance to currently available BTK inhibitors, such as J&Js Imbruvica.

In the phase 1/2 study of the BTK inhibitor, out of 139 CLL/SLL patients who were efficacy-evaluable, 88 responded to treatment, with 19 partial responses with ongoing lymphocytosis, 45 with stable disease and one with progressive disease.

In a subgroup of patients previously treated with a BTK inhibitor, the overall response rate was 62%, which increased to 84% for those with ten months or more follow-up.

It is important to note that the patients included in this study were heavily pre-treated, with all CLL/SLL patients having received a median of three prior lines of therapy.

Vertex/CRISPR Therapeutics make headway in sickle cell and beta thalassaemia

Also presenting data at ASH were Vertex and CRISPR Therapeutics, whose gene-editing therapy CTX001 scored some promising results in transfusion-dependent beta thalassaemia (TDT) and sickle cell disease (SCD) patients.

The CRISPR/Cas9-based gene therapy was investigated in a total of ten patients, seven of which had TDT and three with SCD.

All TDT patients treated with CTX001 were transfusion independent at last follow-up and all SCD patients were free of vaso-occlusive crises (VOCs), the companies announced at the meeting.

These are the first published results from CRISPR/Cas9 therapy in people with a genetic disease and represent an important milestone in medicine and for our collaboration with CRISPR Therapeutics, said Reshma Kewalramani, chief executive officer and president, Vertex.

Most importantly, this data represents a critical step in our effort to bring transformative and potentially curative therapies to patients, he added.

bluebird bios beta thalassaemia gene therapy Zynteglo scores promising long-term data

bluebird bio also posted long-term data for its own beta thalassaemia gene therapy Zynteglo (betibeglogene autotemcel) at ASH 2020.

The new data reflects up to six years of safety and efficacy data for the gene therapy in patients with TDT.

Among 32 patients enrolled in the 13-year, long-term LTF-303 study, 64% of patients treated in the phase 1/2 portion and 90% in the phase 2 portion achieved transfusion independence (TI).

In the LTF-303 study, all patients who achieved TI remained free from transfusions, with the median duration of ongoing TI coming in at 39.4 months.

Continue reading here:
ASH 2020: Gilead eyes new Yescarta indication, Vertex/CRISPR make headway in sickle cell and more - PMLiVE

CiBER-seq dissects genetic networks

Cells integrate environmental signals and internal states to dynamically control gene expression. Muller et al. developed a technique to dissect this cellular logic by linking targeted, genome-wide genetic perturbations with a deep-sequencing readout that quantitatively measured the expression phenotype induced by each perturbation. The method, dubbed CiBER-seq, was able to recapitulate known regulatory pathways linking protein synthesis with nutrient availability in budding yeast cells. Unexpectedly, the authors found that the cellular logic also appears to consider protein production machinery in this decision. By uncovering additional facets of this deeply conserved pathway, the findings demonstrate the utility of comprehensive and quantitative CiBER-seq profiling in mapping the gene networks underlying cellular decisions.

Science, this issue p. eabb9662

Systematically profiling the effects of genetic perturbations is a powerful approach that has revealed the molecular basis for a wide range of biological phenomena. The simple, programmable DNA recognition of CRISPR-Cas9 enables genome-wide genetic analysis in human cells and many other systems. Cas9 is guided by a short RNA to a complementary sequence in the genome, where it can introduce mutations or alter gene expression. Pooled libraries of guide RNAs (gRNAs) that individually target each gene in the genome allow us to introduce genetic perturbations systematically into a population of cells. A key challenge is measuring the phenotypic effects caused by individual guides in these pooled libraries and linking these phenotypes back to the associated gRNA, thereby finding the gene that is responsible.

Molecular phenotypes such as gene expression changes provide a clear and sensitive measure for many cellular processes. We sought a general approach to profile how the expression of a particular gene of interest changed when other genes were perturbed. We began with a library of gRNAs, each disrupting one gene, and linked these guides with an expression reporter containing a guide-specific nucleotide barcode. gRNAs that alter reporter expression will change the abundance of the expressed RNA barcode specifically associated with that guide. Deep sequencing of these expressed barcodes quantifies each of these guide-specific reporter expression effects individually within a pooled, complex population. We have implemented this strategy by combining CRISPR interference (CRISPRi) with barcoded expression reporter sequencing (CiBER-seq).

We used CiBER-seq to profile the responses of several yeast promoters tied to a range of biological functions. Each promoter yielded a distinct pattern of responses that could be understood in terms of its known function and regulation. For example, we rediscover the control of MET6 expression by regulatory ubiquitylation and connect the bud scar protein Cwp1 to other genes required for budding and cytokinesis. Our analysis of the HIS4 promoter, a well-characterized target of the integrated stress response, yielded a range of genetic perturbations that activate this pathway by causing the accumulation of uncharged transfer RNAs (tRNAs). We also uncovered a notable role for tRNA depletion in this response, as impaired tRNA biogenesis activated HIS4 expression through a distinct pathway. In order to understand this regulation, we carried out genetic interaction analysis and looked for quantitative deviations in CiBER-seq profiles caused by the introduction of a second genetic perturbation. We also developed an indirect CiBER-seq approach to measure translational and posttranslational regulation, which both play roles in the signaling pathways upstream of HIS4.

CiBER-seq produces comprehensive phenotypic profiles that offer insights into gene function and regulation. These high-throughput and quantitative phenotypic measurements are also well suited for the systematic measurement of genetic interactions, which contain rich information about the operation of biological processes. This approach can be applied to study a wide range of transcriptional, translational, and posttranslational regulatory responses, and it has the potential to shed light on many areas of biology.

CRISPR-Cas9 gRNA cassettes are linked with transcriptional reporters containing specific barcodes. The RNA-to-DNA ratio for each barcode, measured by deep sequencing, reveals the reporter expression phenotype induced by each gRNA.

To realize the promise of CRISPR-Cas9based genetics, approaches are needed to quantify a specific, molecular phenotype across genome-wide libraries of genetic perturbations. We addressed this challenge by profiling transcriptional, translational, and posttranslational reporters using CRISPR interference (CRISPRi) with barcoded expression reporter sequencing (CiBER-seq). Our barcoding approach allowed us to connect an entire library of guides to their individual phenotypic consequences using pooled sequencing. CiBER-seq profiling fully recapitulated the integrated stress response (ISR) pathway in yeast. Genetic perturbations causing uncharged transfer RNA (tRNA) accumulation activated ISR reporter transcription. Notably, tRNA insufficiency also activated the reporter, independent of the uncharged tRNA sensor. By uncovering alternate triggers for ISR activation, we illustrate how precise, comprehensive CiBER-seq profiling provides a powerful and broadly applicable tool for dissecting genetic networks.

Link:
CiBER-seq dissects genetic networks by quantitative CRISPRi profiling of expression phenotypes - Science Magazine